Wir danken N. Dean für die ursprüngliche mCherry FP-Sequenz bietet, M. Gerami-Nejad für den Bau von Plasmiden, B. Larson für die technische Unterstützung und T. Heisel für hilfreiche Ratschläge bei der Entwicklung dieses Projektes. JB wurde vom European Research Council Erweiterte Auszeichnung 340.087 (RAPLODAPT) unterstützt. Mikroskopie und Imaging-Systeme wurden von der University of Minnesota Pediatrics Foundation und der University of Minnesota Imaging Center zur Verfügung gestellt.

1. Isolieren Sie Template Plasmide aus E. coli <ol><li> Wachsen E. coli das Templat - Plasmid bei über Nacht in 10 ml LB-Medium (LB) + 200 mg / L Ampicillin (AMP) 37 ° C enthält , unter Schütteln. </li><li> Ernten Sie die Zellen durch bei 6.000 × g für 2 min zentrifugiert. </li><li> Dekantieren Flüssigkeit, Isolierung und Reinigung von DNA aus E. Zellen durch ein Standardverfahren coli wie zuvor beschrieben in Ausubel et al. 8. </li><li> Resuspendieren DNA in Tris-EDTA (TE; 10 mM Tris, pH 8,0, 1 mM EDTA, pH 8,0) bei einer Arbeitskonzentration von 50-100 ng / ml. </li></ol> 2. Entwurf Grundierungen <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td fo:width="0.5in" style="width:50px"> Grundierung </td><td> Primer - Sequenz </td></tr><tr><td> F1 </td><td> 5 &#39; <strong&gt; GAGAATTGAAGAAGAGTTGGGAGACAATGCTATCTATGCTGGTAAGGACTTCCACAATGCTCAAACTTTG GGTGGTTCTAAAGGTGAAGAATTATT 3 &#39; </td></tr><tr><td> R1 </td><td> 5 &#39;GAGCGTTTGCACCAACAGGCCATCATTTGTGACGAGAGAAGACCTGACGTCATTAGATTGGCACCTTTGC GTAAAACGACGGCCAGTGAATTC 3 &#39; </td></tr><tr><td> F2 </td><td> 5 &#39;GAGAATTGAAGAAGAGTTGGGAGACAATGCTATCTATGCTGGTAAGGACTTCCACAATGCTCAAACTTTG GGTGGTGTTTCAAAAGGTGAAGAAGATAAT 3 &#39; </td></tr><tr><td> R2 </td><td> 5 &#39;GAGCGTTTGCACCAACAGGCCATCATTTGTGACGAGAGAAGACCTGACGTCATTAGATTGGCACCTTTGC ACTGGATGGCGGCGTTAGTATC 3 &#39; </td></tr></tbody></table> Tabelle 1: Primersequenzen in dieser Studie verwendet. Fett Kursiv Text zeigt Homologie zu dem ENO1 genomischen Locus, normale Schrift Regionen sind homologe DNA - Plasmid. <ol> &lt;li&gt; Konstruktions Primer homolog zu Sequenzen , die Kassette zu Plasmid angrenzenden und amplifiziert werden , wie an das 3&#39;-Ende des Zielgens von Interesse (zB ENO1) Rekombination in das Gen der genomischen Locus (Abbildung 2 und Tabelle 1) zu erleichtern , . <ol><li> Sicherzustellen, dass der Vorwärtsprimer Sequenzen, die die letzten 70 Basenpaaren (bp) des Gens von Interesse entsprechen, 5&#39;-3 &#39;, minus das Stoppcodon, die codierende Rahmen zu halten, plus die ersten etwa 30 bp des Plasmids Sequenz sein amplifiziert. Als Hinweis ist die GGTGGTGGTT in jedem Primer ein Poly-Glycin-Linker ohne FP Homologie. Bemerkenswert ist, in Abwesenheit eines Linkers kann es direkte Fusion von funktionellen Domänen sein, die theoretisch auf falsch gefaltete Proteine, geringe Ausbeute bei der Proteinproduktion oder beeinträchtigte Bioaktivität führen kann. </li><li> Stellen Sie sicher, dass die Reverse-Primer-Sequenzen 70 bp direkt stromabwärts von Gen sind, 3&#39;- 5 &#39;einschließlich, keine Gen-Sequenz sowie die letzte approximately 30 bp des Ernährungs oder Arzneimittelresistenzmarker in dem Plasmid verwendet. </li><li> Mit F1 und R1 GFP- NAT1 und YFP- NAT1 Kassetten mit pMG2120 und pMG2263 jeweils und F2 und R2 zu erzeugen mCherry- NAT1 mit pMG2343 zu erzeugen. </li></ol></li></ol> 3. Generieren FP Cassetten durch PCR (Tag 1) <ol><li> Bereiten Sie Reagenzien für die PCR. Machen Sie einen Master-Mix (500 &amp; mgr; l Endvolumen), indem die folgenden Mengen und Konzentrationen in ein 1,5-ml-Röhrchen: 50 &amp; mgr; l PCR-Puffer (500 mM Kaliumchlorid, 100 mM Tris pH 8,0 in Wasser), 20 &amp; mgr; l Desoxynukleotide (dNTPs; Stammischung von Nukleotiden bei jeweils 10 mM), 40 &amp; mgr; l 25 mM Magnesiumchlorid, 20 ul Plasmid gereinigt (aus ~ 50-100 ng / ul Stammlösung), 10 &amp; mgr; l jeder Vorwärts- und Rückwärts-Primer (von 10 mM Stammlösungen), 30 &amp; mgr; l Taq Polymerase (generic, 5.000 Einheiten / ml) und 320 &amp; mgr; l Wasser. <ol><li> Aliquot 50 ul Master-Mix in jeder von 10 PCR-Kompatible 0,5-ml-Röhrchen. </li></ol></li><li> Platzieren Sie PCR-Röhrchen in Thermocycler und führen Sie die folgenden Schritte aus: 1 Zyklus von 5 min bei 94 ° C dsDNA zu denaturieren; 40 Zyklen sequentiell von 45 sec bei 94 ° C, 30 sec bei 55 ° C Primer zu ermöglichen, um das Plasmid-Matrizen-DNA zu tempern, und 4 min bei 68 ° C für die Verlängerung der DNA-Produkte; und 1 endgültige Verlängerungszyklus von 15 min bei 72 ° C. HINWEIS: Der PCR-Mastermix und Zyklusparameter müssen verwendet bezogen auf die Taq-Polymerase modifiziert werden. </li><li> Pool Alle Produkte der 10 PCR-Reaktionen in einem 1,5-ml-Röhrchen. <ol><li> Gegenstand 5 ul gepoolten PCR-Produkt einer Agarose-Gelelektrophorese Amplicongröße zu verifizieren und eine Schätzung der Produktkonzentration zu erhalten, basierend auf einem Vergleich mit einer DNA-Leiter. Im Allgemeinen verwenden ~ 250 ug Kassette DNA in jeder nachfolgenden Transformationsmischung. </li><li> Ausfällen DNA durch Zugabe von 50 &amp; mgr; l 3 M Natriumacetat von 750 &amp; mgr; l 95% Ethanol zu den Produkten gefolgt und Inkubation mindestens 30 minbei -20 ° C </li><li> Ernte der PCR-Produkte durch das Röhrchen bei 16.000 xg für 10 min zentrifugiert. Entfernen Sie vorsichtig und über Nacht den Überstand und trocknen Sie das Pellet verwerfen. Resuspendieren der getrockneten DNA-Kassette Pellet in 40 ul TE pH 8,0 und bei Raumtemperatur lagern bis zur Verwendung. </li></ol></li></ol> 4. Transformations Candida - Zellen mit FP - DNA - Kassetten <ol><li> Am Tag 1 Hefestamm zu erholen von einer 15% Glycerin (-80 ° C) Lager durch Ausstreichen ein paar geschabt Kristalle auf Hefe-Pepton Dextrose mit Adenin (YPAD) Agar gefroren umgewandelt werden und bei 30 ° C inkubiert. Nach der Wiederherstellung des Koloniewachstums, eine einzige Kolonie in 2 ml Flüssigkeit YPAD Medium in einem Glaskulturröhrchen mit einem atmungsfähigen Kappe impfen und über Nacht bei 30 ° C unter Rühren inkubiert. </li><li> Am Tag 2 verdünnt 300 &amp; mgr; l über Nacht Hefekultur in 50 ml frisch YPAD (bis zu einer endgültigen OD 600 von ~ 0,2) in einem 125 ml Erlenmeyerkolben mit einem atmungsfähigen Kappe. Schütteln bei 30 ° Cfür ~ 3 h (auf eine endgültige OD 600 ~ 0,6-0,8). <ol><li> Gießen Die Übernachtkultur in ein 50 ml konisches Röhrchen und die Zellen pelletieren, indem sie in einer Tischzentrifuge bei 1 500 x g für 5 min dreht. </li><li> Abgießen und ordnungsgemäß den Überstand verwerfen. Zellpellet in 5 ml Wasser. Wiederpelletieren Sie die Zellen durch Zentrifugieren erneut 5 min bei 1500 xg in einer Tischzentrifuge. </li><li> Abgießen und ordnungsgemäß den Überstand verwerfen. Resuspendieren der Zellen in 500 &amp; mgr; l TELiAc (TE Lithiumacetat: 10 mM Tris, pH 8,0, 1 mM EDTA, pH 8,0, 0,1 M Lithiumacetat), während in ein 1,5-ml-Röhrchen übertragen. Zentrifugieren Sie die Röhrchen für 2 min bei 3000 × g in einer Mikro. </li><li> Die Zellen in 250 ul TELiAc. Das Gesamtvolumen einschließlich sollte das Pellet ~ 300 &amp; mgr; l sein. </li></ol></li><li> Zu einer sauberen (unterschiedliche Mikrozentrifugenröhrchen als in 4.2.4), werden 5 ul Träger - DNA (10 mg / ml) und 150 &amp; mgr; l hergestellt , Candida - Zellen (aus 4.2.4). Dies ist die negative Kontrolle für transformation. <ol><li> Auf eine zweite saubere Mikrozentrifugenröhrchen, werden 5 &amp; mgr; l denaturierter Träger-DNA (dh bei 90 ° C für 10 min gekocht wurde, kühlt auf 4 ° C), alle 40 &amp; mgr; l des hergestellten PCR-Produktes (von 3.3.1) und 150 ul vorbereitet Candida - Zellen (von 4.2.4). </li><li> Inkubieren der beiden Transformationsmischungen für 30 min bei Raumtemperatur. </li><li> Zu jedem Röhrchen Transformationsmischung, fügen 700 ul PLATE-Mix (10 mM Tris, pH 8,0, 1 mM EDTA, pH 8,0, 0,1 M Lithiumacetat in 50% Polyethylenglycol 3350). Drehen Sie die Rohre zu mischen und Inkubation über Nacht bei RT. </li></ol></li><li> Am Tag 3, brüten die Transformation bei 42 ° C mischt für 1 Stunde (Hitzeschock). <ol><li> die Transformation Zentrifuge mischt für 30 sec bei 16.000 xg in einer Mikrozentrifuge. Entfernen und ordnungsgemäß den Überstand verwerfen. Resuspendieren jeder der Zellpellets in 150 &amp; mgr; l Wasser durch vorsichtiges Auf-und Abpipettieren, um Zellen nicht zu beschädigen. </li><li> Für Transformationen utdurch Pipettieren der Lösungen auf den geeigneten selektiven Medien Agar (zB ohne Uridin) und verteilen Sie die Mischung gleichmäßig mit sterilen Glasperlen ilizing auxotrophen Markergene (zB URA3), die jeweils gesamte Mischung plattieren. </li><li> Für Transformationen des Nourseothricin - Resistenz - Markergen (NAT1) verwendet wird , wie hier beschrieben, mischt Platte Transformation zuerst auf nicht-selektiven YPAD Agar und Inkubation bei 30 ° C für 6-12 h. Dieser Schritt hilft bei der Zellgewinnung, Post Hitzeschock, vor Stress Nourseothricin angewendet wird. </li><li> Nach der teilweisen Erholung des Wachstums, die Candida - Zellen auf YPAD Replika - Platte , die 400 ug / ml Nourseothricin. Für Transformationen verwendet Nahrungsmarkergene (zB URA3), dieser Zwischenbeschichtungsschritt ist nicht erforderlich , und die Zellen können direkt auf selektive Medien ausplattiert Hefe (zB YPAD ohne Uridin) , wie in 4.4.2 beschrieben. HINWEIS: Wenn die Umwandlung erfolgreich ist, colOnies sollte innerhalb von ein bis drei Tagen (zur Auswahl potentiell bis zu fünf Tagen nach Auswuchs auf Nourseothricin enthaltenden Agar) erscheinen. Keine Kolonien sollten mit Transformation haltige Mischungen Träger-DNA allein (Negativkontrolle) verteilt auf Platten erscheinen. </li></ol></li><li> Für auxotroph und Nourseothricin Marker Auswahl, Streifen mutmaßliche Trans als einzelne Kolonien auf frische selektive Medien-Agar-Platten und bei 30 ° C inkubieren, um Hefezellen propagieren, die für eine erfolgreiche Aufbau von FP-Fusionen gescreent werden können. </li><li> Screen - Trans für die korrekte Integration der Tagging - Kassette (siehe Repräsentative Ergebnisse für ein detailliertes Beispiel). Wenn das Gen von Interesse in ausreichenden Mengen exprimiert wird, ganze Kolonie Fluoreszenz so auftreten, dass es möglich ist, den potenziellen Kandidaten Integranten unter Verwendung eines Plattenabbildungssystem mit Fluoreszenzdetektion Fähigkeit zu erkennen. <ol><li> Überprüfen Sie mutmaßliche Integranten durch PCR-Primer homolog zu Sequenzen unter Verwendung von outside der Integrationsbereich Fusion an das Zielgen zu bestätigen. </li><li> Darüber hinaus betrachten Western Blot-Analyse der Expression und Größe des Fusionsproteins, sowie durch Fluoreszenzmikroskopie von Einzelzellen für eine visuelle Bestätigung der Proteinlokalisierung, falls bekannt zu bestimmen. </li></ol></li></ol>

<ol>
	<li>Bendel, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colonization+and+epithelial+adhesion+in+the+pathogenesis+of+neonatal+candidiasis.">Colonization and epithelial adhesion in the pathogenesis of neonatal candidiasis.</a> Semin. Perinatol. 27 (5), 357-364 (2003).</li><li>Gerami-Nejad, M., Berman, J., Gale, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cassettes+for+PCR-mediated+construction+of+green,+yellow,+and+cyan+fluorescent+protein+fusions+in+Candida+albicans.">Cassettes for PCR-mediated construction of green, yellow, and cyan fluorescent protein fusions in Candida albicans.</a> Yeast. 18 (9), 859-864 (2001).</li><li>Gerami-Nejad, M., Dulmage, K., Berman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Additional+cassettes+for+epitope+and+fluorescent+fusion+proteins+in+Candida+albicans.">Additional cassettes for epitope and fluorescent fusion proteins in Candida albicans.</a> Yeast. 26 (7), 399-406 (2009).</li><li>Gerami-Nejad, M., Forche, A., McClellan, M., Berman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+protein+function+in+clinical+C.+albicans+isolates.">Analysis of protein function in clinical C. albicans isolates.</a> Yeast. 29 (8), 303-309 (2012).</li><li>Gerami-Nejad, M., Hausauer, D., McClellan, M., Berman, J., Gale, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cassettes+for+the+PCR-mediated+construction+of+regulatable+alleles+in+Candida+albicans.">Cassettes for the PCR-mediated construction of regulatable alleles in Candida albicans.</a> Yeast. 21 (5), 429-436 (2004).</li><li>Gonia, S., Larson, B., Gale, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR-mediated+gene+modification+strategy+for+construction+of+fluorescent+protein+fusions+in+Candida+parapsilosis.">PCR-mediated gene modification strategy for construction of fluorescent protein fusions in Candida parapsilosis.</a> Yeast. 33 (2), 63-69 (2016).</li><li>Milne, S. W., Cheetham, J., Lloyd, D., Aves, S., Bates, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cassettes+for+PCR-+mediated+gene+tagging+in+Candida+albicans+utilizing+nourseothricin+resistance.">Cassettes for PCR- mediated gene tagging in Candida albicans utilizing nourseothricin resistance.</a> Yeast. 28 (12), 833-841 (2011).</li><li>Ausubel, F. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Current Protocols in Molecular Biology. , (1995).</li><li>Wilson, R. B., Davis, D., Mitchell, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+hypothesis+testing+with+Candida+albicans+through+gene+disruption+with+short+homology+regions.">Rapid hypothesis testing with Candida albicans through gene disruption with short homology regions.</a> J. Bacteriol. 181 (6), 1868-1874 (1999).</li><li>Pulver, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rsr1+focuses+Cdc42+activity+at+hyphal+tips+and+promotes+maintenance+of+hyphal+development+in+Candida+albicans.">Rsr1 focuses Cdc42 activity at hyphal tips and promotes maintenance of hyphal development in Candida albicans.</a> Eukaryotic Cell. 12 (4), 482-495 (2013).</li><li>Falgier, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Candida+species+differ+in+their+interactions+with+immature+human+gastrointestinal+epithelial+cells.">Candida species differ in their interactions with immature human gastrointestinal epithelial cells.</a> Pediatr. Res. 69 (5), 384-389 (2011).</li><li>Nosek, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+manipulation+of+the+pathogenic+yeast+Candida+parapsilosis.">Genetic manipulation of the pathogenic yeast Candida parapsilosis.</a> Curr. Genet. 42 (1), 27-35 (2002).</li><li>Zemanova, J., Nosek, J., Tomaska, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-efficiency+transformation+of+the+pathogenic+yeast+Candida+parapsilosis.">High-efficiency transformation of the pathogenic yeast Candida parapsilosis.</a> Curr. Genet. 45 (3), 183-186 (2004).</li><li>Benjamin, D. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neonatal+candidiasis+among+extremely+low+birth+weight+infants:+risk+factors,+mortality+rates,+and+neurodevelopmental+outcomes+at+18+to+22+months.">Neonatal candidiasis among extremely low birth weight infants: risk factors, mortality rates, and neurodevelopmental outcomes at 18 to 22 months.</a> Pediatrics. 117 (1), 84-92 (2006).</li><li>Kullberg, B. J., Arendrup, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Invasive+Candidiasis.">Invasive Candidiasis.</a> N Engl J Med. 373 (15), 1445-1456 (2015).</li></ol>

Die Autoren haben nichts zu offenbaren.

Konstruktion von Epitop - markierten Sequenzen in Candida Spezies die PCR-vermittelte Gen - Modifikationsstrategie oben beschrieben verwendet , kann als ein dreistufiges Verfahren zusammengefaßt werden. Zunächst wird eine Kassette durch PCR hergestellt, die die Sequenz homolog zur Integration und Regionen gewünschten codiert sowohl auf den Ort des Einfügens in das Hefegenom. Zweitens werden die Hefezellen transformiert werden, mit der Kassette chemisch kompetente mit Lithiumacetat und co-inkubiert hergestel...

Candida - Spezies sind symbiotischer Pilze , die die Darm- und Urogenitaltrakts aller Menschen besiedeln. Unter den Bedingungen der Immunschwäche, wie das mit Frühgeburt auftreten oder immunsuppressive Wirkung von Behandlungen für Krebs, kann Candida - Spezies opportunistischen Erregern werden. Von den Candida - Spezies, ist Candida albicans die häufigste Pilz Kolonisator und bewirkt , dass die Mehrheit der invasiven Pilzinfektionen. Andere Candida - Spezies wie C. glabrata, C. parapsilosis, C. tropicalis und C. kruseii auch schwere Infektionen bei immunsupprimierten Patienten verursachen, mit einigen ausstellenden intrinsische Resistenz gegen häufig Anti-Pilz - Antibiotika wie Fluconazol und Amphotericin B. Daher verwendet, Infektionen mit einigen dieser Arten werden immer häufiger, insbesondere bei Patienten beobachtet prophylaktisch mit Anti-Pilz-Mittel behandelt werden. Auch bei angemessene und rechtzeitige einNTI-Pilz - Behandlung, invasive Candida - Infektionen weiterhin mit einer signifikanten Morbidität und Mortalität 1 verbunden zu werden. Wegen der Bedeutung von Candida - Spezies in die menschliche Gesundheit besteht ein Bedarf an leicht verfügbaren molekularen Werkzeugen, die die Studie und Aufklärung ihrer Pathogenese - Mechanismen ermöglichen. Ein wichtiges Instrument, das Forscher ermöglicht die Visualisierung und mikrobiellen Zellen und die Proteine ​​zu quantifizieren, die sie zum Ausdruck bringen ist FP-Fusion-Technologie. Polymerase - Kettenreaktion (PCR) -vermittelte Modifikation Gen, wie in diesem Dokument beschrieben ist , ermöglicht die Konstruktion von Fusionen zwischen FP - Sequenzen und ein Candida Protein von Interesse an seiner genomischen Locus codierende Sequenz. Stabile Integration des Konstrukts erleichtert Analyse der Proteinexpression sowie Proteinlokalisierung Dynamik. Plasmide enthalten FP - Sequenzen, die für die Expression in Candida albicans optimiert und das kann in der PCR-vermittelten g verwendet werdenene Modifikationsstrategie wurden zuvor konstruiert 2, 3, 4, 5. Plasmide enthalten FP transformation &quot;Kassetten&quot;: eine Sequenz FP auf einen Ernährungsmarker - Gen verknüpft, die die Transformation von C. albicans und C. parapsilosis 2, 3, 4, 5, 6, 7 erleichtert. Derzeit verfügbare Plasmide enthalten eine Vielzahl von selektierbaren Markergenen Nahrungs (URA3, HIS1, ARG4) für die Transformation von auxotrophen Stämmen sowie eine dominant Arzneimittelresistenzmarker (NAT1), die Auxotrophien fehlt Transformation von klinischen Stämmen ermöglicht. Darüber hinaus enthalten die Plasmide Optionen für bis zu vier verschiedenen FP-Sequenzen (grün [GFP], yellow [YFP], cyan [CFP] und Kirsche [mCherry]) und entweder eine ADH1 Terminierungssequenz für den Bau von Carboxy-terminus Protein - Fusionen oder einer Promotorsequenz für den Bau von Amino-Terminus Protein - Fusionen. Primer werden mit Homologie zu der Plasmid-DNA rund um die FP-Kassette entwickelt. Außerdem enthalten die Primer auch 5&#39;-Verlängerungssequenzen eine Homologie zu dem Hefe - Gen von Interesse trägt markiert werden, der Integration der Kassette in den genomischen Locus durch homologe Rekombination (Figur 1) erleichtert. Genspezifischen FP Kassetten werden durch PCR erzeugt und dann umgewandelt in Candida - Zellen kompetent gemacht für die Aufnahme von DNA durch Behandlung mit Lithiumacetat. <img alt="Abbildung 1" src="/files/ftp_upload/55333/55333fig1.jpg" /> Abbildung 1: Diagramm der wie FP - Sequenz - Fusionen in Candida - Spezies erzeugt werden. (A) Plasmid DNA includes eine FP - Sequenz und eine Sequenz , die Nourseothricin Widerstand (NAT1). Relativen Positionen Vorwärts (FWD) und rückwärts (REV) Primer gezeigt sind, mit schwarzen Abschnitte der Primer die Region der Homologie zu dem Plasmid-Sequenz anzeigt, und die purpurrote Bereiche bezeichnet die genspezifischen Region Homologie oder Primerverlängerung. (B) FP - Kassetten werden in Candida umgewandelt und zu integrieren in der ENO1 genomischen Locus durch homologe Rekombination (gestrichelte Linien). (C) Resultierende FP Fusionssequenz am 3&#39; - Ende von ENO1. <a href="http://ecsource.jove.com/files/ftp_upload/55333/55333fig1large.jpg" target="_blank">Bitte klicken Sie hier</a> , um <a href="http://ecsource.jove.com/files/ftp_upload/55333/55333fig1large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a> Hier stellen wir ein Beispiel für Protein - Fusion (ENO1-FP) Konstruktionen in Candida - Spezies. Wir verwenden Tagging Plasmide , die die NAT1 Transformation Markergen zusammen mit Sequenzen , die für GFP, YFP enthält, odermCherry (Abbildung 2). Diese Plasmide werden zusammen mit den Primern in PCR verwendet , um genspezifische Kassetten erzeugen , die Fusion von FPs an das 3&#39;-Ende ENO1 erleichtern, was zu einer Expression von ENO1 fusioniert an FPs an seinem Carboxy-Terminus. <img alt="Figur 2" src="/files/ftp_upload/55333/55333fig2.jpg" /> Abbildung 2: Karten von FP - Kassette enthaltenden Plasmide. Vorwärts (F) und rückwärts (R) Primer verwendet, um die Kassetten aus den Plasmiden zu erzeugen, zusammen mit der relativen Lage ihrer Homologie zu den Plasmiden angegeben. Primersequenzen sind in Tabelle 1 aufgeführt. F1 und R1 wurden auch zur Erzeugung der pYFP- NAT1 Kassette verwendet. Das Plasmid , das das YFP- NAT1 Kassette (pMG2263) enthält , ist identisch mit pMG2120 mit Ausnahme von YFP anstelle des GFP - Sequenz. Kassettengrößen: GFP-NAT1, 3,7 kbp; mCherry- NAT1, 3,2 kbp; YFP- NAT1, 3.7 kbp. Diese Zahl wurde von Gerami-Nejad modifiziert, et al. 4 <a href="http://ecsource.jove.com/files/ftp_upload/55333/55333fig2large.jpg" target="_blank">Bitte klicken Sie hier</a> , um <a href="http://ecsource.jove.com/files/ftp_upload/55333/55333fig2large.jpg" target="_blank">eine größere Version dieser Figur zu sehen.</a>

<table><tbody><tr><td>100 W mercury lamp</td><td>CHIU Technical Corporation</td><td>M-100T</td><td></td></tr><tr><td>95% Ethanol</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Adenine</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Ampicillin</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Carrier DNA</td><td>Ambion</td><td>AM9680</td><td>Sheared Salmon Sperm DNA 10 mg/ml</td></tr><tr><td>CCD Camera</td><td>Photometrics</td><td>CoolSNAP HQ</td><td></td></tr><tr><td>Conical Tube</td><td>Corning</td><td>430828</td><td>50 ml</td></tr><tr><td>Culture Tube Rotator</td><td>New Brunswick</td><td>2013923</td><td>TC-8, or Any Culture Tube Rotator</td></tr><tr><td>Deoxynucleotides (dNTP) PCR Grade</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Eppendorf Tubes</td><td>Eppendorf</td><td>022363719, 022363212</td><td>0.5 ml, 1.5 ml</td></tr><tr><td>Erlenmeyer Flask</td><td>Fisher Scientific</td><td>7250089</td><td>125 ml</td></tr><tr><td>Ethylenediaminetetraacetic Acid (EDTA)</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Freezer (-80 &amp;deg;C)</td><td>Thermo Electron Corporation</td><td>ULT-1386-9-V</td><td>Revco Ultima II</td></tr><tr><td>GFP, YFP and Texas Red Filter Sets</td><td>Chroma Technology Corporation</td><td>49002, 86004v2, 49008</td><td></td></tr><tr><td>Glass culture tubes</td><td>Fisher Scientific</td><td>1496126</td><td>75 mm</td></tr><tr><td>HRP goat anti-mouse antibody</td><td>Santa Cruz Biotechnology</td><td>SC-2005</td><td></td></tr><tr><td>HRP goat anti-rabbit antibody</td><td>Santa Cruz Biotechnology</td><td>SC-2301</td><td></td></tr><tr><td>Incubator (30 &amp;deg;C)</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Lithium Acetate</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Lysogeny Broth (LB) Media</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Magnesium Chloride</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Microcentrifuge</td><td>Eppendorf</td><td>5415 D</td><td></td></tr><tr><td>Microscope</td><td>Nikon</td><td>E600</td><td>Nikon Eclipse E600</td></tr><tr><td>Microscope Image Analysis Software</td><td>Universal Imaging Corporation</td><td>6.3r7</td><td>MetaMorph Software Series 6.3r7</td></tr><tr><td>Mouse anti-GFP antibody</td><td>Roche</td><td>11814460001</td><td></td></tr><tr><td>Nourseothricin</td><td>Fisher Scientific</td><td>50997939</td><td></td></tr><tr><td>PCR Thermocycler</td><td>Applied Biosystems</td><td>9700</td><td>GeneAmp PCR System</td></tr><tr><td>PCR tubes</td><td>BioExpress, GeneMate</td><td>T-3035-1</td><td>0.2 ml</td></tr><tr><td>Polyethylene Glycol 3350</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Potassium Chloride</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Rabbit anti-mCherry antibody</td><td>BioVision</td><td>5993-100</td><td></td></tr><tr><td>Refrigerator (4 &amp;deg;C)</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Sodium Acetate</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Stereomicroscope</td><td>Nikon</td><td>SMZ1500</td><td></td></tr><tr><td>Table Top Centrifuge</td><td>Labnet</td><td>Z 400</td><td>Hermle Z 400</td></tr><tr><td>&lt;em&gt;Taq&lt;/em&gt; DNA Polymerase</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Tris(hydroxymethyl)aminomethane (Tris)</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Vortex Mixer</td><td>Scientific Industries</td><td>SI-0236</td><td>Vortex Genie 2</td></tr><tr><td>Yeast Extract Peptone Dextrose (YPD) Media</td><td>Any</td><td>NA</td><td></td></tr></tbody></table>

generation of fluorescent protein fusions in candida species

Candida - Spezies, weit verbreitete Kolonisatoren der Darm- und Urogenitaltrakts, sind die Ursache für die Mehrzahl der invasiven Pilzinfektionen beim Menschen. So werden molekulare und genetische Werkzeuge benötigt, um die Untersuchung ihrer Pathogenese-Mechanismen zu erleichtern. PCR-vermittelte Genveränderung ist eine einfache und schnelle Ansatz Epitop-markierte Proteine ​​zu erzeugen, deren Nachweis zu erleichtern. Insbesondere sind fluoreszierendes Protein (FP) Fusionen leistungsfähige Werkzeuge, die Visualisierung und Quantifizierung von beiden Hefezellen und Proteine, die durch Fluoreszenzmikroskopie und Immunoblotting ermöglichen, respectively. Plasmide enthalten FP - codierenden Sequenzen, zusammen mit Nahrungsmarkergene, die die Transformation von Candida - Arten zu erleichtern, wurden zum Zwecke der FP Konstruktion und Expression in Candida erzeugt wird . Hier präsentieren wir eine Strategie für eine FP - Fusion in einer Candida - Spezies zu konstruieren. Plasmide, die die Nourseothricin resista enthältnce Transformationsmarker - Gen (NAT1) zusammen mit Sequenzen für entweder grün, gelb oder Kirsche FPs (GFP, YFP, mCherry) zusammen mit Primer verwendet , die Gen-spezifische Sequenzen in einer Polymerase - Kettenreaktion (PCR) eine FP - Kassette zu erzeugen , . Diese genspezifischen Kassette hat die Fähigkeit, in das 3&#39;-Ende des entsprechenden Genlocus durch homologe Rekombination zu integrieren. Erfolgreich in-frame-Fusion der FP-Sequenz in das Gen-Locus von Interesse genetisch überprüft, gefolgt von einer Analyse der Fusionsprotein-Expression mittels Mikroskopie und / oder Immundetektionsverfahren. Darüber hinaus ist für den Fall von stark exprimierten Proteine ​​können erfolgreiche Fusionen für primär durch Fluoreszenz-Bildgebungstechniken gescreent werden.

Als Beispiel haben wir dem oben beschriebenen Protokoll GFP und mCherry Fusionen zu konstruieren , in einem C. parapsilosis Laborstamm zu ENO1. Jeder mutmaßliche Trans wurde ursprünglich für das Wachstum erneut ausgestrichen. In diesem Beispiel wird , da das resultierende Fusionsprotein stark exprimiert (Enolase) und die FPs sind hell, wir in der Lage waren Trans durch Fluoreszenzmikroskopie zur Durchführung von diagnostischen PCR vor dem Bildschirm (Abbildung 3)</st...

Watch this Scientific Journal Video about Generation of Fluorescent Protein Fusions in Candida Species at JoVE.com

Generation of Fluorescent Protein Fusions in Candida Species

PCR-vermittelte Gen - Modifikation kann verwendet werden , fluoreszierendes Protein - Fusionen in Candida - Spezies zu erzeugen, die Visualisierung und Quantifizierung von Hefezellen und Proteinen erleichtert. Hier präsentieren wir eine Strategie für ein fluoreszierendes Protein - Fusion (ENO1-FP) in Candida parapsilosis zu konstruieren.

Die Erzeugung von Fluorescent Protein Fusions in<em&gt; Candida</em&gt; Arten

Candida species, prevalent colonizers of the intestinal and genitourinary tracts, are the cause of the majority of invasive fungal infections in humans. ...

generation-of-fluorescent-protein-fusions-in-candida-species

Research

JoVE Journal

Genetics

Generation of Fluorescent Protein Fusions in Candida Species

10.6K Aufrufe.  University of Minnesota.  PCR-vermittelte Gen - Modifikation kann verwendet werden , fluoreszierendes Protein - Fusionen in Candida - Spezies zu erzeugen, die Visualisierung und Quantifizierung von Hefezellen und Proteinen erleichtert. Hier präsentieren wir eine Strategie für ein fluoreszierendes Protein - Fusion (ENO1-FP) in Candida parapsilosis zu konstruieren. 

Serie: Generation of Fluorescent Protein Fusions in Candida Species

The C. elegans Excretory Canal as a Model for Intracellular Lumen Morphogenesis and In Vivo Polarized Membrane Biogenesis in a Single Cell: labeling by GFP-fusions, RNAi Interaction Screen and Imaging

The four C. elegans excretory canals are narrow tubes extended through the length of the animal from a single cell, with almost equally far extended intracellular endotubes that build and stabilize the lumen with a membrane and submembraneous cytoskeleton of apical character. The excretory cell expands its length approximately 2,000 times to generate these canals, making this model unique for the in vivo assessment of de novo polarized membrane biogenesis, intracellular lumen morphogenesis and unicellular tubulogenesis. The protocol presented here shows how to combine standard labeling, gain- and loss-of-function genetic or RNA interference (RNAi)-, and microscopic approaches to use this model to visually dissect and functionally analyze these processes on a molecular level. As an example of a labeling approach, the protocol outlines the generation of transgenic animals with fluorescent fusion proteins for live analysis of tubulogenesis. As an example of a genetic approach, it highlights key points of a visual RNAi-based interaction screen designed to modify a gain-of-function cystic canal phenotype. The specific methods described are how to: label and visualize the canals by expressing fluorescent proteins; construct a targeted RNAi library and strategize RNAi screening for the molecular analysis of canal morphogenesis; visually assess modifications of canal phenotypes; score them by dissecting fluorescence microscopy; characterize subcellular canal components at higher resolution by confocal microscopy; and quantify visual parameters. The approach is useful for the investigator who is interested in taking advantage of the C. elegans excretory canal for identifying and characterizing genes involved in the phylogenetically conserved processes of intracellular lumen and unicellular tube morphogenesis.

The C. elegans Excretory Canal as a Model for Intracellular Lumen Morphogenesis and In Vivo Polarized Membrane Biogenesis in a Single Cell: labeling by GFP-fusions, RNAi Interaction Screen and Imaging

The C. elegans excretory canal is a unique single-cell model for the visual in vivo analysis of de novo polarized membrane biogenesis. This protocol describes a combination of standard genetic/RNAi and imaging approaches, adaptable for the identification and characterization of molecules directing unicellular tubulogenesis, and apical membrane and lumen biogenesis.

C. Elegans Excretory Kanal als Modell für die intrazelluläre Lumen Morphogenese und In Vivo polarisiert Membrane Biogenesis in einer einzelnen Zelle: Kennzeichnung von GFP-Fusionen, RNAi Interaktion Bildschirm und Imaging

The four C. elegans excretory canals are narrow tubes extended through the length of the animal from a single cell, with almost equally far extended ...

Forschung

Entwicklungsbiologie

Biolistic Transformation of a Fluorescent Tagged Gene into the Opportunistic Fungal Pathogen Cryptococcus neoformans

The basidiomycete Cryptococcus neoformans, an invasive opportunistic pathogen of the central nervous system, is the most frequent cause of fungal meningitis worldwide resulting in more than 625,000 deaths per year worldwide.&#160;Although electroporation has been developed for the transformation of plasmids in Cryptococcus, only&#160;biolistic&#160;delivery provides&#160;an effective means to transform&#160;linear&#160;DNA&#160;that can be integrated into the genome by homologous recombination.&#160;
Acetate has been shown to be a major fermentation product during cryptococcal infection, but the significance of this is not yet known.&#160;A bacterial pathway composed of the enzymes xylulose-5-phosphate/fructose-6-phosphate phosphoketolase (Xfp) and acetate kinase (Ack) is one of three potential pathways for acetate production in C. neoformans. Here, we demonstrate the biolistic transformation of a construct, which has the gene encoding Ack fused to the fluorescent tag mCherry, into&#160;C. neoformans. We then confirm integration of the ACK-mCherry fusion into the&#160;ACK&#160;locus.

Biolistic Transformation of a Fluorescent Tagged Gene into the Opportunistic Fungal Pathogen Cryptococcus neoformans

Biolistic transformation is a method used to generate stable integration of DNA into the genome of the opportunistic pathogen Cryptococcus neoformans through homologous recombination. We will demonstrate biolistic transformation of a construct, which has the gene encoding acetate kinase fused to the fluorescent tag mCherry into&#160;C. neoformans.

Biolistischen Transformation einer Leuchtstoff Tagged-Gens in den Opportunistic Pilzpathogenentwicklung<em&gt; Cryptococcus neoformans</em

The basidiomycete Cryptococcus neoformans, an invasive opportunistic pathogen of the central nervous system, is the most frequent cause of fungal ...

Immunologie und Infektion

Visualizing Yeast Organelles with Fluorescent Protein Markers

The budding yeast, Saccharomyces cerevisiae, is a classic model system in studying organelle function and dynamics. In our previous works, we have constructed fluorescent protein-based markers for major organelles and endomembrane structures, including the nucleus, endoplasmic reticulum (ER), Golgi apparatus, endosomes, vacuoles, mitochondria, peroxisomes, lipid droplets, and autophagosomes. The protocol presented here describes the procedures for using these markers in yeast, including DNA preparation for yeast transformation, selection and evaluation of transformants, fluorescent microscopic observation, and the expected outcomes. The text is geared toward researchers who are entering the field of yeast organelle study from other backgrounds. Essential steps are covered, as well as technical notes about microscope hardware considerations and several common pitfalls. It provides a starting point for people to observe yeast subcellular entities by live-cell fluorescent microscopy. These tools and methods can be used to identify protein subcellular localization and track organelles of interest in time-lapse imaging.

<meta charset="utf8"></head><body>Visualisierung von Hefeorganellen mit fluoreszierenden Proteinmarkern

Here we describe the use of a set of fluorescent protein-based organelle markers in live-cell imaging of the budding yeast, Saccharomyces cerevisiae.

Visualisierung von Hefeorganellen mit fluoreszierenden Proteinmarkern

The budding yeast, Saccharomyces cerevisiae, is a classic model system in studying organelle function and dynamics. In our previous works, we have ...

Biochemie

In vivo Quantification of G Protein Coupled Receptor Interactions using Spectrally Resolved Two-photon Microscopy

The study of protein interactions in living cells is an important area of research because the information accumulated both benefits industrial applications as well as increases basic fundamental biological knowledge. F&ouml;rster (Fluorescence) Resonance Energy Transfer (FRET) between a donor molecule in an electronically excited state and a nearby acceptor molecule has been frequently utilized for studies of protein-protein interactions in living cells. The proteins of interest are tagged with two different types of fluorescent probes and expressed in biological cells. The fluorescent probes are then excited, typically using laser light, and the spectral properties of the fluorescence emission emanating from the fluorescent probes is collected and analyzed. Information regarding the degree of the protein interactions is embedded in the spectral emission data. Typically, the cell must be scanned a number of times in order to accumulate enough spectral information to accurately quantify the extent of the protein interactions for each region of interest within the cell. However, the molecular composition of these regions may change during the course of the acquisition process, limiting the spatial determination of the quantitative values of the apparent FRET efficiencies to an average over entire cells. By means of a spectrally resolved two-photon microscope, we are able to obtain a full set of spectrally resolved images after only one complete excitation scan of the sample of interest. From this pixel-level spectral data, a map of FRET efficiencies throughout the cell is calculated. By applying a simple theory of FRET in oligomeric complexes to the experimentally obtained distribution of FRET efficiencies throughout the cell, a single spectrally resolved scan reveals stoichiometric and structural information about the oligomer complex under study. Here we describe the procedure of preparing biological cells (the yeast Saccharomyces cerevisiae) expressing membrane receptors (sterile 2 &alpha;-factor receptors) tagged with two different types of fluorescent probes. Furthermore, we illustrate critical factors involved in collecting fluorescence data using the spectrally resolved two-photon microscopy imaging system. The use of this protocol may be extended to study any type of protein which can be expressed in a living cell with a fluorescent marker attached to it.

In vivo Quantification of G Protein Coupled Receptor Interactions using Spectrally Resolved Two-photon Microscopy

By employing a spectrally resolved two-photon microscopy imaging system, pixel-level maps of F&ouml;rster Resonance Energy Transfer (FRET) efficiencies are obtained for cells expressing membrane receptors hypothesized to form homo-oligomeric complexes. From the FRET efficiency maps, we are able to estimate stoichiometric information about the oligomer complex under study.

In vivo Quantifizierung der G Protein-gekoppelten Rezeptor-Wechselwirkungen mit spektral aufgelöste Zwei-Photonen-Mikroskopie

The study of protein interactions in living cells is an important area of research because the information accumulated both benefits industrial ...

Biologie

Quantitative Live Cell Fluorescence-microscopy Analysis of Fission Yeast

Several microscopy techniques are available today that can detect a specific protein within the cell. During the last decade live cell imaging using fluorochromes like Green Fluorescent Protein (GFP) directly attached to the protein of interest has become increasingly popular 1. Using GFP and similar fluorochromes the subcellular localisations and movements of proteins can be detected in a fluorescent microscope. Moreover, also the subnuclear localisation of a certain region of a chromosome can be studied using this technique. GFP is fused to the Lac Repressor protein (LacR) and ectopically expressed in the cell where tandem repeats of the lacO sequence has been inserted into the region of interest on the chromosome2. The LacR-GFP will bind to the lacO repeats and that area of the genome will be visible as a green dot in the fluorescence microscope. Yeast is especially suited for this type of manipulation since homologous recombination is very efficient and thereby enables targeted integration of the lacO repeats and engineered fusion proteins with GFP 3. Here we describe a quantitative method for live cell analysis of fission yeast. Additional protocols for live cell analysis of fission yeast can be found, for example on how to make a movie of the meiotic chromosomal behaviour 4. In this particular experiment we focus on subnuclear organisation and how it is affected during gene induction. We have labelled a gene cluster, named Chr1, by the introduction of lacO binding sites in the vicinity of the genes. The gene cluster is enriched for genes that are induced early during nitrogen starvation of fission yeast 5. In the strain the nuclear membrane (NM) is labelled by the attachment of mCherry to the NM protein Cut11 giving rise to a red fluorescent signal. The Spindle Pole body (SPB) compound Sid4 is fused to Red Fluorescent Protein (Sid4-mRFP) 6. In vegetatively growing yeast cells the centromeres are always attached to the SPB that is embedded in the NM 7. The SPB is identified as a large round structure in the NM. By imaging before and 20 minutes after depletion of the nitrogen source we can determine the distance between the gene cluster (GFP) and the NM/SPB. The mean or median distances before and after nitrogen depletion are compared and we can thus quantify whether or not there is a shift in subcellular localisation of the gene cluster after nitrogen depletion.

The fission yeast, Schizosaccharomyces pombe, is a good model system to study basic cellular processes. Here we describe a method to perform quantitative live cell analysis of fission yeast. In this particular experiment we focus on organisation of the genome within the cell nucleus, but the method can also be used to study cytosolic factors.

Quantitative Live Cell Fluoreszenz-Mikroskopie Analyse von Fission Yeast

Several microscopy techniques are available today that can detect a specific protein within the cell. During the last decade live cell imaging using ...

Use of In Vivo Imaging to Screen for Morphogenesis Phenotypes in Candida albicans Mutant Strains During Active Infection in a Mammalian Host

Candida albicans is an important human pathogen. Its ability to switch between morphologic forms is central to&#160;its pathogenesis; these morphologic changes are regulated by a complex signaling network controlled in response to environmental stimuli. These regulatory components have been highly studied, but almost all studies use a variety of in vitro stimuli to trigger filamentation. To determine how morphogenesis is regulated during the pathogenesis process, we developed an in vivo microscopy system to obtain high spatial resolution images of organisms undergoing hyphal formation within the mammalian host. The protocol presented here describes the use of this system to screen small collections of C. albicans mutant strains, allowing us to identify key regulators of morphogenesis as it occurs at the site of infection. Representative results are presented, demonstrating that some regulators of morphogenesis, such as the transcriptional regulator Efg1, have consistent phenotypes in vitro and in vivo, whereas other regulators, such as adenyl cyclase (Cyr1), have significantly different phenotypes in vivo compared to in vitro.

Use of In Vivo Imaging to Screen for Morphogenesis Phenotypes in Candida albicans Mutant Strains During Active Infection in a Mammalian Host

This manuscript describes a method for screening moderately sized Candida albicans mutant libraries for morphogenesis phenotypes during active infection in a mammalian host using non-invasive confocal microscopy.

Verwendung von In-vivo-Bildgebung zum Screening auf Morphogenese-Phänotypen in Candida albicans mutierten Stämmen während einer aktiven Infektion in einem Säugetierwirt

Candida albicans is an important human pathogen. Its ability to switch between morphologic forms is central to&#160;its pathogenesis; these morphologic ...

Etablierung eines Mausmodells für Candida albicans-assoziierte Katheter-assoziierte Infektionen

A Catheter-Related Candida albicans Infection Model in Mouse

Catheter-related infection (CRI) is a common nosocomial infection caused by candida albicans during catheter implantation. Typically, biofilms are formed on the outer surface of the catheter and lead to disseminated infections, which are fatal to patients. There are no effective prevention and treatment management in clinics. Therefore, it is urgent to establish an animal model of CRI for the preclinical screening of new strategies for its prevention and treatment. In this study, a polyethylene catheter, a widely used medical catheter, was inserted into the back of the BALB/c mice after hair removal. Candida albicans ATCC MYA-2876 (SC5314) expressing enhanced green fluorescent protein was subsequently inoculated on the skin's surface along the catheter. Intense fluorescence was observed on the surface of the catheter under a fluorescent microscope 3 days later. Mature and thick biofilms were found on the surface of the catheter via scanning electron microscopy. These results indicated the adhesion, colonization, and biofilm formation of candida albicans on the surface of the catheter. The hyperplasia of the epidermis and the infiltration of inflammatory cells in the skin specimens indicated the histopathological changes of the CRI-associated skin. To sum up, a mouse CRI model was successfully established. This model is expected to be helpful in the research and development of therapeutic management for candida albicans associated CRI.

Autor im Rampenlicht: Verbesserung des Candida albicans-Nachweises bei Katheterinfektionen durch fluoreszierendes Protein-Tagging 

We establish a mouse model of C.albicans-associated catheter-related infection (CRI), in which biofilm forms on the catheter, and the interaction between C.albicans and host correlates well with the clinical CRI. This model helps screen therapies for C.albicans biofilm-associated CRI, laying a foundation for clinical transformation.

Ein katheterbezogenes Candida albicans-Infektionsmodell in der Maus

Catheter-related infection (CRI) is a common nosocomial infection caused by candida albicans during catheter implantation. Typically, biofilms are formed ...

Die Erzeugung von Fluorescent Protein Fusions in

Zusammenfassung

Weitere Videos entdecken

Kapitel in diesem Video

C. Elegans Excretory Kanal als Modell für die intrazelluläre Lumen Morphogenese und In Vivo polarisiert Membrane Biogenesis in einer einzelnen Zelle: Kennzeichnung von GFP-Fusionen, RNAi Interaktion Bildschirm und Imaging

Biolistischen Transformation einer Leuchtstoff Tagged-Gens in den Opportunistic Pilzpathogenentwicklung

Visualisierung von Hefeorganellen mit fluoreszierenden Proteinmarkern

Visualisierung von Hefeorganellen mit fluoreszierenden Proteinmarkern

In vivo Quantifizierung der G Protein-gekoppelten Rezeptor-Wechselwirkungen mit spektral aufgelöste Zwei-Photonen-Mikroskopie

Quantitative Live Cell Fluoreszenz-Mikroskopie Analyse von Fission Yeast

Verwendung von In-vivo-Bildgebung zum Screening auf Morphogenese-Phänotypen in Candida albicans mutierten Stämmen während einer aktiven Infektion in einem Säugetierwirt

Ein katheterbezogenes Candida albicans-Infektionsmodell in der Maus

Ein katheterbezogenes Candida albicans-Infektionsmodell in der Maus

Ein katheterbezogenes Candida albicans-Infektionsmodell in der Maus