We thank N. Dean for providing the original mCherry FP sequence, M. Gerami-Nejad for construction of plasmids, B. Larson for technical assistance, and T. Heisel for helpful advice during the development of this project. J.B. was supported by the European Research Council Advanced Award 340087 (RAPLODAPT). Microscopy and imaging systems were provided by the University of Minnesota Pediatrics Foundation and the University of Minnesota Imaging Center.

1. Isolate Template Plasmids from E. coli
<ol>
	<li>Grow E. coli containing the template plasmid overnight in 10 ml lysogeny broth (LB) + 200 mg/L ampicillin (AMP) at 37 &#176;C with shaking.</li>
	<li>Harvest cells by centrifuging at 6,000 x g for 2 min.</li>
	<li>Decant liquid, isolate and purify DNA from E. coli cells by a standard method as described previously in Ausubel et al.8.</li>
	<li>Resuspend DNA in Tris-EDTA (TE; 10 mM Tris, pH 8.0, 1 mM EDTA, pH 8.0) at a working concentration of 50-100 ng/ml.</li>
</ol>
2. Design Primers

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td fo:width="0.5in" style="width:50px">Primer</td>
			<td>Primer Sequence</td>
		</tr>
		<tr>
			<td>F1</td>
			<td>5&#39;&#160;GAGAATTGAAGAAGAGTTGGGAGACAATGCTATCTATGCTGGTAAGGACTTCCACAATGCTCAAACTTTG 
			GGTGGTTCTAAAGGTGAAGAATTATT 3&#39;</td>
		</tr>
		<tr>
			<td>R1</td>
			<td>5&#39;&#160;GAGCGTTTGCACCAACAGGCCATCATTTGTGACGAGAGAAGACCTGACGTCATTAGATTGGCACCTTTGC 
			GTAAAACGACGGCCAGTGAATTC 3&#39;</td>
		</tr>
		<tr>
			<td>F2</td>
			<td>5&#39;&#160;GAGAATTGAAGAAGAGTTGGGAGACAATGCTATCTATGCTGGTAAGGACTTCCACAATGCTCAAACTTTG 
			GGTGGTGTTTCAAAAGGTGAAGAAGATAAT 3&#39;</td>
		</tr>
		<tr>
			<td>R2</td>
			<td>5&#39;&#160;GAGCGTTTGCACCAACAGGCCATCATTTGTGACGAGAGAAGACCTGACGTCATTAGATTGGCACCTTTGC 
			ACTGGATGGCGGCGTTAGTATC 3&#39;</td>
		</tr>
	</tbody>
</table>
Table 1: Primer sequences used in this study. Bold italicized text indicates homology to the ENO1 genomic locus, normal font regions are homologous to plasmid DNA.
<ol>
	<li>Design primers to be homologous to plasmid sequences bordering the cassette to be amplified as well as to the 3&#39;-end of the target gene of interest (e.g. ENO1) to facilitate recombination into the gene&#39;s genomic locus (Figure 2 and Table 1).
	<ol>
		<li>Ensure that the forward primer sequences match the last 70 base pairs (bp) of the gene of interest, 5&#39;- 3&#39;, minus the stop codon, to maintain the coding frame, plus the first approximately 30 bp of the plasmid sequence to be amplified. As a note, the GGTGGTGGTT in each primer is a poly-glycine linker with no FP homology. Of note, in the absence of a linker, there can be direct fusion of functional domains, which can theoretically lead to protein misfolding, low yield in protein production, or impaired bioactivity.</li>
		<li>Ensure that the reverse primer sequences are 70 bp just downstream of gene, 3&#39;- 5&#39;, not including any gene sequence, plus the last approximately 30 bp of the nutritional or drug resistance marker used in the plasmid.</li>
		<li>Use F1 and R1 to generate GFP-NAT1 and YFP-NAT1 cassettes with pMG2120 and pMG2263, respectively and F2 and R2 to generate mCherry-NAT1 with pMG2343.</li>
	</ol>
	</li>
</ol>
3. Generate FP Cassettes by PCR (Day 1)
<ol>
	<li>Prepare reagents for PCR. Make a master mix (500 &#181;l final volume) by adding the following volumes and concentrations to a 1.5 ml tube: 50 &#181;l PCR buffer (500 mM potassium chloride, 100 mM Tris pH 8.0 in water), 20 &#181;l deoxynucleotides (dNTPs; stock mixture of nucleotides at 10 mM each), 40 &#181;l 25 mM magnesium chloride, 20 &#181;l purified plasmid (from ~50-100 ng/&#181;l stock solution), 10 &#181;l each forward and reverse primer (from 10 mM stock solutions), 30 &#181;l Taq polymerase (generic, 5,000 units/ml), and 320 &#181;l water.
	<ol>
		<li>Aliquot 50 &#181;l of master mix into each of 10 PCR-compatible 0.5 ml tubes.</li>
	</ol>
	</li>
	<li>Place PCR tubes in thermocycler and run the following steps: 1 cycle of 5 min at 94 &#176;C to denature dsDNA; 40 cycles sequentially of 45 sec at 94 &#176;C, 30 sec at 55 &#176;C to allow primers to anneal to plasmid template DNA, and 4 min at 68 &#176;C for extension of DNA products; and 1 final extension cycle of 15 min at 72 &#176;C. 
	NOTE: The PCR master mix and cycling parameters may need to be modified based on the particular Taq polymerase used.</li>
	<li>Pool all products from the 10 PCR reactions in a 1.5 ml tube.
	<ol>
		<li>Subject 5 &#181;l of pooled PCR product to agarose gel electrophoresis to verify amplicon size and obtain an estimate of product concentration, based on comparison to a DNA ladder. Generally, use ~250 &#181;g of cassette DNA in each subsequent transformation mix.</li>
		<li>Precipitate DNA by adding 50 &#181;l 3 M sodium acetate followed by 750 &#181;l 95% ethanol to the products and incubate at least 30 min at -20&#176; C.</li>
		<li>Harvest the PCR products by centrifuging the tube at 16,000 x g for 10 min. Carefully remove and discard the supernatant and dry the pellet overnight. Resuspend the dried DNA cassette pellet in 40 &#181;l TE pH 8.0 and store at room temperature until use.</li>
	</ol>
	</li>
</ol>
4. Transform Candida Cells with FP DNA Cassettes
<ol>
	<li>On Day 1, recover yeast strain to be transformed from a 15% glycerol frozen (-80 &#176;C) stock by streaking a few scraped crystals onto yeast peptone dextrose with adenine (YPAD) agar and incubate at 30 &#176;C. After recovery of colony growth, inoculate a single colony into 2 ml liquid YPAD medium in a glass culture tube with a breathable cap and incubate overnight at 30 &#176;C with agitation.</li>
	<li>On Day 2, dilute 300 &#181;l of overnight yeast culture into 50 ml fresh YPAD (to a final OD600 of ~0.2) in a 125 ml Erlenmeyer flask with a breathable cap. Shake at 30 &#176;C for ~3 hr (to a final OD600 ~0.6-0.8).
	<ol>
		<li>Pour the overnight culture into a 50 ml conical tube and pellet the cells by spinning for 5 min at 1 500 x g in a table top centrifuge.</li>
		<li>Pour off and properly discard the supernatant. Resuspend the cell pellet in 5 ml water. Re-pellet the cells by centrifuging again for 5 min at 1,500 x g in a table top centrifuge.</li>
		<li>Pour off and properly discard the supernatant. Resuspend the cells in 500 &#181;l TELiAc (TE lithium acetate: 10 mM Tris, pH 8.0, 1 mM EDTA, pH 8.0, 0.1 M lithium acetate) while transferring to a 1.5 ml tube. Centrifuge the tube for 2 min at 3,000 x g in a microcentrifuge.</li>
		<li>Resuspend cells in 250 &#181;l TELiAc. The total volume including the pellet should be ~300 &#181;l.</li>
	</ol>
	</li>
	<li>To a clean (different microfuge tube than in 4.2.4), add 5 &#181;l carrier DNA (10 mg/ml) and 150 &#181;l of prepared Candida cells (from 4.2.4). This is the negative control for transformation.
	<ol>
		<li>To a second clean microfuge tube, add 5 &#181;l of denatured carrier DNA (that has been boiled at 90 &#176;C for 10 min and cooled to 4 &#176;C), all 40 &#181;l of the prepared PCR product (from 3.3.1) and 150 &#181;l of prepared Candida cells (from 4.2.4).</li>
		<li>Incubate the two transformation mixes for 30 min at room temperature.</li>
		<li>To each transformation mix tube, add 700 &#181;l PLATE mix (10 mM Tris, pH 8.0, 1 mM EDTA, pH 8.0, 0.1 M lithium acetate in 50% polyethylene glycol 3350). Invert the tubes to mix and incubate them overnight at RT.</li>
	</ol>
	</li>
	<li>On Day 3, incubate the transformation mixes at 42 &#176;C for 1 hr (heat shock).
	<ol>
		<li>Centrifuge the transformation mixes for 30 sec at 16,000 x g in a microcentrifuge. Remove and properly discard the supernatant. Resuspend each of the cell pellets in 150 &#181;l water by gently pipetting up and down so as to not to damage the cells.</li>
		<li>For transformations utilizing auxotrophic marker genes (e.g. URA3), plate each entire mixture by pipetting the solutions onto the appropriate selective media agar (e.g. lacking uridine) and spread the mixture evenly using sterile glass beads.</li>
		<li>For transformations utilizing the nourseothricin resistance marker gene (NAT1), as described here, plate transformation mixes first onto non-selective YPAD agar and incubate at 30 &#176;C for 6-12 hr. This step aids in cell recovery, post heat shock, before nourseothricin stress is applied.</li>
		<li>After partial growth recovery, replica plate the Candida cells onto YPAD containing 400 &#181;g/ml nourseothricin. For transformations utilizing nutritional marker genes (e.g. URA3), this intermediate plating step is not needed and cells can be directly plated onto selective yeast media (e.g. YPAD lacking uridine) as described in 4.4.2. 
		NOTE: If the transformation is successful, colonies should appear within one to three days (potentially up to five days of outgrowth for selection on nourseothricin-containing agar). No colonies should appear on plates spread with transformation mixes containing carrier DNA alone (negative control).</li>
	</ol>
	</li>
	<li>For auxotrophic and nourseothricin marker selection, streak putative transformants as single colonies to fresh selective media agar plates and incubate at 30 &#176;C to propagate yeast cells that can be screened for successful construction of FP fusions.</li>
	<li>Screen transformants for correct integration of the tagging cassette (see Representative Results for a detailed example). If the gene of interest is expressed at sufficient amounts, whole colony fluorescence may occur such that it is possible to detect potential candidate integrants using a plate imaging system with fluorescence detection ability.
	<ol>
		<li>Check putative integrants by PCR using primers homologous to sequences outside of the region of integration to confirm fusion to the target gene.</li>
		<li>In addition, consider Western blot analysis to determine the expression and size of the fusion protein, as well as by fluorescence microscopy of single cells for visual confirmation of protein localization, if known.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Bendel, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colonization+and+epithelial+adhesion+in+the+pathogenesis+of+neonatal+candidiasis.">Colonization and epithelial adhesion in the pathogenesis of neonatal candidiasis.</a> Semin. Perinatol. 27 (5), 357-364 (2003).</li><li>Gerami-Nejad, M., Berman, J., Gale, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cassettes+for+PCR-mediated+construction+of+green,+yellow,+and+cyan+fluorescent+protein+fusions+in+Candida+albicans.">Cassettes for PCR-mediated construction of green, yellow, and cyan fluorescent protein fusions in Candida albicans.</a> Yeast. 18 (9), 859-864 (2001).</li><li>Gerami-Nejad, M., Dulmage, K., Berman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Additional+cassettes+for+epitope+and+fluorescent+fusion+proteins+in+Candida+albicans.">Additional cassettes for epitope and fluorescent fusion proteins in Candida albicans.</a> Yeast. 26 (7), 399-406 (2009).</li><li>Gerami-Nejad, M., Forche, A., McClellan, M., Berman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+protein+function+in+clinical+C.+albicans+isolates.">Analysis of protein function in clinical C. albicans isolates.</a> Yeast. 29 (8), 303-309 (2012).</li><li>Gerami-Nejad, M., Hausauer, D., McClellan, M., Berman, J., Gale, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cassettes+for+the+PCR-mediated+construction+of+regulatable+alleles+in+Candida+albicans.">Cassettes for the PCR-mediated construction of regulatable alleles in Candida albicans.</a> Yeast. 21 (5), 429-436 (2004).</li><li>Gonia, S., Larson, B., Gale, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR-mediated+gene+modification+strategy+for+construction+of+fluorescent+protein+fusions+in+Candida+parapsilosis.">PCR-mediated gene modification strategy for construction of fluorescent protein fusions in Candida parapsilosis.</a> Yeast. 33 (2), 63-69 (2016).</li><li>Milne, S. W., Cheetham, J., Lloyd, D., Aves, S., Bates, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cassettes+for+PCR-+mediated+gene+tagging+in+Candida+albicans+utilizing+nourseothricin+resistance.">Cassettes for PCR- mediated gene tagging in Candida albicans utilizing nourseothricin resistance.</a> Yeast. 28 (12), 833-841 (2011).</li><li>Ausubel, F. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Current Protocols in Molecular Biology. , (1995).</li><li>Wilson, R. B., Davis, D., Mitchell, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+hypothesis+testing+with+Candida+albicans+through+gene+disruption+with+short+homology+regions.">Rapid hypothesis testing with Candida albicans through gene disruption with short homology regions.</a> J. Bacteriol. 181 (6), 1868-1874 (1999).</li><li>Pulver, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rsr1+focuses+Cdc42+activity+at+hyphal+tips+and+promotes+maintenance+of+hyphal+development+in+Candida+albicans.">Rsr1 focuses Cdc42 activity at hyphal tips and promotes maintenance of hyphal development in Candida albicans.</a> Eukaryotic Cell. 12 (4), 482-495 (2013).</li><li>Falgier, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Candida+species+differ+in+their+interactions+with+immature+human+gastrointestinal+epithelial+cells.">Candida species differ in their interactions with immature human gastrointestinal epithelial cells.</a> Pediatr. Res. 69 (5), 384-389 (2011).</li><li>Nosek, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+manipulation+of+the+pathogenic+yeast+Candida+parapsilosis.">Genetic manipulation of the pathogenic yeast Candida parapsilosis.</a> Curr. Genet. 42 (1), 27-35 (2002).</li><li>Zemanova, J., Nosek, J., Tomaska, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-efficiency+transformation+of+the+pathogenic+yeast+Candida+parapsilosis.">High-efficiency transformation of the pathogenic yeast Candida parapsilosis.</a> Curr. Genet. 45 (3), 183-186 (2004).</li><li>Benjamin, D. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neonatal+candidiasis+among+extremely+low+birth+weight+infants:+risk+factors,+mortality+rates,+and+neurodevelopmental+outcomes+at+18+to+22+months.">Neonatal candidiasis among extremely low birth weight infants: risk factors, mortality rates, and neurodevelopmental outcomes at 18 to 22 months.</a> Pediatrics. 117 (1), 84-92 (2006).</li><li>Kullberg, B. J., Arendrup, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Invasive+Candidiasis.">Invasive Candidiasis.</a> N Engl J Med. 373 (15), 1445-1456 (2015).</li></ol>

The authors have nothing to disclose.

Construction of epitope tagged sequences in Candida species using the PCR-mediated gene modification strategy described above can be summarized as a three-step process. First, a cassette is made by PCR that encodes both the sequence desired for integration and regions homologous to the locus of insertion into the yeast genome. Second, the yeast cells to be transformed are made chemically competent with lithium acetate and co-incubated with the cassette. Third, the cells are plated on selective media to recover t...

Candida species are commensal fungi that colonize the intestinal and genitourinary tracts of all humans. Under conditions of immunodeficiency, such as that occur with premature birth or immunosuppressive effects from treatments for cancer, Candida species can become opportunistic pathogens. Of the Candida species, Candida albicans is the most prevalent fungal colonizer and causes the majority of invasive fungal infections. Other Candida species such as C. glabrata, C. parapsilosis, C. tropicalis, and C. kruseii also cause serious infections in immunocompromised patients, with some exhibiting intrinsic resistance to commonly used anti-fungal antibiotics such as fluconazole and amphotericin B. Hence, infections with some of these species are being observed more frequently, especially in patients being treated prophylactically with anti-fungal agents. Even with appropriate and timely anti-fungal treatment, invasive Candida infections continue to be associated with significant morbidity and mortality1. Because of the significance of Candida species in human health, there is a need for readily available molecular tools that allow the study and elucidation of their pathogenesis mechanisms.
One important tool that allows researchers to visualize and quantify microbial cells and the proteins that they express is FP fusion technology. Polymerase chain reaction (PCR)-mediated gene modification, as described in this paper, allows the construction of fusions, between FP sequences and a Candida protein coding sequence of interest at its genomic locus. Stable integration of the construct facilitates analysis of protein expression as well as protein localization dynamics. Plasmids containing FP sequences, optimized for expression in Candida albicans and that can be used in the PCR-mediated gene modification strategy, have been previously constructed2,3,4,5. Plasmids contain FP transformation &#34;cassettes&#34;: a FP sequence linked to a nutritional marker gene that facilitates the transformation of C. albicans and C. parapsilosis2,3,4,5,6,7. Currently available plasmids contain a variety of selectable nutritional marker genes (URA3, HIS1, ARG4) for transformation of auxotrophic strains as well as a dominant drug resistance marker (NAT1), which facilitates transformation of clinical strains lacking auxotrophies. In addition, plasmids contain options for up to four different FP sequences (green [GFP], yellow [YFP], cyan [CFP], and cherry [mCherry]) and either an ADH1 termination sequence for construction of carboxy-terminus protein fusions, or a promoter sequence for construction of amino-terminus protein fusions. Primers are designed with homology to the plasmid DNA surrounding the FP cassette. In addition, the primers also contain 5&#39;-extension sequences bearing homology to the yeast gene of interest to be tagged, which facilitates integration of the cassette into the genomic locus via homologous recombination (Figure 1). Gene-specific FP cassettes are generated by PCR and then transformed into Candida cells made competent for uptake of DNA by treatment with lithium acetate.
<img alt="Figure 1" src="/files/ftp_upload/55333/55333fig1.jpg" /> 
Figure 1: Diagram of how FP sequence fusions are generated in Candida species. (A) Plasmid DNA includes a FP sequence and a sequence encoding nourseothricin resistance (NAT1). Relative locations of Forward (FWD) and reverse (REV) primers are shown, with black portions of the primers indicating the region of homology to the plasmid sequence and the purple portions denoting the gene-specific homology region or primer extension. (B) FP cassettes are transformed into Candida and integrate within the ENO1 genomic locus via homologous recombination (dotted lines). (C) Resulting FP fusion sequence at the 3&#39;end of ENO1. <a href="http://cloudflare.jove.com/files/ftp_upload/55333/55333fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Herein, we present an example of protein fusion (Eno1-FP) constructions in Candida species. We use tagging plasmids containing the NAT1 transformation marker gene along with sequences encoding GFP, YFP, or mCherry (Figure 2). These plasmids are used along with primers in PCR to generate gene-specific cassettes that facilitate fusion of FPs to the 3&#39;-end of ENO1, resulting in expression of Eno1 fused to FPs at its carboxy-terminus.
<img alt="Figure 2" src="/files/ftp_upload/55333/55333fig2.jpg" /> 
Figure 2: Maps of FP cassette-containing plasmids. Forward (F) and reverse (R) primers used to generate the cassettes from the plasmids are indicated along with the relative location of their homology to the plasmids. Primer sequences are as listed in Table 1. F1 and R1 were also used to generate the pYFP-NAT1 cassette. The plasmid containing the YFP-NAT1 cassette (pMG2263) is identical to pMG2120 with the exception of YFP in place of the GFP sequence. Cassette sizes: GFP-NAT1, 3.7 kbp; mCherry-NAT1, 3.2 kbp; YFP-NAT1, 3.7 kbp. This figure has been modified from Gerami-Nejad, et al.4 <a href="http://cloudflare.jove.com/files/ftp_upload/55333/55333fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

<table><tbody><tr><td>100 W mercury lamp</td><td>CHIU Technical Corporation</td><td>M-100T</td><td></td></tr><tr><td>95% Ethanol</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Adenine</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Ampicillin</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Carrier DNA</td><td>Ambion</td><td>AM9680</td><td>Sheared Salmon Sperm DNA 10 mg/ml</td></tr><tr><td>CCD Camera</td><td>Photometrics</td><td>CoolSNAP HQ</td><td></td></tr><tr><td>Conical Tube</td><td>Corning</td><td>430828</td><td>50 ml</td></tr><tr><td>Culture Tube Rotator</td><td>New Brunswick</td><td>2013923</td><td>TC-8, or Any Culture Tube Rotator</td></tr><tr><td>Deoxynucleotides (dNTP) PCR Grade</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Eppendorf Tubes</td><td>Eppendorf</td><td>022363719, 022363212</td><td>0.5 ml, 1.5 ml</td></tr><tr><td>Erlenmeyer Flask</td><td>Fisher Scientific</td><td>7250089</td><td>125 ml</td></tr><tr><td>Ethylenediaminetetraacetic Acid (EDTA)</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Freezer (-80 &amp;deg;C)</td><td>Thermo Electron Corporation</td><td>ULT-1386-9-V</td><td>Revco Ultima II</td></tr><tr><td>GFP, YFP and Texas Red Filter Sets</td><td>Chroma Technology Corporation</td><td>49002, 86004v2, 49008</td><td></td></tr><tr><td>Glass culture tubes</td><td>Fisher Scientific</td><td>1496126</td><td>75 mm</td></tr><tr><td>HRP goat anti-mouse antibody</td><td>Santa Cruz Biotechnology</td><td>SC-2005</td><td></td></tr><tr><td>HRP goat anti-rabbit antibody</td><td>Santa Cruz Biotechnology</td><td>SC-2301</td><td></td></tr><tr><td>Incubator (30 &amp;deg;C)</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Lithium Acetate</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Lysogeny Broth (LB) Media</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Magnesium Chloride</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Microcentrifuge</td><td>Eppendorf</td><td>5415 D</td><td></td></tr><tr><td>Microscope</td><td>Nikon</td><td>E600</td><td>Nikon Eclipse E600</td></tr><tr><td>Microscope Image Analysis Software</td><td>Universal Imaging Corporation</td><td>6.3r7</td><td>MetaMorph Software Series 6.3r7</td></tr><tr><td>Mouse anti-GFP antibody</td><td>Roche</td><td>11814460001</td><td></td></tr><tr><td>Nourseothricin</td><td>Fisher Scientific</td><td>50997939</td><td></td></tr><tr><td>PCR Thermocycler</td><td>Applied Biosystems</td><td>9700</td><td>GeneAmp PCR System</td></tr><tr><td>PCR tubes</td><td>BioExpress, GeneMate</td><td>T-3035-1</td><td>0.2 ml</td></tr><tr><td>Polyethylene Glycol 3350</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Potassium Chloride</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Rabbit anti-mCherry antibody</td><td>BioVision</td><td>5993-100</td><td></td></tr><tr><td>Refrigerator (4 &amp;deg;C)</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Sodium Acetate</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Stereomicroscope</td><td>Nikon</td><td>SMZ1500</td><td></td></tr><tr><td>Table Top Centrifuge</td><td>Labnet</td><td>Z 400</td><td>Hermle Z 400</td></tr><tr><td>&lt;em&gt;Taq&lt;/em&gt; DNA Polymerase</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Tris(hydroxymethyl)aminomethane (Tris)</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Vortex Mixer</td><td>Scientific Industries</td><td>SI-0236</td><td>Vortex Genie 2</td></tr><tr><td>Yeast Extract Peptone Dextrose (YPD) Media</td><td>Any</td><td>NA</td><td></td></tr></tbody></table>

generation of fluorescent protein fusions in candida species

Candida species, prevalent colonizers of the intestinal and genitourinary tracts, are the cause of the majority of invasive fungal infections in humans. Thus, molecular and genetic tools are needed to facilitate the study of their pathogenesis mechanisms. PCR-mediated gene modification is a straightforward and quick approach to generate epitope-tagged proteins to facilitate their detection. In particular, fluorescent protein (FP) fusions are powerful tools that allow visualization and quantitation of both yeast cells and proteins by fluorescence microscopy and immunoblotting, respectively. Plasmids containing FP encoding sequences, along with nutritional marker genes that facilitate the transformation of Candida species, have been generated for the purpose of FP construction and expression in Candida. Herein, we present a strategy for constructing a FP fusion in a Candida species. Plasmids containing the nourseothricin resistance transformation marker gene (NAT1) along with sequences for either green, yellow, or cherry FPs (GFP, YFP, mCherry) are used along with primers that include gene-specific sequences in a polymerase chain reaction (PCR) to generate a FP cassette. This gene-specific cassette has the ability to integrate into the 3'-end of the corresponding gene locus via homologous recombination. Successful in-frame fusion of the FP sequence into the gene locus of interest is verified genetically, followed by analysis of fusion protein expression by microscopy and/or immuno-detection methods. In addition, for the case of highly expressed proteins, successful fusions can be screened for primarily by fluorescence imaging techniques.

As an example, we used the protocol described above to construct GFP and mCherry fusions to Eno1 in a C. parapsilosis laboratory strain. Each putative transformant was initially restreaked for growth. In this example, since the resultant fusion protein is highly expressed (enolase) and the FPs are bright, we were able to screen transformants by fluorescence microscopy prior to performing diagnostic PCR (Figure 3)6.
<p class="jove_conte...

Watch this Scientific Journal Video about Generation of Fluorescent Protein Fusions in Candida Species at JoVE.com

Generation of Fluorescent Protein Fusions in Candida Species

PCR-mediated gene modification can be used to generate fluorescent protein fusions in Candida species, which facilitates visualization and quantitation of yeast cells and proteins. Herein, we present a strategy for constructing a fluorescent protein fusion (Eno1-FP) in Candida parapsilosis.

Generation of Fluorescent Protein Fusions in Candida Species

Candida species, prevalent colonizers of the intestinal and genitourinary tracts, are the cause of the majority of invasive fungal infections in humans. ...

generation-of-fluorescent-protein-fusions-in-candida-species

Research

JoVE Journal

Genetics

10.6K Views.  University of Minnesota.  PCR-gemedieerde genetische modificatie kan worden gebruikt voor fluorescent proteïne fusies in Candida soorten die visualisatie en kwantificering van gistcellen en eiwitten vergemakkelijkt genereren. Hierin presenteren we een strategie voor het construeren van een fluorescerend eiwit fusie (Eno1-FP) Candida parapsilosis. 

Video: Generation of Fluorescent Protein Fusions in Candida Species

The C. elegans Excretory Canal as a Model for Intracellular Lumen Morphogenesis and In Vivo Polarized Membrane Biogenesis in a Single Cell: labeling by GFP-fusions, RNAi Interaction Screen and Imaging

The four C. elegans excretory canals are narrow tubes extended through the length of the animal from a single cell, with almost equally far extended intracellular endotubes that build and stabilize the lumen with a membrane and submembraneous cytoskeleton of apical character. The excretory cell expands its length approximately 2,000 times to generate these canals, making this model unique for the in vivo assessment of de novo polarized membrane biogenesis, intracellular lumen morphogenesis and unicellular tubulogenesis. The protocol presented here shows how to combine standard labeling, gain- and loss-of-function genetic or RNA interference (RNAi)-, and microscopic approaches to use this model to visually dissect and functionally analyze these processes on a molecular level. As an example of a labeling approach, the protocol outlines the generation of transgenic animals with fluorescent fusion proteins for live analysis of tubulogenesis. As an example of a genetic approach, it highlights key points of a visual RNAi-based interaction screen designed to modify a gain-of-function cystic canal phenotype. The specific methods described are how to: label and visualize the canals by expressing fluorescent proteins; construct a targeted RNAi library and strategize RNAi screening for the molecular analysis of canal morphogenesis; visually assess modifications of canal phenotypes; score them by dissecting fluorescence microscopy; characterize subcellular canal components at higher resolution by confocal microscopy; and quantify visual parameters. The approach is useful for the investigator who is interested in taking advantage of the C. elegans excretory canal for identifying and characterizing genes involved in the phylogenetically conserved processes of intracellular lumen and unicellular tube morphogenesis.

The C. elegans Excretory Canal as a Model for Intracellular Lumen Morphogenesis and In Vivo Polarized Membrane Biogenesis in a Single Cell: labeling by GFP-fusions, RNAi Interaction Screen and Imaging

The C. elegans excretory canal is a unique single-cell model for the visual in vivo analysis of de novo polarized membrane biogenesis. This protocol describes a combination of standard genetic/RNAi and imaging approaches, adaptable for the identification and characterization of molecules directing unicellular tubulogenesis, and apical membrane and lumen biogenesis.

The four C. elegans excretory canals are narrow tubes extended through the length of the animal from a single cell, with almost equally far extended ...

Developmental Biology

Biolistic Transformation of a Fluorescent Tagged Gene into the Opportunistic Fungal Pathogen Cryptococcus neoformans

The basidiomycete Cryptococcus neoformans, an invasive opportunistic pathogen of the central nervous system, is the most frequent cause of fungal meningitis worldwide resulting in more than 625,000 deaths per year worldwide.&#160;Although electroporation has been developed for the transformation of plasmids in Cryptococcus, only&#160;biolistic&#160;delivery provides&#160;an effective means to transform&#160;linear&#160;DNA&#160;that can be integrated into the genome by homologous recombination.&#160;
Acetate has been shown to be a major fermentation product during cryptococcal infection, but the significance of this is not yet known.&#160;A bacterial pathway composed of the enzymes xylulose-5-phosphate/fructose-6-phosphate phosphoketolase (Xfp) and acetate kinase (Ack) is one of three potential pathways for acetate production in C. neoformans. Here, we demonstrate the biolistic transformation of a construct, which has the gene encoding Ack fused to the fluorescent tag mCherry, into&#160;C. neoformans. We then confirm integration of the ACK-mCherry fusion into the&#160;ACK&#160;locus.

Biolistic Transformation of a Fluorescent Tagged Gene into the Opportunistic Fungal Pathogen Cryptococcus neoformans

Biolistic transformation is a method used to generate stable integration of DNA into the genome of the opportunistic pathogen Cryptococcus neoformans through homologous recombination. We will demonstrate biolistic transformation of a construct, which has the gene encoding acetate kinase fused to the fluorescent tag mCherry into&#160;C. neoformans.

The basidiomycete Cryptococcus neoformans, an invasive opportunistic pathogen of the central nervous system, is the most frequent cause of fungal ...

Immunology and Infection

Visualizing Yeast Organelles with Fluorescent Protein Markers

The budding yeast, Saccharomyces cerevisiae, is a classic model system in studying organelle function and dynamics. In our previous works, we have constructed fluorescent protein-based markers for major organelles and endomembrane structures, including the nucleus, endoplasmic reticulum (ER), Golgi apparatus, endosomes, vacuoles, mitochondria, peroxisomes, lipid droplets, and autophagosomes. The protocol presented here describes the procedures for using these markers in yeast, including DNA preparation for yeast transformation, selection and evaluation of transformants, fluorescent microscopic observation, and the expected outcomes. The text is geared toward researchers who are entering the field of yeast organelle study from other backgrounds. Essential steps are covered, as well as technical notes about microscope hardware considerations and several common pitfalls. It provides a starting point for people to observe yeast subcellular entities by live-cell fluorescent microscopy. These tools and methods can be used to identify protein subcellular localization and track organelles of interest in time-lapse imaging.

Here we describe the use of a set of fluorescent protein-based organelle markers in live-cell imaging of the budding yeast, Saccharomyces cerevisiae.

The budding yeast, Saccharomyces cerevisiae, is a classic model system in studying organelle function and dynamics. In our previous works, we have ...

Biochemistry

In vivo Quantification of G Protein Coupled Receptor Interactions using Spectrally Resolved Two-photon Microscopy

The study of protein interactions in living cells is an important area of research because the information accumulated both benefits industrial applications as well as increases basic fundamental biological knowledge. F&ouml;rster (Fluorescence) Resonance Energy Transfer (FRET) between a donor molecule in an electronically excited state and a nearby acceptor molecule has been frequently utilized for studies of protein-protein interactions in living cells. The proteins of interest are tagged with two different types of fluorescent probes and expressed in biological cells. The fluorescent probes are then excited, typically using laser light, and the spectral properties of the fluorescence emission emanating from the fluorescent probes is collected and analyzed. Information regarding the degree of the protein interactions is embedded in the spectral emission data. Typically, the cell must be scanned a number of times in order to accumulate enough spectral information to accurately quantify the extent of the protein interactions for each region of interest within the cell. However, the molecular composition of these regions may change during the course of the acquisition process, limiting the spatial determination of the quantitative values of the apparent FRET efficiencies to an average over entire cells. By means of a spectrally resolved two-photon microscope, we are able to obtain a full set of spectrally resolved images after only one complete excitation scan of the sample of interest. From this pixel-level spectral data, a map of FRET efficiencies throughout the cell is calculated. By applying a simple theory of FRET in oligomeric complexes to the experimentally obtained distribution of FRET efficiencies throughout the cell, a single spectrally resolved scan reveals stoichiometric and structural information about the oligomer complex under study. Here we describe the procedure of preparing biological cells (the yeast Saccharomyces cerevisiae) expressing membrane receptors (sterile 2 &alpha;-factor receptors) tagged with two different types of fluorescent probes. Furthermore, we illustrate critical factors involved in collecting fluorescence data using the spectrally resolved two-photon microscopy imaging system. The use of this protocol may be extended to study any type of protein which can be expressed in a living cell with a fluorescent marker attached to it.

In vivo Quantification of G Protein Coupled Receptor Interactions using Spectrally Resolved Two-photon Microscopy

By employing a spectrally resolved two-photon microscopy imaging system, pixel-level maps of F&ouml;rster Resonance Energy Transfer (FRET) efficiencies are obtained for cells expressing membrane receptors hypothesized to form homo-oligomeric complexes. From the FRET efficiency maps, we are able to estimate stoichiometric information about the oligomer complex under study.

The study of protein interactions in living cells is an important area of research because the information accumulated both benefits industrial ...

Biology

Quantitative Live Cell Fluorescence-microscopy Analysis of Fission Yeast

Several microscopy techniques are available today that can detect a specific protein within the cell. During the last decade live cell imaging using fluorochromes like Green Fluorescent Protein (GFP) directly attached to the protein of interest has become increasingly popular 1. Using GFP and similar fluorochromes the subcellular localisations and movements of proteins can be detected in a fluorescent microscope. Moreover, also the subnuclear localisation of a certain region of a chromosome can be studied using this technique. GFP is fused to the Lac Repressor protein (LacR) and ectopically expressed in the cell where tandem repeats of the lacO sequence has been inserted into the region of interest on the chromosome2. The LacR-GFP will bind to the lacO repeats and that area of the genome will be visible as a green dot in the fluorescence microscope. Yeast is especially suited for this type of manipulation since homologous recombination is very efficient and thereby enables targeted integration of the lacO repeats and engineered fusion proteins with GFP 3. Here we describe a quantitative method for live cell analysis of fission yeast. Additional protocols for live cell analysis of fission yeast can be found, for example on how to make a movie of the meiotic chromosomal behaviour 4. In this particular experiment we focus on subnuclear organisation and how it is affected during gene induction. We have labelled a gene cluster, named Chr1, by the introduction of lacO binding sites in the vicinity of the genes. The gene cluster is enriched for genes that are induced early during nitrogen starvation of fission yeast 5. In the strain the nuclear membrane (NM) is labelled by the attachment of mCherry to the NM protein Cut11 giving rise to a red fluorescent signal. The Spindle Pole body (SPB) compound Sid4 is fused to Red Fluorescent Protein (Sid4-mRFP) 6. In vegetatively growing yeast cells the centromeres are always attached to the SPB that is embedded in the NM 7. The SPB is identified as a large round structure in the NM. By imaging before and 20 minutes after depletion of the nitrogen source we can determine the distance between the gene cluster (GFP) and the NM/SPB. The mean or median distances before and after nitrogen depletion are compared and we can thus quantify whether or not there is a shift in subcellular localisation of the gene cluster after nitrogen depletion.

The fission yeast, Schizosaccharomyces pombe, is a good model system to study basic cellular processes. Here we describe a method to perform quantitative live cell analysis of fission yeast. In this particular experiment we focus on organisation of the genome within the cell nucleus, but the method can also be used to study cytosolic factors.

Several microscopy techniques are available today that can detect a specific protein within the cell. During the last decade live cell imaging using ...

Use of In Vivo Imaging to Screen for Morphogenesis Phenotypes in Candida albicans Mutant Strains During Active Infection in a Mammalian Host

Candida albicans is an important human pathogen. Its ability to switch between morphologic forms is central to&#160;its pathogenesis; these morphologic changes are regulated by a complex signaling network controlled in response to environmental stimuli. These regulatory components have been highly studied, but almost all studies use a variety of in vitro stimuli to trigger filamentation. To determine how morphogenesis is regulated during the pathogenesis process, we developed an in vivo microscopy system to obtain high spatial resolution images of organisms undergoing hyphal formation within the mammalian host. The protocol presented here describes the use of this system to screen small collections of C. albicans mutant strains, allowing us to identify key regulators of morphogenesis as it occurs at the site of infection. Representative results are presented, demonstrating that some regulators of morphogenesis, such as the transcriptional regulator Efg1, have consistent phenotypes in vitro and in vivo, whereas other regulators, such as adenyl cyclase (Cyr1), have significantly different phenotypes in vivo compared to in vitro.

Use of In Vivo Imaging to Screen for Morphogenesis Phenotypes in Candida albicans Mutant Strains During Active Infection in a Mammalian Host

This manuscript describes a method for screening moderately sized Candida albicans mutant libraries for morphogenesis phenotypes during active infection in a mammalian host using non-invasive confocal microscopy.

Candida albicans is an important human pathogen. Its ability to switch between morphologic forms is central to&#160;its pathogenesis; these morphologic ...

Establishing a Mouse Model for Candida albicans-Associated Catheter-Related Infection

A Catheter-Related Candida albicans Infection Model in Mouse

Catheter-related infection (CRI) is a common nosocomial infection caused by candida albicans during catheter implantation. Typically, biofilms are formed on the outer surface of the catheter and lead to disseminated infections, which are fatal to patients. There are no effective prevention and treatment management in clinics. Therefore, it is urgent to establish an animal model of CRI for the preclinical screening of new strategies for its prevention and treatment. In this study, a polyethylene catheter, a widely used medical catheter, was inserted into the back of the BALB/c mice after hair removal. Candida albicans ATCC MYA-2876 (SC5314) expressing enhanced green fluorescent protein was subsequently inoculated on the skin's surface along the catheter. Intense fluorescence was observed on the surface of the catheter under a fluorescent microscope 3 days later. Mature and thick biofilms were found on the surface of the catheter via scanning electron microscopy. These results indicated the adhesion, colonization, and biofilm formation of candida albicans on the surface of the catheter. The hyperplasia of the epidermis and the infiltration of inflammatory cells in the skin specimens indicated the histopathological changes of the CRI-associated skin. To sum up, a mouse CRI model was successfully established. This model is expected to be helpful in the research and development of therapeutic management for candida albicans associated CRI.

Author Spotlight: Enhancing Candida albicans Detection in Catheter Infections Using Fluorescent Protein Tagging 

We establish a mouse model of C.albicans-associated catheter-related infection (CRI), in which biofilm forms on the catheter, and the interaction between C.albicans and host correlates well with the clinical CRI. This model helps screen therapies for C.albicans biofilm-associated CRI, laying a foundation for clinical transformation.

Catheter-related infection (CRI) is a common nosocomial infection caused by candida albicans during catheter implantation. Typically, biofilms are formed ...

Microscopy of Fission Yeast Sexual Lifecycle

The fission yeast Schizosaccharomyces pombe has been an invaluable model system in studying the regulation of the mitotic cell cycle progression, the mechanics of cell division and cell polarity. Furthermore, classical experiments on its sexual reproduction have yielded results pivotal to current understanding of DNA recombination and meiosis. More recent analysis of fission yeast mating has raised interesting questions on extrinsic stimuli response mechanisms, polarized cell growth and cell-cell fusion. To study these topics in detail we have developed a simple protocol for microscopy of the entire sexual lifecycle. The method described here is easily adjusted to study specific mating stages. Briefly, after being grown to exponential phase in a nitrogen-rich medium, cell cultures are shifted to a nitrogen-deprived medium for periods of time suited to the stage of the sexual lifecycle that will be explored. Cells are then mounted on custom, easily built agarose pad chambers for imaging. This approach allows cells to be monitored from the onset of mating to the final formation of spores.

We provide a reproducible basic method for the long-term microscopy of the fission yeast sexual lifecycle. With minor adjustments described, the presented protocol allows research focus on different steps of the reproductive process.

The fission yeast Schizosaccharomyces pombe has been an invaluable model system in studying the regulation of the mitotic cell cycle progression, the ...

Effect of Fluorescent Proteins on Fusion Partners Using Polyglutamine Toxicity Assays in Yeast

For the investigation of protein localization and trafficking using live cell imaging, researchers often rely on fusing their protein of interest to a fluorescent reporter. The constantly evolving list of genetically encoded fluorescent proteins (FPs) presents users with several alternatives when it comes to fluorescent fusion design. Each FP has specific optical and biophysical properties that can affect the biochemical, cellular, and functional properties of the resulting fluorescent fusions. For instance, several FPs tend to form nonspecific oligomers that are susceptible to impede on the function of the fusion partner. Unfortunately, only a few methods exist to test the impact of FPs on the behavior of the fluorescent reporter. Here, we describe a simple method that enables the rapid assessment of the impact of FPs using polyglutamine (polyQ) toxicity assays in the budding yeast Saccharomyces cerevisiae. PolyQ-expanded huntingtin proteins are associated with the onset of Huntington&#39;s disease (HD), where the expanded huntingtin aggregates into toxic oligomers and inclusion bodies. The aggregation and toxicity of polyQ expansions in yeast are highly dependent on the sequences flanking the polyQ region, including the presence of fluorescent tags, thus providing an ideal experimental platform to study the impact of FPs on the behavior of their fusion partner.

This article describes protocols to assess the effect of fluorescent proteins on the aggregation and toxicity of misfolded polyglutamine expansion for the rapid evaluation of a newly uncharacterized fluorescent protein in the context of fluorescent reporters.

For the investigation of protein localization and trafficking using live cell imaging, researchers often rely on fusing their protein of interest to a ...

Small-Scale Plasma Membrane Preparation for the Analysis of Candida albicans Cdr1-mGFPHis

The successful biochemical and biophysical characterization of ABC transporters depends heavily on the choice of the heterologous expression system. Over the past two decades, we have developed a yeast membrane protein expression platform that has been used to study many important fungal membrane proteins. The expression host Saccharomyces cerevisiae AD&#916;&#916; is deleted in seven major endogenous ABC transporters and it contains the transcription factor Pdr1-3 with a gain-of-function mutation that enables the constitutive overexpression of heterologous membrane protein genes stably integrated as single copies at the genomic PDR5 locus. The creation of versatile plasmid vectors and the optimization of one-step cloning strategies enables the rapid and accurate cloning, mutagenesis, and expression of heterologous ABC transporters. Here, we describe the development and use of a novel protease-cleavable mGFPHis double tag (i.e., the monomeric yeast enhanced green fluorescent protein yEGFP3 fused to a six-histidine affinity purification tag) that was designed to avoid possible interference of the tag with the protein of interest and to increase the binding efficiency of the His tag to nickel-affinity resins. The fusion of mGFPHis to the membrane protein ORF (open reading frame) enables easy quantification of the protein by inspection of polyacrylamide gels and detection of degradation products retaining the mGFPHis tag. We demonstrate how this feature facilitates detergent screening for membrane protein solubilization. A protocol for the efficient, fast, and reliable isolation of the small-scale plasma membrane preparations of the C-terminally tagged Candida albicans multidrug efflux transporter Cdr1 overexpressed in S. cerevisiae AD&#916;&#916;, is presented. This small-scale plasma membrane isolation protocol generates high-quality plasma membranes within a single working day. The plasma membrane preparations can be used to determine the enzyme activities of Cdr1 and Cdr1 mutant variants.

Small-Scale Plasma Membrane Preparation for the Analysis of Candida albicans Cdr1-mGFPHis

This article presents a small-scale plasma membrane isolation protocol for the characterization of Candida albicans ABC (ATP-binding cassette) protein Cdr1, overexpressed in Saccharomyces cerevisiae. A protease-cleavable C-terminal mGFPHis double tag with a 16-residue linker between Cdr1 and the tag was designed to facilitate the purification and detergent-screening of Cdr1.

The successful biochemical and biophysical characterization of ABC transporters depends heavily on the choice of the heterologous expression system. Over ...

Generation of Fluorescent Protein Fusions in Candida Species

Samenvatting

Meer video's verkennen