Biz orijinal MCherry FP dizisi sağlamak için N. Dean teşekkür M. Gerami-Nejad plasmidlerin yapımı için, bu projenin geliştirilmesi sırasında yararlı tavsiyeler için teknik yardım B. Larson ve T. Heisel. JB Avrupa Araştırma Konseyi İleri Ödülü 340.087 (RAPLODAPT) tarafından desteklenmiştir. Mikroskopi ve görüntüleme sistemleri Minnesota Pediatri Vakfı Üniversitesi ve Minnesota Görüntüleme Merkezi Üniversitesi tarafından sağlanmıştır.

E. coli 1. İzole Şablon Plazmidler <ol><li> Çalkalanarak 37 ° C&#39;de 10 mi lizojeni etsuyu (LB) + 200 mg / l ampisilin (amp) &#39;de bir gece boyunca şablon plazmiti içeren E. coli büyütün. </li><li> 2 dakika boyunca 6000 x g&#39;de santrifüj Hasat hücreleri. </li><li> , Sıvı boşaltacaktır izole etmek ve Ausubel ve diğerleri daha önce tarif edildiği gibi E. standart bir yöntemle coli hücreleri DNA saflaştırılması. 8. </li><li> 50-100 ng / ml çalışma konsantrasyonunda Tris-EDTA (10 mM Tris, pH 8.0, 1 mM EDTA, pH 8.0 TE) içinde yeniden süspanse DNA. </li></ol> 2. Tasarım Astarlar <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td fo:width="0.5in" style="width:50px"> astar boya </td><td> primer sekans </td></tr><tr><td> F1 </td><td> 5 &#39; <strong&gt; GAGAATTGAAGAAGAGTTGGGAGACAATGCTATCTATGCTGGTAAGGACTTCCACAATGCTCAAACTTTG GGTGGTTCTAAAGGTGAAGAATTATT 3 &#39; </td></tr><tr><td> R1 </td><td> 5 &#39;GAGCGTTTGCACCAACAGGCCATCATTTGTGACGAGAGAAGACCTGACGTCATTAGATTGGCACCTTTGC GTAAAACGACGGCCAGTGAATTC 3 &#39; </td></tr><tr><td> F2 </td><td> 5 &#39;GAGAATTGAAGAAGAGTTGGGAGACAATGCTATCTATGCTGGTAAGGACTTCCACAATGCTCAAACTTTG GGTGGTGTTTCAAAAGGTGAAGAAGATAAT 3 &#39; </td></tr><tr><td> R2 </td><td> 5 &#39;GAGCGTTTGCACCAACAGGCCATCATTTGTGACGAGAGAAGACCTGACGTCATTAGATTGGCACCTTTGC ACTGGATGGCGGCGTTAGTATC 3 &#39; </td></tr></tbody></table> Tablo 1: Bu çalışmada kullanılan astar dizilerini sıralamaktadır. Kalın, italik yazı ENO1 genomik homoloji gösterir, normal yazı tipi bölgeler DNA plazmid homologdur. <ol> &lt;Li&gt; Tasarım primerleri kaseti çevreleyen sekansları genin genomik rekombinasyonu kolaylaştıran ilgi konusu hedef gen (örn ENO1) 3&#39;-ucuna ve amplifiye edilecek olan plazmid homolog olduğu (Şekil 2 ve Tablo 1) . <ol><li> İleri primer sekansları, son 70 baz çifti, ilgi konusu genin (bp), 5&#39;-3 &#39;, eksi durdurma kodonu eşleşen kodlama çerçevesini korumak için, ayrıca plazma dizinin ilk yaklaşık 30 bp olması emin olun yükseltilir. Not olarak, her bir primer olarak GGTGGTGGTT Resim AP homolojiye sahip bir poli-glisin bağlayıcıdır. Dikkat çekici bir şekilde, bir bağlayıcının yokluğunda, teorik olarak, protein yanlış katlanması, protein üretimi düşük verimle veya bozulmuş biyo yol fonksiyonel alan, doğrudan füzyonu olabilir. </li><li> Ters primer diziler, genin 70 bp hemen alt emin olun 3&#39;-5 &#39;, herhangi bir gen sekansı, ayrıca, son bir yaklaşımı dahilximately plazmid kullanılan beslenme ya da ilaç direnci marker 30 bp. </li><li> Kullanım F1 ve R1 pMG2343 ile mCherry- NAT1 oluşturmak için pMG2120 ve pMG2263 sırasıyla ve F2 ve R2 ile GFP- NAT1 ve YFP- NAT1 kasetleri üretir. </li></ol></li></ol> 3. PCR ile FP kasetler oluşturun (Gün 1) <ol><li> PCR için reaktifler hazırlayın. 1.5 ml tüp aşağıdaki miktarlar ve konsantrasyonlarda eklenmesi ile ana karışımı (500 ul son hacim) sağlayın: 50 ul PCR tampon maddesi (500 mM potasyum klorür, su içinde 100 mM Tris pH 8.0), 20 ul deoksinükleotidler (dNTP, hazır karışımı, 10 mm), 40 ul 25 mM magnezyum klorür nükleotidlerin, 20 ul), 10 ul her ileri ve 10 mM stok çözeltilerinden primer (ters), 30 ul Taq ~ 50-100 ng / ul stok çözeltisinden plazmid (saflaştırılmıştır polimeraz (genel, 5000 birim / ml) ve 320 ul su. <ol><li> 10 PCR compatib her birine ana karışımı Kısım 50 ulle 0.5 ml tüpler. </li></ol></li><li> aşağıdaki adımları PCR PCR tüpleri yerleştirin ve çalıştırın: 1 devir dk 5 94 ° C&#39;de dsDNA denatüre etmek; 94 ° C&#39;de 45 saniye 40 döngü, ardışık olarak 55 ° C&#39;de 30 saniye primerler plasmid şablonu DNA tavlanmasına izin verecek ve DNA ürünleri uzatılması için 68 ° C&#39;de 4 dak; ve 72 ° C&#39;de 15 dakika için 1 son uzatma döngüsü. NOT: PCR master mix ve bisiklet parametreleri kullanılan özel Taq polimeraz dayalı modifiye edilmesi gerekebilir. </li><li> Havuz 1.5 ml tüp içinde 10 PCR reaksiyonları tüm ürünler. <ol><li> agaroz jel elektroforezine toplanmış PCR ürünü konusu 5 ul bir DNA merdiveni mukayesesine dayalı bir amplikon boyutunu doğrulamak ve ürün konsantrasyonunun tahmin elde edildi. Genel olarak, takip eden her bir dönüşüm karışımı kaseti DNA ~ 250 ug kullanımı. </li><li> ürün 750 ul% 95 etanol ile, ardından 50 ul 3 M sodyum asetat eklenerek DNA hızlandırabilir ve en az 30 dakika süreyle inkübe-20 ° C&#39;de </li><li> 10 dakika boyunca 16.000 xg tüp santrifüj edilerek PCR ürünleri hasat. Dikkatle çıkarın ve süpernatantı atmak ve bir gecede pelet kurulayın. 40 ul TE pH 8.0 içinde kurutulmuştur DNA kasetinin pelletini ve kullanılana kadar oda sıcaklığında saklayın. </li></ol></li></ol> 4. FP DNA kasetleri ile Candida Hücreler Transform <ol><li> 1. Günde, maya suşu geri adenin (İpad) agar ile maya Pepton Dekstroz üzerine bir kaç kazınmış kristaller çizgiler ile 30 ° C&#39;de inkübe ile (-80 ° C), hazır dondurulmuş% 15 gliserol transforme edilecek. Koloni büyüme çıktıktan sonra, hava alabilir bir kap ile camdan yapılmış bir kültür tüp içinde 2 ml sıvı İpad ortam içine tek bir koloni inoküle ve ajitasyon ile 30 ° C &#39;de bir gece boyunca inkübe edilir. </li><li> 2. günde, hava alabilir bir kapaklı 125 ml&#39;lik bir Erlenmeyer şişesi içinde 50 ml (son OD 600 ~ 0.2), taze İpad gece boyunca maya kültürü 300 ul seyreltilir. 30 ° C &#39;de çalkalanır(nihai OD ~ 0.6-0.8 600) ~ 3 saat. <ol><li> 50 ml&#39;lik konik tüp içine gecede kültür dökün ve bir masa üstü santrifüj 1 500 xg&#39;de 5 dakika boyunca iplik pelet hücreleri. </li><li> dökün ve düzgün süpernatant atın. 5 ml su içinde hücre pelletini. bir masa üstü santrifüjü içinde 1,500 xg&#39;de 5 dakika boyunca yeniden santrifüjlenerek hücreler yeniden pelet. </li><li> dökün ve düzgün süpernatant atın. 1.5 ml tüp aktarma sırasında 500 ul TELiAc (10 mM Tris, pH 8.0, 1 mM EDTA, pH 8.0, 0.1 M lityum asetat TE lityum asetat) &#39;de tekrar süspansiyon hücreleri. bir mikrosantrifüj içinde 3000 x g&#39;de 2 dakika süre ile boru santrifüjleyin. </li><li> 250 ul TELiAc yeniden süspanse hücreleri. pelet dahil toplam hacim ~ 300 ul olmalıdır. </li></ol></li><li> Temiz (4.2.4&#39;te farklı mikrofüj tüpüne) için, 5 ul bir taşıyıcı DNA (10 mg / ml) ve (4.2.4 den) hazırlandı Candida hücrelerinin 150 ul ekle. Bu t negatif kontrolütransformasyonu. <ol><li> ikinci temiz bir mikrofüj tüpüne, denatüre bir taşıyıcı DNA 5 ul (yani, 10 dakika boyunca 90 ° C&#39;de kaynatıldı ve 4 ° C&#39;ye soğutulmuş), (3.3.1 arasında) hazırlanan PCR ürününün 40 ul ve 150 ekleme (4.2.4 den) hazırlandı Candida hücrelerinin ul. </li><li> Oda sıcaklığında 30 dakika için iki transformasyon karışımları inkübe edin. </li><li> Her bir dönüşüm karışımı tüp, 700 ul LEVHA karışımı (10 mM Tris, pH 8.0, 1 mM EDTA, pH 8.0,% 50 polietilen glikol 3350 içinde 0.1 M lityum asetat) ekleyin. karıştırın ve oda sıcaklığında gece boyunca inkübe Tüpler haricindekileri. </li></ol></li><li> Gün 3, dönüşüm 1 saat 42 ° C (ısı şoku) de karışımları kuluçkaya yatmaktadır. <ol><li> Santrifüj dönüşümü bir mikrosantrifüj 16.000 xg&#39;de 30 sn karıştırır. Çıkarın ve düzgün süpernatant atın. hücrelere zarar vermemek üzere yavaşça pipetleme 150 ul su içinde hücre peletlerinin her yeniden süspanse edin ve. </li><li> dönüşümler ut içinauxotrophic marker genleri (örneğin URA3) ilizing, uygun seçici ortam agara çözüm pipetle (örneğin eksik üridin) tarafından her bütün karışımı plaka ve eşit steril cam boncuklar kullanarak karışımı yayıldı. </li><li> Burada tarif edildiği gibi nourseothricin direnç marker genini (NAT1) kullanılarak dönüşümleri için, levha dönüşümü seçici olmayan İpad agar üzerine ilk karışımları ve 6-12 saat boyunca 30 ° C&#39;de inkübe edin. stres nourseothricin önce hücre kurtarma sonrası ısı şok Bu adım yardımcıları, uygulanır. </li><li> Kısmi büyüme İyileştikten sonra, İpad üzerine kopya plaka Candida hücreleri, 400 ug / ml nourseothricin içeren. Beslenme marker genleri (örneğin, URA3) kullanılarak dönüşümler için, bu ara kaplama adımı gerekli değildir ve hücreler, 4.4.2 tarif edildiği gibi seçici bir maya ortamı (örneğin İpad yoksun üridin) üzerine kaplanabilir. NOT: dönüşüm başarılı olursa, colonies bir ila üç gün içinde ortaya çıkar (potansiyel olarak nourseothricin içeren agar üzerinde seçim için büyümesinin beş gün kadar) gerekir. Hiçbir koloniler tek başına (negatif kontrol) taşıyıcı DNA içeren dönüşüm karışımları ile yayılan plakalar üzerinde görünmelidir. </li></ol></li><li> okzotrofik ve nourseothricin işaretçi seçimi, taze seçici ortam agar plakalarına tek koloniler olarak çizgi Putatif transformantlar ve FP füzyonlar kurulmasında taranabilir maya hücreleri yaymak için 30 ° C&#39;de inkübe edin. </li><li> Ekran transformantlar etiketleme kasetinin doğru entegrasyon (ayrıntılı örneğin Örnek sonuçlar). ilgi konusu genin yeterli miktarda ifade edilirse, bütün koloni floresans floresans saptama yeteneğine sahip bir plaka görüntüleme sistemi kullanılarak potansiyel aday entegranlarm tespit etmek mümkün olduğu gibi meydana gelebilir. <ol><li> PCR outsid dizileri ile homolog primerler kullanılarak varsayımsal entegranlarm Girişentegrasyon bölgesinin e hedef gen füzyonu teyit etmek için. </li><li> Buna ek olarak, Batı füzyon proteininin ekspresyonu ve boyutunu belirlemek için benek analizi, hem de bilinen durumunda, protein lokalizasyonu görsel doğrulama için, tek hücre floresan mikroskobu düşünün. </li></ol></li></ol>

<ol>
	<li>Bendel, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colonization+and+epithelial+adhesion+in+the+pathogenesis+of+neonatal+candidiasis.">Colonization and epithelial adhesion in the pathogenesis of neonatal candidiasis.</a> Semin. Perinatol. 27 (5), 357-364 (2003).</li><li>Gerami-Nejad, M., Berman, J., Gale, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cassettes+for+PCR-mediated+construction+of+green,+yellow,+and+cyan+fluorescent+protein+fusions+in+Candida+albicans.">Cassettes for PCR-mediated construction of green, yellow, and cyan fluorescent protein fusions in Candida albicans.</a> Yeast. 18 (9), 859-864 (2001).</li><li>Gerami-Nejad, M., Dulmage, K., Berman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Additional+cassettes+for+epitope+and+fluorescent+fusion+proteins+in+Candida+albicans.">Additional cassettes for epitope and fluorescent fusion proteins in Candida albicans.</a> Yeast. 26 (7), 399-406 (2009).</li><li>Gerami-Nejad, M., Forche, A., McClellan, M., Berman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+protein+function+in+clinical+C.+albicans+isolates.">Analysis of protein function in clinical C. albicans isolates.</a> Yeast. 29 (8), 303-309 (2012).</li><li>Gerami-Nejad, M., Hausauer, D., McClellan, M., Berman, J., Gale, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cassettes+for+the+PCR-mediated+construction+of+regulatable+alleles+in+Candida+albicans.">Cassettes for the PCR-mediated construction of regulatable alleles in Candida albicans.</a> Yeast. 21 (5), 429-436 (2004).</li><li>Gonia, S., Larson, B., Gale, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR-mediated+gene+modification+strategy+for+construction+of+fluorescent+protein+fusions+in+Candida+parapsilosis.">PCR-mediated gene modification strategy for construction of fluorescent protein fusions in Candida parapsilosis.</a> Yeast. 33 (2), 63-69 (2016).</li><li>Milne, S. W., Cheetham, J., Lloyd, D., Aves, S., Bates, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cassettes+for+PCR-+mediated+gene+tagging+in+Candida+albicans+utilizing+nourseothricin+resistance.">Cassettes for PCR- mediated gene tagging in Candida albicans utilizing nourseothricin resistance.</a> Yeast. 28 (12), 833-841 (2011).</li><li>Ausubel, F. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Current Protocols in Molecular Biology. , (1995).</li><li>Wilson, R. B., Davis, D., Mitchell, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+hypothesis+testing+with+Candida+albicans+through+gene+disruption+with+short+homology+regions.">Rapid hypothesis testing with Candida albicans through gene disruption with short homology regions.</a> J. Bacteriol. 181 (6), 1868-1874 (1999).</li><li>Pulver, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rsr1+focuses+Cdc42+activity+at+hyphal+tips+and+promotes+maintenance+of+hyphal+development+in+Candida+albicans.">Rsr1 focuses Cdc42 activity at hyphal tips and promotes maintenance of hyphal development in Candida albicans.</a> Eukaryotic Cell. 12 (4), 482-495 (2013).</li><li>Falgier, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Candida+species+differ+in+their+interactions+with+immature+human+gastrointestinal+epithelial+cells.">Candida species differ in their interactions with immature human gastrointestinal epithelial cells.</a> Pediatr. Res. 69 (5), 384-389 (2011).</li><li>Nosek, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+manipulation+of+the+pathogenic+yeast+Candida+parapsilosis.">Genetic manipulation of the pathogenic yeast Candida parapsilosis.</a> Curr. Genet. 42 (1), 27-35 (2002).</li><li>Zemanova, J., Nosek, J., Tomaska, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-efficiency+transformation+of+the+pathogenic+yeast+Candida+parapsilosis.">High-efficiency transformation of the pathogenic yeast Candida parapsilosis.</a> Curr. Genet. 45 (3), 183-186 (2004).</li><li>Benjamin, D. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neonatal+candidiasis+among+extremely+low+birth+weight+infants:+risk+factors,+mortality+rates,+and+neurodevelopmental+outcomes+at+18+to+22+months.">Neonatal candidiasis among extremely low birth weight infants: risk factors, mortality rates, and neurodevelopmental outcomes at 18 to 22 months.</a> Pediatrics. 117 (1), 84-92 (2006).</li><li>Kullberg, B. J., Arendrup, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Invasive+Candidiasis.">Invasive Candidiasis.</a> N Engl J Med. 373 (15), 1445-1456 (2015).</li></ol>

Yazarlar ifşa hiçbir şey yok.

Epitopa inşası, yukarıda tarif edilen PCR aracılı gen modifikasyonu stratejisi kullanılarak Candida türleri dizilerin üç aşamalı bir süreç olarak özetlenebilir etiketli. İlk olarak, kaset iki maya genomu içine sokulması lokusuna homolog bütünleşme ve bölgeler için istenen dizisini kodlayan PCR ile yapılır. İkinci olarak, transforme edilecek maya hücreleri lityum asetat ve kaset ile birlikte kuluçkaya kimyasal olarak yetkin yapılır. Üçüncü olarak, hücreler, transformantların ku...

Candida türleri bütün insanların bağırsak ve genitoüriner yolları kolonize ortakçı mantarlardır. Öyle ki erken doğum ya da kanser tedavilerinden immünsupresif etkileri ile ortaya gibi immün yetmezlik koşulları altında, Candida türleri fırsatçı patojenler olabilir. Candida türlerinin, Candida albicans en yaygın mantar kolonize olup invaziv mantar enfeksiyonlarının çoğunluğu neden olur. Böyle C. glabrata, C. parapsilosis, C. tropicalis, ve C. gibi diğer Candida türleri, bazı sergileyen içsel direnç, bağışıklık sistemi baskılanmış hastalarda ciddi enfeksiyonlara neden kruseii yaygın Dolayısıyla böyle flukonazol ve amfoterisin B gibi anti-mantar kullanılan antibiyotiklere bu türlerin bazı enfeksiyonları özellikle de anti-mantar maddeleri ile profilaktik olarak tedavi edilen hastalarda daha sık rastlanmaktadır. Hatta uygun ve zamanında a ilenti-mantar tedavisi, invaziv Candida enfeksiyonları önemli morbidite ve mortalite 1 ile ilişkili olmaya devam etmektedir. Çünkü İnsan sağlığı Candida türleri önemi, bunların patogenezi düzenekleri ve iyi açıklanması izin hazır moleküler araçlar için bir ihtiyaç vardır. Araştırmacılar görselleştirmek ve mikrobiyal hücrelerin ve ifade proteinlerin ölçmek için olanak sağlayan bir önemli bir araçtır FP füzyon teknolojisidir. Polimeraz zincir reaksiyonu (PCR) aracılık ettiği gen modifikasyonu, bu yazıda tarif edildiği gibi AP dizileri ve genomik ilgilenilen sekansını kodlayan bir Candida proteini arasındaki füzyonlar yapımına izin verir. Yapının istikrarlı entegrasyon protein ifade analizinin yanı sıra protein yerelleştirme dinamikleri kolaylaştırır. AP dizilerini içeren plazmidler, Candida albicans içinde ekspresyon için optimize edilmiş ve PCR aracılı g kullanılabilenen modifikasyonu strateji, daha önce 2, 3, 4, 5, inşa edilmiştir. C. albicans, C. parapsilosis, 2, 3, 4, 5, 6, 7 tarafından tutulan bir besin marker genine bağlanmış bir AP sekansı: plazmidler AP dönüşüm &quot;kaset&quot; içerir. Şu anda mevcut plazmidler seçilebilir beslenme oksotrofik suşlarının transformasyonu için marker genleri (URA3, HIS1, ARG4) yanı sıra oksotrofilerinin yoksun klinik suşların dönüşmesini kolaylaştırmaktadır baskın bir ilâç rezistans markeri (NAT1), çeşitli içerir. Buna ek olarak, plazmidler yello dört farklı FP dizilerinin (yeşil [GFP], seçenekler içeriyor[YFP] W, mavi [CFP] ve kiraz [MCherry]) ve karboksi-termini, proteinin füzyonlarının inşa, veya amino-terminal protein füzyonları yapımı için bir promotör sekansı için bir ADH1 sonlandırma dizisi ya da. Primerler, AP kaseti çevreleyen plasmid DNA&#39;sına homoloji ile tasarlanmıştır. Buna ek olarak, primerler ayrıca, homolog rekombinasyon (Şekil 1) aracılığı ile genomik lokusuna kaset tümlemeyi kolaylaştırır etiketlenecek olan maya geninin homoloji taşıyan 5&#39;-uzantısı dizilerini ihtiva etmektedir. Gen spesifik AP kasetleri, PCR ile üretilen ve daha sonra, lityum asetat ile işlenmesi suretiyle DNA alımı için, yetkin hale getirilmiştir Candida hücrelerine transforme edilmiştir. <img alt="Şekil 1" src="/files/ftp_upload/55333/55333fig1.jpg" /> Şekil 1: FP dizisi füzyonları Candida türlerinin oluşturulur nasıl diyagramı. (A) plazmid DNA dahil olmakes bir AP dizisi ve direnç (NAT1) nourseothricin bir dizi kodlama. İleri (FWD) ve ters (REV) primerleri rölatif konumları plazmid dizisinin homoloji bölgesini gösteren primerler ve gene-özel homoloji bölgesini ya da primer uzaması gösteren mor kısımların siyah bölümleri ile gösterilir. (B) AP kasetleri Candida dönüştü ve homolog rekombinasyon (noktalı çizgiler) üzerinden ENO1 genomik içinde entegre edilmiştir. ENO1 3 &#39;ucunda AP füzyon sekansı Elde edilen (C). <a href="http://ecsource.jove.com/files/ftp_upload/55333/55333fig1large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a> Bu yazıda, Candida türlerinin protein füzyon (Eno1-FP) yapıların bir örnek sunuyoruz. Biz GFP, YFP kodlayan diziler ile birlikte NAT1 dönüşüm işaretleyici geni içeren plazmidler etiketleme, ya da kullanmakMCherry (Şekil 2). Bu plazmidler, karboksi-terminalinde FPS kaynaşık Eno1 ekspresyonu ile sonuçlanan ENO1 3&#39;-ucuna FP kaynaşmasını kolaylaştırmak gene özel kasetleri oluşturmak için PCR primerler ile birlikte kullanılmıştır. <img alt="şekil 2" src="/files/ftp_upload/55333/55333fig2.jpg" /> Şekil 2: FP kaset içeren plazmid Haritalar. İleri (F) ve plazmidlerden kasetleri oluşturmak için kullanılan geri (R) primerleri plazmidler kendi homoloji göreli konumu ile birlikte gösterilir. Tablo 1 &#39;de gösterildiği gibi olan primer sekanslarıdır. F1 ve R1 de pYFP- NAT1 kasetini oluşturmak için kullanıldı. YFP- NAT1 kaseti (pMG2263) içeren plazmid, GFP dizisinin yerine YFP dışında pMG2120 aynıdır. Kaset boyutları: GFP-NAT1, 3.7 kbp; mCherry- NAT1, 3.2 kbp&#39;lik; YFP- NAT1, 3.7 kbp. Bu rakam, Gerami-Nejad, ve ark modifiye edilmiştir. 4 <a href="http://ecsource.jove.com/files/ftp_upload/55333/55333fig2large.jpg" target="_blank">Bu rakamın büyük halini görmek için lütfen buraya tıklayınız.</a>

<table><tbody><tr><td>100 W mercury lamp</td><td>CHIU Technical Corporation</td><td>M-100T</td><td></td></tr><tr><td>95% Ethanol</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Adenine</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Ampicillin</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Carrier DNA</td><td>Ambion</td><td>AM9680</td><td>Sheared Salmon Sperm DNA 10 mg/ml</td></tr><tr><td>CCD Camera</td><td>Photometrics</td><td>CoolSNAP HQ</td><td></td></tr><tr><td>Conical Tube</td><td>Corning</td><td>430828</td><td>50 ml</td></tr><tr><td>Culture Tube Rotator</td><td>New Brunswick</td><td>2013923</td><td>TC-8, or Any Culture Tube Rotator</td></tr><tr><td>Deoxynucleotides (dNTP) PCR Grade</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Eppendorf Tubes</td><td>Eppendorf</td><td>022363719, 022363212</td><td>0.5 ml, 1.5 ml</td></tr><tr><td>Erlenmeyer Flask</td><td>Fisher Scientific</td><td>7250089</td><td>125 ml</td></tr><tr><td>Ethylenediaminetetraacetic Acid (EDTA)</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Freezer (-80 &amp;deg;C)</td><td>Thermo Electron Corporation</td><td>ULT-1386-9-V</td><td>Revco Ultima II</td></tr><tr><td>GFP, YFP and Texas Red Filter Sets</td><td>Chroma Technology Corporation</td><td>49002, 86004v2, 49008</td><td></td></tr><tr><td>Glass culture tubes</td><td>Fisher Scientific</td><td>1496126</td><td>75 mm</td></tr><tr><td>HRP goat anti-mouse antibody</td><td>Santa Cruz Biotechnology</td><td>SC-2005</td><td></td></tr><tr><td>HRP goat anti-rabbit antibody</td><td>Santa Cruz Biotechnology</td><td>SC-2301</td><td></td></tr><tr><td>Incubator (30 &amp;deg;C)</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Lithium Acetate</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Lysogeny Broth (LB) Media</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Magnesium Chloride</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Microcentrifuge</td><td>Eppendorf</td><td>5415 D</td><td></td></tr><tr><td>Microscope</td><td>Nikon</td><td>E600</td><td>Nikon Eclipse E600</td></tr><tr><td>Microscope Image Analysis Software</td><td>Universal Imaging Corporation</td><td>6.3r7</td><td>MetaMorph Software Series 6.3r7</td></tr><tr><td>Mouse anti-GFP antibody</td><td>Roche</td><td>11814460001</td><td></td></tr><tr><td>Nourseothricin</td><td>Fisher Scientific</td><td>50997939</td><td></td></tr><tr><td>PCR Thermocycler</td><td>Applied Biosystems</td><td>9700</td><td>GeneAmp PCR System</td></tr><tr><td>PCR tubes</td><td>BioExpress, GeneMate</td><td>T-3035-1</td><td>0.2 ml</td></tr><tr><td>Polyethylene Glycol 3350</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Potassium Chloride</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Rabbit anti-mCherry antibody</td><td>BioVision</td><td>5993-100</td><td></td></tr><tr><td>Refrigerator (4 &amp;deg;C)</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Sodium Acetate</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Stereomicroscope</td><td>Nikon</td><td>SMZ1500</td><td></td></tr><tr><td>Table Top Centrifuge</td><td>Labnet</td><td>Z 400</td><td>Hermle Z 400</td></tr><tr><td>&lt;em&gt;Taq&lt;/em&gt; DNA Polymerase</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Tris(hydroxymethyl)aminomethane (Tris)</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Vortex Mixer</td><td>Scientific Industries</td><td>SI-0236</td><td>Vortex Genie 2</td></tr><tr><td>Yeast Extract Peptone Dextrose (YPD) Media</td><td>Any</td><td>NA</td><td></td></tr></tbody></table>

generation of fluorescent protein fusions in candida species

Candida türleri, bağırsak ve genitoüriner yolun yaygın sömürgeciler, insanlarda invaziv fungal enfeksiyonların çoğunun nedenidir. Böylece, moleküler ve genetik araçlar Patogenezleri mekanizmalarının çalışmasını kolaylaştırmak için ihtiyaç vardır. PCR aracılı gen modifikasyonu da tespit edilmesi için epitop etiketli proteinlerin üretilmesi için basit ve hızlı bir yöntemdir. Özellikle, floresan proteini (FP) füzyonlar sırasıyla floresan mikroskopi ve immunoblotting, hem maya hücreleri ve protein görselleştirme ve kantitatif sağlayan güçlü araçlardır. Candida türleri dönüşümünü kolaylaştırır beslenme marker genleri ile birlikte, AP kodlama dizileri ihtiva eden plasmidler, Candida AP yapı ve ifade amacıyla oluşturulmuştur. Bu yazıda, bir Candida türlerinin bir AP füzyon oluşturmak için bir strateji sunmak. nourseothricin dayanıklı iş içeren plazmidlerya da yeşil, sarı, veya kiraz FP (GFP, YFP, MCherry) bir polimeraz zincir reaksiyonu (PCR) &#39;de gene özel sekansları içerir primerler ile birlikte kullanıldığı bir AP kaseti oluşturmak için dizilerin birlikte ım transformasyon işaretleyici gen (NAT1) . Bu gen spesifik kaseti, homolog rekombinasyon yoluyla, ilgili gen mahalinin 3&#39;-ucuna entegre yeteneğine sahiptir. ilgi konusu gen lokusu içerisine AP dizisinin başarıyla çerçeve füzyonu mikroskopi ve / veya immüno-saptama yöntemleri ile füzyon proteini ifade analizi, ardından genetik doğrulanır. Buna ek olarak, yüksek ölçüde sentezlenen proteinlerin durum için başarılı füzyonlar flüoresan görüntüleme teknikleri ile öncelikli olarak taranabilir.

Bir örnek olarak, bir C parapsilosis laboratuar suşunda Eno1 GFP ve MCherry füzyonları oluşturmak için yukarıda tarif edilen protokol kullanılmıştır. Her varsayımsal dönüştürücü ilk büyüme için tekrar boyandı edildi. Elde edilen füzyon proteini, yüksek (enolaz) olarak ifade edilir ve Çerçeve parlak olduğundan, bu örnekte, (Şekil 3) daha önceki tanı PCR gerçekleştirmeden floresan mikroskobu ile transformantların taranması mümk?...

Watch this Scientific Journal Video about Generation of Fluorescent Protein Fusions in Candida Species at JoVE.com

Generation of Fluorescent Protein Fusions in Candida Species

PCR aracılı gen modifikasyonu görselleştirme ve maya hücreleri ve proteinleri kantitatif kolaylaştırır Candida türleri, floresan protein füzyonları oluşturmak için de kullanılabilir. Bu yazıda, Candida parapsilosis bir floresan protein füzyon (Eno1-FP) oluşturmak için bir strateji sunmak.

Floresan protein füzyonları üretilmesi<em&gt; Candida</em&gt; Türler

Candida species, prevalent colonizers of the intestinal and genitourinary tracts, are the cause of the majority of invasive fungal infections in humans. ...

generation-of-fluorescent-protein-fusions-in-candida-species

Research

JoVE Journal

Genetics

Generation of Fluorescent Protein Fusions in Candida Species

10.6K Görüntüleme.  University of Minnesota.  PCR aracılı gen modifikasyonu görselleştirme ve maya hücreleri ve proteinleri kantitatif kolaylaştırır Candida türleri, floresan protein füzyonları oluşturmak için de kullanılabilir. Bu yazıda, Candida parapsilosis bir floresan protein füzyon (Eno1-FP) oluşturmak için bir strateji sunmak. 

Video: Generation of Fluorescent Protein Fusions in Candida Species

The C. elegans Excretory Canal as a Model for Intracellular Lumen Morphogenesis and In Vivo Polarized Membrane Biogenesis in a Single Cell: labeling by GFP-fusions, RNAi Interaction Screen and Imaging

The four C. elegans excretory canals are narrow tubes extended through the length of the animal from a single cell, with almost equally far extended intracellular endotubes that build and stabilize the lumen with a membrane and submembraneous cytoskeleton of apical character. The excretory cell expands its length approximately 2,000 times to generate these canals, making this model unique for the in vivo assessment of de novo polarized membrane biogenesis, intracellular lumen morphogenesis and unicellular tubulogenesis. The protocol presented here shows how to combine standard labeling, gain- and loss-of-function genetic or RNA interference (RNAi)-, and microscopic approaches to use this model to visually dissect and functionally analyze these processes on a molecular level. As an example of a labeling approach, the protocol outlines the generation of transgenic animals with fluorescent fusion proteins for live analysis of tubulogenesis. As an example of a genetic approach, it highlights key points of a visual RNAi-based interaction screen designed to modify a gain-of-function cystic canal phenotype. The specific methods described are how to: label and visualize the canals by expressing fluorescent proteins; construct a targeted RNAi library and strategize RNAi screening for the molecular analysis of canal morphogenesis; visually assess modifications of canal phenotypes; score them by dissecting fluorescence microscopy; characterize subcellular canal components at higher resolution by confocal microscopy; and quantify visual parameters. The approach is useful for the investigator who is interested in taking advantage of the C. elegans excretory canal for identifying and characterizing genes involved in the phylogenetically conserved processes of intracellular lumen and unicellular tube morphogenesis.

The C. elegans Excretory Canal as a Model for Intracellular Lumen Morphogenesis and In Vivo Polarized Membrane Biogenesis in a Single Cell: labeling by GFP-fusions, RNAi Interaction Screen and Imaging

The C. elegans excretory canal is a unique single-cell model for the visual in vivo analysis of de novo polarized membrane biogenesis. This protocol describes a combination of standard genetic/RNAi and imaging approaches, adaptable for the identification and characterization of molecules directing unicellular tubulogenesis, and apical membrane and lumen biogenesis.

C. elegans Excretory kanal hücre içi Lumen morfogenez ve In Vivo polarize membran Biyogenez tek bir hücrede için bir Model olarak: etiketleme GFP-füzyon, RNAi etkileşimi ekran ve görüntüleme

The four C. elegans excretory canals are narrow tubes extended through the length of the animal from a single cell, with almost equally far extended ...

Gelişim Biyolojisi

Biolistic Transformation of a Fluorescent Tagged Gene into the Opportunistic Fungal Pathogen Cryptococcus neoformans

The basidiomycete Cryptococcus neoformans, an invasive opportunistic pathogen of the central nervous system, is the most frequent cause of fungal meningitis worldwide resulting in more than 625,000 deaths per year worldwide.&#160;Although electroporation has been developed for the transformation of plasmids in Cryptococcus, only&#160;biolistic&#160;delivery provides&#160;an effective means to transform&#160;linear&#160;DNA&#160;that can be integrated into the genome by homologous recombination.&#160;
Acetate has been shown to be a major fermentation product during cryptococcal infection, but the significance of this is not yet known.&#160;A bacterial pathway composed of the enzymes xylulose-5-phosphate/fructose-6-phosphate phosphoketolase (Xfp) and acetate kinase (Ack) is one of three potential pathways for acetate production in C. neoformans. Here, we demonstrate the biolistic transformation of a construct, which has the gene encoding Ack fused to the fluorescent tag mCherry, into&#160;C. neoformans. We then confirm integration of the ACK-mCherry fusion into the&#160;ACK&#160;locus.

Biolistic Transformation of a Fluorescent Tagged Gene into the Opportunistic Fungal Pathogen Cryptococcus neoformans

Biolistic transformation is a method used to generate stable integration of DNA into the genome of the opportunistic pathogen Cryptococcus neoformans through homologous recombination. We will demonstrate biolistic transformation of a construct, which has the gene encoding acetate kinase fused to the fluorescent tag mCherry into&#160;C. neoformans.

Fırsatçı mantar patojenlere bir Floresan etiketli geninin biyolistik transformasyonu<em&gt; Cryptococcus neoformans</em

The basidiomycete Cryptococcus neoformans, an invasive opportunistic pathogen of the central nervous system, is the most frequent cause of fungal ...

İmmünoloji ve Enfeksiyon

Visualizing Yeast Organelles with Fluorescent Protein Markers

The budding yeast, Saccharomyces cerevisiae, is a classic model system in studying organelle function and dynamics. In our previous works, we have constructed fluorescent protein-based markers for major organelles and endomembrane structures, including the nucleus, endoplasmic reticulum (ER), Golgi apparatus, endosomes, vacuoles, mitochondria, peroxisomes, lipid droplets, and autophagosomes. The protocol presented here describes the procedures for using these markers in yeast, including DNA preparation for yeast transformation, selection and evaluation of transformants, fluorescent microscopic observation, and the expected outcomes. The text is geared toward researchers who are entering the field of yeast organelle study from other backgrounds. Essential steps are covered, as well as technical notes about microscope hardware considerations and several common pitfalls. It provides a starting point for people to observe yeast subcellular entities by live-cell fluorescent microscopy. These tools and methods can be used to identify protein subcellular localization and track organelles of interest in time-lapse imaging.

<meta charset="utf8"></head><body>Floresan Protein İşaretleyicileri ile Maya Organellerinin Görselleştirilmesi

Here we describe the use of a set of fluorescent protein-based organelle markers in live-cell imaging of the budding yeast, Saccharomyces cerevisiae.

Floresan Protein İşaretleyicileri ile Maya Organellerinin Görselleştirilmesi

The budding yeast, Saccharomyces cerevisiae, is a classic model system in studying organelle function and dynamics. In our previous works, we have ...

Biyokimya

In vivo Quantification of G Protein Coupled Receptor Interactions using Spectrally Resolved Two-photon Microscopy

The study of protein interactions in living cells is an important area of research because the information accumulated both benefits industrial applications as well as increases basic fundamental biological knowledge. F&ouml;rster (Fluorescence) Resonance Energy Transfer (FRET) between a donor molecule in an electronically excited state and a nearby acceptor molecule has been frequently utilized for studies of protein-protein interactions in living cells. The proteins of interest are tagged with two different types of fluorescent probes and expressed in biological cells. The fluorescent probes are then excited, typically using laser light, and the spectral properties of the fluorescence emission emanating from the fluorescent probes is collected and analyzed. Information regarding the degree of the protein interactions is embedded in the spectral emission data. Typically, the cell must be scanned a number of times in order to accumulate enough spectral information to accurately quantify the extent of the protein interactions for each region of interest within the cell. However, the molecular composition of these regions may change during the course of the acquisition process, limiting the spatial determination of the quantitative values of the apparent FRET efficiencies to an average over entire cells. By means of a spectrally resolved two-photon microscope, we are able to obtain a full set of spectrally resolved images after only one complete excitation scan of the sample of interest. From this pixel-level spectral data, a map of FRET efficiencies throughout the cell is calculated. By applying a simple theory of FRET in oligomeric complexes to the experimentally obtained distribution of FRET efficiencies throughout the cell, a single spectrally resolved scan reveals stoichiometric and structural information about the oligomer complex under study. Here we describe the procedure of preparing biological cells (the yeast Saccharomyces cerevisiae) expressing membrane receptors (sterile 2 &alpha;-factor receptors) tagged with two different types of fluorescent probes. Furthermore, we illustrate critical factors involved in collecting fluorescence data using the spectrally resolved two-photon microscopy imaging system. The use of this protocol may be extended to study any type of protein which can be expressed in a living cell with a fluorescent marker attached to it.

In vivo Quantification of G Protein Coupled Receptor Interactions using Spectrally Resolved Two-photon Microscopy

By employing a spectrally resolved two-photon microscopy imaging system, pixel-level maps of F&ouml;rster Resonance Energy Transfer (FRET) efficiencies are obtained for cells expressing membrane receptors hypothesized to form homo-oligomeric complexes. From the FRET efficiency maps, we are able to estimate stoichiometric information about the oligomer complex under study.

Işıksal Çözülmüş İki foton Mikroskop kullanarak G Protein Coupled Reseptör Etkileşmeleri in vivo Niceleme

The study of protein interactions in living cells is an important area of research because the information accumulated both benefits industrial ...

Biyoloji

Quantitative Live Cell Fluorescence-microscopy Analysis of Fission Yeast

Several microscopy techniques are available today that can detect a specific protein within the cell. During the last decade live cell imaging using fluorochromes like Green Fluorescent Protein (GFP) directly attached to the protein of interest has become increasingly popular 1. Using GFP and similar fluorochromes the subcellular localisations and movements of proteins can be detected in a fluorescent microscope. Moreover, also the subnuclear localisation of a certain region of a chromosome can be studied using this technique. GFP is fused to the Lac Repressor protein (LacR) and ectopically expressed in the cell where tandem repeats of the lacO sequence has been inserted into the region of interest on the chromosome2. The LacR-GFP will bind to the lacO repeats and that area of the genome will be visible as a green dot in the fluorescence microscope. Yeast is especially suited for this type of manipulation since homologous recombination is very efficient and thereby enables targeted integration of the lacO repeats and engineered fusion proteins with GFP 3. Here we describe a quantitative method for live cell analysis of fission yeast. Additional protocols for live cell analysis of fission yeast can be found, for example on how to make a movie of the meiotic chromosomal behaviour 4. In this particular experiment we focus on subnuclear organisation and how it is affected during gene induction. We have labelled a gene cluster, named Chr1, by the introduction of lacO binding sites in the vicinity of the genes. The gene cluster is enriched for genes that are induced early during nitrogen starvation of fission yeast 5. In the strain the nuclear membrane (NM) is labelled by the attachment of mCherry to the NM protein Cut11 giving rise to a red fluorescent signal. The Spindle Pole body (SPB) compound Sid4 is fused to Red Fluorescent Protein (Sid4-mRFP) 6. In vegetatively growing yeast cells the centromeres are always attached to the SPB that is embedded in the NM 7. The SPB is identified as a large round structure in the NM. By imaging before and 20 minutes after depletion of the nitrogen source we can determine the distance between the gene cluster (GFP) and the NM/SPB. The mean or median distances before and after nitrogen depletion are compared and we can thus quantify whether or not there is a shift in subcellular localisation of the gene cluster after nitrogen depletion.

The fission yeast, Schizosaccharomyces pombe, is a good model system to study basic cellular processes. Here we describe a method to perform quantitative live cell analysis of fission yeast. In this particular experiment we focus on organisation of the genome within the cell nucleus, but the method can also be used to study cytosolic factors.

Fisyon Maya Kantitatif Canlı Hücre Floresan mikroskopi Analizi

Several microscopy techniques are available today that can detect a specific protein within the cell. During the last decade live cell imaging using ...

Use of In Vivo Imaging to Screen for Morphogenesis Phenotypes in Candida albicans Mutant Strains During Active Infection in a Mammalian Host

Candida albicans is an important human pathogen. Its ability to switch between morphologic forms is central to&#160;its pathogenesis; these morphologic changes are regulated by a complex signaling network controlled in response to environmental stimuli. These regulatory components have been highly studied, but almost all studies use a variety of in vitro stimuli to trigger filamentation. To determine how morphogenesis is regulated during the pathogenesis process, we developed an in vivo microscopy system to obtain high spatial resolution images of organisms undergoing hyphal formation within the mammalian host. The protocol presented here describes the use of this system to screen small collections of C. albicans mutant strains, allowing us to identify key regulators of morphogenesis as it occurs at the site of infection. Representative results are presented, demonstrating that some regulators of morphogenesis, such as the transcriptional regulator Efg1, have consistent phenotypes in vitro and in vivo, whereas other regulators, such as adenyl cyclase (Cyr1), have significantly different phenotypes in vivo compared to in vitro.

Use of In Vivo Imaging to Screen for Morphogenesis Phenotypes in Candida albicans Mutant Strains During Active Infection in a Mammalian Host

This manuscript describes a method for screening moderately sized Candida albicans mutant libraries for morphogenesis phenotypes during active infection in a mammalian host using non-invasive confocal microscopy.

Bir Memeli Konağında Aktif Enfeksiyon Sırasında Candida albicans Mutant Suşlarında Morfogenez Fenotiplerini Taramak için In Vivo Görüntülemenin Kullanımı

Candida albicans is an important human pathogen. Its ability to switch between morphologic forms is central to&#160;its pathogenesis; these morphologic ...

Candida albicans ile İlişkili Kateter İlişkili Enfeksiyon için Bir Fare Modeli Oluşturma

A Catheter-Related Candida albicans Infection Model in Mouse

Catheter-related infection (CRI) is a common nosocomial infection caused by candida albicans during catheter implantation. Typically, biofilms are formed on the outer surface of the catheter and lead to disseminated infections, which are fatal to patients. There are no effective prevention and treatment management in clinics. Therefore, it is urgent to establish an animal model of CRI for the preclinical screening of new strategies for its prevention and treatment. In this study, a polyethylene catheter, a widely used medical catheter, was inserted into the back of the BALB/c mice after hair removal. Candida albicans ATCC MYA-2876 (SC5314) expressing enhanced green fluorescent protein was subsequently inoculated on the skin's surface along the catheter. Intense fluorescence was observed on the surface of the catheter under a fluorescent microscope 3 days later. Mature and thick biofilms were found on the surface of the catheter via scanning electron microscopy. These results indicated the adhesion, colonization, and biofilm formation of candida albicans on the surface of the catheter. The hyperplasia of the epidermis and the infiltration of inflammatory cells in the skin specimens indicated the histopathological changes of the CRI-associated skin. To sum up, a mouse CRI model was successfully established. This model is expected to be helpful in the research and development of therapeutic management for candida albicans associated CRI.

Yazar Spotlight: Floresan Protein Etiketleme Kullanarak Kateter Enfeksiyonlarında Candida albicans Tespitinin Geliştirilmesi 

We establish a mouse model of C.albicans-associated catheter-related infection (CRI), in which biofilm forms on the catheter, and the interaction between C.albicans and host correlates well with the clinical CRI. This model helps screen therapies for C.albicans biofilm-associated CRI, laying a foundation for clinical transformation.

Farede Kateterle İlişkili Candida albicans Enfeksiyon Modeli

Catheter-related infection (CRI) is a common nosocomial infection caused by candida albicans during catheter implantation. Typically, biofilms are formed ...

Floresan protein füzyonları üretilmesi

Özet

Daha Fazla Video Keşfet

C. elegans Excretory kanal hücre içi Lumen morfogenez ve In Vivo polarize membran Biyogenez tek bir hücrede için bir Model olarak: etiketleme GFP-füzyon, RNAi etkileşimi ekran ve görüntüleme

Fırsatçı mantar patojenlere bir Floresan etiketli geninin biyolistik transformasyonu

Floresan Protein İşaretleyicileri ile Maya Organellerinin Görselleştirilmesi

Floresan Protein İşaretleyicileri ile Maya Organellerinin Görselleştirilmesi

Işıksal Çözülmüş İki foton Mikroskop kullanarak G Protein Coupled Reseptör Etkileşmeleri in vivo Niceleme

Fisyon Maya Kantitatif Canlı Hücre Floresan mikroskopi Analizi

Bir Memeli Konağında Aktif Enfeksiyon Sırasında Candida albicans Mutant Suşlarında Morfogenez Fenotiplerini Taramak için In Vivo Görüntülemenin Kullanımı

Farede Kateterle İlişkili Candida albicans Enfeksiyon Modeli

Farede Kateterle İlişkili Candida albicans Enfeksiyon Modeli

Farede Kateterle İlişkili Candida albicans Enfeksiyon Modeli