Ringraziamo N. Dean per fornire la sequenza originale mCherry FP, M. Gerami-Nejad per la costruzione di plasmidi, B. Larson per l&#39;assistenza tecnica, e T. Heisel per consigli utili durante lo sviluppo di questo progetto. JB è stato sostenuto dal premio Consiglio europeo della ricerca avanzata 340.087 (RAPLODAPT). sistemi di microscopia e di imaging sono stati forniti dalla University of Minnesota Pediatria Foundation e l&#39;Università del Minnesota Imaging Center.

1. Isolare Template plasmidi da E. coli <ol><li> Grow E. coli contenenti il plasmide modello durante la notte in 10 ml di brodo lisogenia (LB) + 200 mg / L ampicillina (AMP) a 37 ° C con agitazione. </li><li> Celle di raccolta per centrifugazione a 6.000 xg per 2 min. </li><li> Decantare liquido, isolare e purificare il DNA da E. coli cellule con un metodo standard, come descritto in precedenza in Ausubel et al. 8. </li><li> Risospendere DNA in Tris-EDTA (TE; 10 mM Tris, pH 8,0, 1 mM EDTA, pH 8,0) ad una concentrazione di lavoro di 50-100 ng / ml. </li></ol> 2. Primer design <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td fo:width="0.5in" style="width:50px"> Primer </td><td> Sequenza Primer </td></tr><tr><td> F1 </td><td> 5 &#39; <strong&gt; GAGAATTGAAGAAGAGTTGGGAGACAATGCTATCTATGCTGGTAAGGACTTCCACAATGCTCAAACTTTG GGTGGTTCTAAAGGTGAAGAATTATT 3 &#39; </td></tr><tr><td> R1 </td><td> 5 &#39;GAGCGTTTGCACCAACAGGCCATCATTTGTGACGAGAGAAGACCTGACGTCATTAGATTGGCACCTTTGC GTAAAACGACGGCCAGTGAATTC 3 &#39; </td></tr><tr><td> F2 </td><td> 5 &#39;GAGAATTGAAGAAGAGTTGGGAGACAATGCTATCTATGCTGGTAAGGACTTCCACAATGCTCAAACTTTG GGTGGTGTTTCAAAAGGTGAAGAAGATAAT 3 &#39; </td></tr><tr><td> R2 </td><td> 5 &#39;GAGCGTTTGCACCAACAGGCCATCATTTGTGACGAGAGAAGACCTGACGTCATTAGATTGGCACCTTTGC ACTGGATGGCGGCGTTAGTATC 3 &#39; </td></tr></tbody></table> Tabella 1: sequenze di primer utilizzati in questo studio. Testo in corsivo grassetto indica omologia al ENO1 locus genomico, normali le regioni di font sono omologhi di DNA plasmidico. <ol> &lt;li&gt; primer design per essere omologo al plasmide sequenze confinanti la cassetta da amplificare nonché alla estremità 3 &#39;del gene bersaglio di interesse (ad es ENO1) agevolare ricombinazione nel locus genomico del gene (Figura 2 e Tabella 1) . <ol><li> Assicurarsi che le sequenze dei primer forward corrispondono ultimi 70 coppie di basi (bp) del gene di interesse, 5&#39;-3 &#39;, meno il codone di stop, per mantenere il telaio codifica, più la prima di circa 30 bp della sequenza plasmide siano amplificato. Come una nota, il GGTGGTGGTT in ogni primer è un linker poli-glicina senza FP omologia. Da segnalare, in assenza di un linker, non ci può essere la fusione diretta dei domini funzionali, che possono teoricamente portare a misfolding, bassa resa nella produzione di proteine, o bioattività compromessa. </li><li> Assicurarsi che le sequenze primer reverse sono 70 bp solo a valle del gene, 3&#39;5 &#39;, ad esclusione di qualsiasi sequenza genica, più l&#39;ultima approximately 30 bp del marcatore nutrizionale o resistenza ai farmaci utilizzati nel plasmide. </li><li> Usare F1 e R1 per generare GFP NAT1 e YFP- NAT1 cassette con rispettivamente pMG2120 e pMG2263, e F2 e R2 per generare mCherry- NAT1 con pMG2343. </li></ol></li></ol> 3. Generare FP cassette mediante PCR (1 ° giorno) <ol><li> Preparare i reagenti per la PCR. Fare un master mix (500 volume finale mL) aggiungendo i seguenti volumi e concentrazioni in una provetta da 1,5 ml: 50 microlitri di buffer PCR (500 mm cloruro di potassio, 100 mM Tris pH 8,0 in acqua), deoxynucleotides 20 microlitri (dNTP; magazzino miscela di nucleotidi a 10 mm ciascuno), 40 ml di 25 mM cloruro di magnesio, 20 l purificati plasmide (da ~ 50-100 ng / ml di soluzione), 10 ml ciascuno in avanti e di primer (da 10 soluzioni madre mM inversa), 30 ml di Taq polimerasi (generica, 5.000 unità / ml), e 320 ml di acqua. <ol><li> Aliquota 50 ml di master mix in ciascuno dei 10 PCR-compatibLe 0,5 ml tubi. </li></ol></li><li> Mettere provette PCR in termociclatore ed eseguire le seguenti operazioni: 1 ciclo di 5 min a 94 ° C per denaturare dsDNA; 40 cicli in sequenza di 45 secondi a 94 ° C, 30 sec a 55 ° C per consentire primers per temprare di plasmide DNA stampo, e 4 minuti a 68 ° C per l&#39;estensione dei prodotti DNA; e 1 ciclo estensione finale di 15 min a 72 ° C. possono avere bisogno di essere modificato in base alla particolare Taq polimerasi utilizzata master mix PCR e in bicicletta parametri: NOTA. </li><li> Pool tutti i prodotti provenienti dai 10 reazioni PCR in una provetta da 1,5 ml. <ol><li> Oggetto 5 ml di prodotto di PCR in pool a elettroforesi su gel di agarosio per verificare dimensioni amplicone ed ottenere una stima della concentrazione del prodotto, basata sul confronto di una scaletta DNA. In generale, usare ~ 250 mg di DNA cassette in ogni successiva mix di trasformazione. </li><li> Precipitare DNA aggiungendo acetato di 50 microlitri 3 M di sodio seguito da 750 microlitri 95% etanolo per i prodotti e incubare almeno 30 mina -20 ° C. </li><li> Raccogliere i prodotti PCR mediante centrifugazione del tubo a 16.000 xg per 10 min. Rimuovere con cautela e scartare il surnatante e asciugare il pellet durante la notte. Risospendere il DNA cassette pellet essiccati in 40 microlitri TE pH 8,0 e conservare a temperatura ambiente fino al momento dell&#39;uso. </li></ol></li></ol> 4. Trasformare cellule di Candida con FP DNA Cassette <ol><li> Il giorno 1, recuperare ceppo di lievito da trasformare da un glicerolo 15% congelati (-80 ° C) stock strisciando alcuni cristalli raschiati Onto lievito peptone destrosio con adenina (YPAD) agar e incubare a 30 ° C. Dopo il recupero della crescita delle colonie, inoculare una singola colonia in 2 ml di mezzo YPAD liquido in una provetta di vetro con tappo traspirante e incubare una notte a 30 ° C con agitazione. </li><li> Il giorno 2, diluire 300 ml di coltura di lievito durante la notte in 50 ml YPAD fresco (ad un OD finale 600 ~ 0.2) in un 125 ml beuta con un tappo traspirante. Agitare a 30 ° Cper ~ 3 ore (per un diametro finale 600 ~ 0,6-0,8). <ol><li> Versare il cultura durante la notte in una provetta conica da 50 ml e agglomerare le cellule mediante centrifugazione per 5 min a 1 500 xg in una centrifuga da tavolo. </li><li> Eliminare e scartare correttamente il surnatante. Risospendere il pellet di cellule in acqua 5 ml. Re-agglomerare le cellule per centrifugazione ancora per 5 min a 1500 xg in una centrifuga da tavolo. </li><li> Eliminare e scartare correttamente il surnatante. Risospendere le cellule in 500 microlitri TELiAc (TE litio acetato: 10 mM Tris, pH 8,0, 1 mM EDTA, pH 8,0, 0,1 M di litio acetato) durante il trasferimento in una provetta da 1,5 ml. Centrifugare la provetta per 2 minuti a 3000 xg in una microcentrifuga. </li><li> Risospendere le cellule in 250 microlitri TELiAc. Il volume totale compreso il pellet dovrebbe essere ~ 300 microlitri. </li></ol></li><li> Per un (provetta da microcentrifuga diverso in 4.2.4) pulito, aggiungere 5 microlitri vettore DNA (10 mg / ml) e 150 ml di cellule di Candida preparati (da 4.2.4). Questo è il controllo negativo per donnaransformation. <ol><li> Per un secondo tubo da microcentrifuga pulita, aggiungere 5 ml di DNA denaturato (carrier che è stata bollita a 90 ° C per 10 min e raffreddato a 4 ° C), tutti i 40 microlitri del prodotto PCR preparato (da 3.3.1) e 150 pl di cellule di Candida preparati (da 4.2.4). </li><li> Incubare le due miscele di trasformazione per 30 min a temperatura ambiente. </li><li> Per ogni tubo mix trasformazione, aggiungere 700 microlitri della miscela PLATE (10 mM Tris, pH 8,0, 1 mM EDTA, pH 8,0, 0,1 M di litio acetato in 50% di polietilene glicole 3350). Capovolgere i tubi per miscelare e incubare una notte a temperatura ambiente. </li></ol></li><li> Il giorno 3, incubare la trasformazione si mescola a 42 ° C per 1 ora (shock termico). <ol><li> Centrifugare la trasformazione miscele per 30 secondi a 16.000 xg in una microcentrifuga. Rimuovere e gettare correttamente il surnatante. Risospendere ciascuno dei pellet cellulari in 150 microlitri di acqua delicatamente pipettando su e giù in modo da non danneggiare le cellule. </li><li> Per le trasformazioni utilizing geni marcatori auxotrofi (ad esempio URA3), piastra ogni intera miscela pipettando le soluzioni sul appropriata agar terreni selettivi (ad es uridina manca) e diffondere la miscela in modo uniforme utilizzando microsfere di vetro sterili. </li><li> Per trasformazioni utilizzando il gene marcatore di resistenza nourseothricin (NAT1), come descritto qui, piastra di trasformazione mescola prima sul agar YPAD non selettiva e incubare a 30 ° C per 6-12 ore. Questo passo aiuti nel recupero delle cellule, shock post di calore, prima nourseothricin lo stress è applicato. </li><li> Dopo il recupero della crescita parziale, piastra replica le cellule Candida Onto YPAD contenente 400 mg / ml nourseothricin. Per le trasformazioni che utilizzano geni marcatori nutrizionali (per esempio URA3), questa fase intermedia la placcatura non è necessario e le cellule può essere placcato direttamente su supporti di lievito selettivi (ad esempio YPAD manca uridina), come descritto in 4.4.2. NOTA: Se la trasformazione è successo, colOnies dovrebbe apparire da uno a tre giorni (potenzialmente fino a cinque giorni di conseguenza per la selezione su agar nourseothricin contenente). Non ci sono colonie dovrebbero apparire su piastre diffuse con miscele di trasformazione che contengono DNA vettore da solo (controllo negativo). </li></ol></li><li> Per la selezione marcatore auxotrophic e nourseothricin, striscia trasformanti putativi come singole colonie per piastre di agar terreni selettivi freschi e incubare a 30 ° C per propagare cellule di lievito che possono essere sottoposti a screening per la costruzione di successo di fusioni FP. </li><li> Trasformanti dello schermo per la corretta integrazione della cassetta di tagging (vedi Rappresentante dei risultati per un esempio dettagliato). Se il gene di interesse viene espresso in quantità sufficiente, tutta la colonia fluorescenza può verificare tale che è possibile rilevare potenziali candidati integrants utilizzando un sistema di imaging piastra con capacità di rilevamento di fluorescenza. <ol><li> Controllare integrants putativi mediante PCR utilizzando primer omologa a sequenze outside della regione di integrazione per confermare fusione al gene bersaglio. </li><li> Inoltre, in considerazione analisi Western blot per determinare l&#39;espressione e dimensioni della proteina di fusione, come anche per microscopia a fluorescenza di singole cellule per la conferma visiva della localizzazione delle proteine, se noto. </li></ol></li></ol>

<ol>
	<li>Bendel, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colonization+and+epithelial+adhesion+in+the+pathogenesis+of+neonatal+candidiasis.">Colonization and epithelial adhesion in the pathogenesis of neonatal candidiasis.</a> Semin. Perinatol. 27 (5), 357-364 (2003).</li><li>Gerami-Nejad, M., Berman, J., Gale, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cassettes+for+PCR-mediated+construction+of+green,+yellow,+and+cyan+fluorescent+protein+fusions+in+Candida+albicans.">Cassettes for PCR-mediated construction of green, yellow, and cyan fluorescent protein fusions in Candida albicans.</a> Yeast. 18 (9), 859-864 (2001).</li><li>Gerami-Nejad, M., Dulmage, K., Berman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Additional+cassettes+for+epitope+and+fluorescent+fusion+proteins+in+Candida+albicans.">Additional cassettes for epitope and fluorescent fusion proteins in Candida albicans.</a> Yeast. 26 (7), 399-406 (2009).</li><li>Gerami-Nejad, M., Forche, A., McClellan, M., Berman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+protein+function+in+clinical+C.+albicans+isolates.">Analysis of protein function in clinical C. albicans isolates.</a> Yeast. 29 (8), 303-309 (2012).</li><li>Gerami-Nejad, M., Hausauer, D., McClellan, M., Berman, J., Gale, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cassettes+for+the+PCR-mediated+construction+of+regulatable+alleles+in+Candida+albicans.">Cassettes for the PCR-mediated construction of regulatable alleles in Candida albicans.</a> Yeast. 21 (5), 429-436 (2004).</li><li>Gonia, S., Larson, B., Gale, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR-mediated+gene+modification+strategy+for+construction+of+fluorescent+protein+fusions+in+Candida+parapsilosis.">PCR-mediated gene modification strategy for construction of fluorescent protein fusions in Candida parapsilosis.</a> Yeast. 33 (2), 63-69 (2016).</li><li>Milne, S. W., Cheetham, J., Lloyd, D., Aves, S., Bates, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cassettes+for+PCR-+mediated+gene+tagging+in+Candida+albicans+utilizing+nourseothricin+resistance.">Cassettes for PCR- mediated gene tagging in Candida albicans utilizing nourseothricin resistance.</a> Yeast. 28 (12), 833-841 (2011).</li><li>Ausubel, F. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Current Protocols in Molecular Biology. , (1995).</li><li>Wilson, R. B., Davis, D., Mitchell, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+hypothesis+testing+with+Candida+albicans+through+gene+disruption+with+short+homology+regions.">Rapid hypothesis testing with Candida albicans through gene disruption with short homology regions.</a> J. Bacteriol. 181 (6), 1868-1874 (1999).</li><li>Pulver, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rsr1+focuses+Cdc42+activity+at+hyphal+tips+and+promotes+maintenance+of+hyphal+development+in+Candida+albicans.">Rsr1 focuses Cdc42 activity at hyphal tips and promotes maintenance of hyphal development in Candida albicans.</a> Eukaryotic Cell. 12 (4), 482-495 (2013).</li><li>Falgier, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Candida+species+differ+in+their+interactions+with+immature+human+gastrointestinal+epithelial+cells.">Candida species differ in their interactions with immature human gastrointestinal epithelial cells.</a> Pediatr. Res. 69 (5), 384-389 (2011).</li><li>Nosek, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+manipulation+of+the+pathogenic+yeast+Candida+parapsilosis.">Genetic manipulation of the pathogenic yeast Candida parapsilosis.</a> Curr. Genet. 42 (1), 27-35 (2002).</li><li>Zemanova, J., Nosek, J., Tomaska, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-efficiency+transformation+of+the+pathogenic+yeast+Candida+parapsilosis.">High-efficiency transformation of the pathogenic yeast Candida parapsilosis.</a> Curr. Genet. 45 (3), 183-186 (2004).</li><li>Benjamin, D. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neonatal+candidiasis+among+extremely+low+birth+weight+infants:+risk+factors,+mortality+rates,+and+neurodevelopmental+outcomes+at+18+to+22+months.">Neonatal candidiasis among extremely low birth weight infants: risk factors, mortality rates, and neurodevelopmental outcomes at 18 to 22 months.</a> Pediatrics. 117 (1), 84-92 (2006).</li><li>Kullberg, B. J., Arendrup, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Invasive+Candidiasis.">Invasive Candidiasis.</a> N Engl J Med. 373 (15), 1445-1456 (2015).</li></ol>

Gli autori non hanno nulla da rivelare.

Costruzione di epitopo etichettato sequenze in specie Candida utilizzando la strategia di modificazione genetica PCR-mediata sopra descritto possono essere riassunti come un processo in tre fasi. Innanzitutto, una cassetta è fatta da PCR che codifica sia la sequenza desiderata di integrazione e regioni omologa al locus di inserimento nel genoma di lievito. In secondo luogo, le cellule di lievito da trasformare sono chimicamente competenti con acetato di litio e co-incubate con la cassetta. Terzo, le cellule ve...

Specie di Candida sono funghi commensali che colonizzano i tratti intestinali e genito-urinario di tutti gli esseri umani. In condizioni di immunodeficienza, come ad esempio che si verificano con parto prematuro o effetti immunosoppressivi di trattamenti per il cancro, specie Candida possono diventare patogeni opportunisti. Tra le specie di Candida, Candida albicans è il colonizzatore fungina più diffusa e provoca la maggior parte delle infezioni fungine invasive. Altre specie di Candida come C. glabrata, C. parapsilosis, C. tropicalis e C. kruseii anche causare gravi infezioni nei pazienti immunocompromessi, con qualche esibendo resistenza intrinseca alla usati comunemente antibiotici anti-fungine quali fluconazolo e amfotericina B. Quindi, infezioni con alcune di queste specie sono osservati più frequentemente, soprattutto nei pazienti in trattamento profilattico con farmaci anti-fungini. Anche con una appropriata e tempestivatrattamento NTI-fungine, infezioni da Candida invasive continuano ad essere associata a morbidità e mortalità 1 significativa. A causa del significato di specie Candida nella salute umana, vi è l&#39;esigenza di strumenti molecolari prontamente disponibili che permettono lo studio e la spiegazione dei loro meccanismi patogeni. Uno strumento importante che permette ai ricercatori di visualizzare e quantificare le cellule microbiche e le proteine ​​che essi esprimono è tecnologia della fusione FP. Reazione a catena della polimerasi (PCR) mediata modificazione genetica, come descritto in questo documento, permette la costruzione di fusioni, tra le sequenze FP ed una proteina Candida sequenza codificante di interesse al suo locus genomico. Integrazione stabile del costrutto facilita l&#39;analisi dell&#39;espressione della proteina e dinamiche localizzazione della proteina. I plasmidi contenenti sequenze FP, ottimizzati per l&#39;espressione in Candida albicans e che possono essere utilizzati nella g PCR-mediatastrategia modifica ene, è stato costruito in precedenza 2, 3, 4, 5. I plasmidi contengono FP trasformazione &quot;cassette&quot;: una sequenza FP legato ad un gene marcatore nutrizionale che facilita la trasformazione di C. albicans e C. parapsilosis 2, 3, 4, 5, 6, 7. Attualmente plasmidi disponibili contengono una varietà di geni marcatori selezionabili nutrizionali (URA3, HIS1, Arg4) per la trasformazione di ceppi auxotrofi così come marcatore resistenza ai farmaci dominante (NAT1), che facilita la trasformazione di ceppi clinici privi auxotrophies. Inoltre, plasmidi contengono opzioni per un massimo di quattro differenti sequenze FP (verde [GFP], Yellow [YFP], ciano [CFP], e la ciliegia [mCherry]) e sia una sequenza di terminazione ADH1 per la costruzione di fusioni di proteine carbossi-terminale, o di una sequenza promotrice per la costruzione di fusioni di proteine amino-terminale. Primer sono progettati con omologia al DNA plasmidico che circonda la cassetta FP. Inoltre, i primer contengono anche sequenze 5&#39;-estensione recanti omologia con il gene di lievito di interesse per essere etichettato, che facilita l&#39;integrazione della cassetta nel locus genomico tramite ricombinazione omologa (Figura 1). Gene-specifici cassette FP sono generati mediante PCR e poi trasformati in cellule di Candida rese competenti per l&#39;assorbimento di DNA mediante trattamento con acetato di litio. <img alt="Figura 1" src="/files/ftp_upload/55333/55333fig1.jpg" /> Figura 1: Diagramma di come FP fusioni sequenza sono generati in specie di Candida. (A) inclusa, plasmidi DNAes una sequenza FP e una codifica sequenza nourseothricin resistenza (NAT1). posizioni relative di Forward (FWD) e reverse primer (REV) sono mostrati, con porzioni nere dei primer che indica la regione di omologia alla sequenza plasmidi e le porzioni viola denotano la regione di omologia gene-specifica o estensione di primer. Cassette (B) FP si trasformano in Candida e si integrano all&#39;interno del ENO1 locus genomico mediante ricombinazione omologa (linee tratteggiate). (C) risultante FP sequenza di fusione presso il 3&#39;end di ENO1. <a href="http://ecsource.jove.com/files/ftp_upload/55333/55333fig1large.jpg" target="_blank">Clicca qui per vedere una versione più grande di questa figura.</a> Qui, vi presentiamo un esempio di fusione di proteine (Eno1-FP) costruzioni in specie di Candida. Usiamo codifica plasmidi contenenti il gene marcatore NAT1 trasformazione insieme a sequenze codificanti GFP, YFP, omCherry (Figura 2). Questi plasmidi sono utilizzati insieme con primer in PCR per generare cassette gene-specifici che facilitano fusione PQ alla estremità 3 &#39;del ENO1, con conseguente espressione di Eno1 fusa PQ al suo carbossi-terminale. <img alt="figura 2" src="/files/ftp_upload/55333/55333fig2.jpg" /> Figura 2: Mappe di FP plasmidi cassette contenenti. Forward (F) e reverse primer (R) utilizzati per generare le cassette dei plasmidi sono indicati nonché la posizione relativa della loro omologia con i plasmidi. Sequenze primer sono elencati nella tabella 1. F1 e R1 sono stati utilizzati anche per generare la cassetta pYFP- NAT1. Il plasmide contenente la cassetta YFP- NAT1 (pMG2263) è identica a pMG2120 con l&#39;eccezione di YFP al posto della sequenza GFP. Dimensioni cassette: GFP-NAT1, 3.7 KBP; mCherry- NAT1, 3,2 kbp; YFP- NAT1, 3.7 kbp. Questo dato è stato modificato da Gerami-Nejad, et al. 4 <a href="http://ecsource.jove.com/files/ftp_upload/55333/55333fig2large.jpg" target="_blank">Clicca qui per vedere una versione più grande di questa figura.</a>

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>100W mercury lamp</td>
			<td>CHIU Technical Corporation</td>
			<td>M-100T</td>
			<td></td>
		</tr>
		<tr>
			<td>95% Ethanol</td>
			<td>Any</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Adenine</td>
			<td>Any</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Any</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Carrier DNA</td>
			<td>Ambion</td>
			<td>AM9680</td>
			<td>Sheared Salmon Sperm DNA 10 mg/ml</td>
		</tr>
		<tr>
			<td>CCD Camera</td>
			<td>Photometrics</td>
			<td>CoolSNAP HQ</td>
			<td></td>
		</tr>
		<tr>
			<td>Conical Tube</td>
			<td>Corning</td>
			<td>430828</td>
			<td>50ml</td>
		</tr>
		<tr>
			<td>Culture Tube Rotator</td>
			<td>New Brunswick</td>
			<td>2013923</td>
			<td>TC-8, or Any Culture Tube Rotator</td>
		</tr>
		<tr>
			<td>Deoxynucleotides (dNTP) PCR Grade</td>
			<td>Any</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Eppendorf Tubes</td>
			<td>Eppendorf</td>
			<td>022363719, 022363212</td>
			<td>0.5ml, 1.5ml</td>
		</tr>
		<tr>
			<td>Erlenmeyer Flask</td>
			<td>Fisher Scientific</td>
			<td>7250089</td>
			<td>125ml</td>
		</tr>
		<tr>
			<td>Ethylenediaminetetraacetic Acid (EDTA)</td>
			<td>Any</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Freezer (-80 &#176;C )</td>
			<td>Thermo Electron Corporation</td>
			<td>ULT-1386-9-V</td>
			<td>Revco Ultima II</td>
		</tr>
		<tr>
			<td>GFP, YFP and Texas Red Filter Sets</td>
			<td>Chroma Technology Corporation</td>
			<td>49002, 86004v2, 49008</td>
			<td></td>
		</tr>
		<tr>
			<td>Glass culture tubes</td>
			<td>Fisher Scientific</td>
			<td>1496126</td>
			<td>75mm</td>
		</tr>
		<tr>
			<td>HRP goat anti-mouse antibody</td>
			<td>Santa Cruz Biotechnology</td>
			<td>SC-2005</td>
			<td></td>
		</tr>
		<tr>
			<td>HRP goat anti-rabbit antibody</td>
			<td>Santa Cruz Biotechnology</td>
			<td>SC-2301</td>
			<td></td>
		</tr>
		<tr>
			<td>Incubator (30 &#176;C )</td>
			<td>Any</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Lithium Acetate</td>
			<td>Any</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Lysogeny Broth (LB) Media</td>
			<td>Any</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnesium Chloride</td>
			<td>Any</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Microcentrifuge</td>
			<td>Eppendorf</td>
			<td>5415 D</td>
			<td></td>
		</tr>
		<tr>
			<td>Microscope</td>
			<td>Nikon</td>
			<td>E600</td>
			<td>Nikon Eclipse E600</td>
		</tr>
		<tr>
			<td>Microscope Image Analysis Software</td>
			<td>Universal Imaging Corporation</td>
			<td>6.3r7</td>
			<td>MetaMorph Software Series 6.3r7</td>
		</tr>
		<tr>
			<td>Mouse anti-GFP antibody</td>
			<td>Roche</td>
			<td>11814460001</td>
			<td></td>
		</tr>
		<tr>
			<td>Nourseothricin</td>
			<td>Fisher Scientific</td>
			<td>50997939</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR Thermocycler</td>
			<td>Applied Biosystems</td>
			<td>9700</td>
			<td>GeneAmp PCR System</td>
		</tr>
		<tr>
			<td>PCR tubes</td>
			<td>BioExpress, GeneMate</td>
			<td>T-3035-1</td>
			<td>0.2ml</td>
		</tr>
		<tr>
			<td>Polyethylene Glycol 3350</td>
			<td>Any</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium Chloride</td>
			<td>Any</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Rabbit anti-mCherry antibody</td>
			<td>BioVision</td>
			<td>5993-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Refrigerator (4&#176;C)</td>
			<td>Any</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Acetate</td>
			<td>Any</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Stereomicroscope</td>
			<td>Nikon</td>
			<td>SMZ1500</td>
			<td></td>
		</tr>
		<tr>
			<td>Table Top Centrifuge</td>
			<td>Labnet</td>
			<td>Z 400</td>
			<td>Hermle Z 400</td>
		</tr>
		<tr>
			<td>Taq DNA Polymerase</td>
			<td>Any</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris(hydroxymethyl)aminomethane (Tris)</td>
			<td>Any</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Vortex Mixer</td>
			<td>Scientific Industries</td>
			<td>SI-0236</td>
			<td>Vortex Genie 2</td>
		</tr>
		<tr>
			<td>Yeast Extract Peptone Dextrose (YPD) Media</td>
			<td>Any</td>
			<td>NA</td>
			<td></td>
		</tr>
	</tbody>
</table>

generation of fluorescent protein fusions in candida species

Specie di Candida, colonizzatori prevalente dei tratti intestinali e genito-urinario, sono la causa della maggior parte delle infezioni fungine invasive sugli esseri umani. Pertanto, sono necessari strumenti molecolari e genetici per facilitare lo studio dei loro meccanismi patogeni. PCR-mediata modificazione genetica è un metodo semplice e rapido per generare proteine ​​epitopi-tag per facilitare la loro individuazione. In particolare, la proteina fluorescente (FP) fusioni sono potenti strumenti che consentono la visualizzazione e la quantificazione di entrambe le cellule di lievito e proteine ​​da microscopia a fluorescenza e immunoblotting, rispettivamente. I plasmidi contenenti FP sequenze di codifica, insieme con geni marcatori nutrizionali che facilitano la trasformazione delle specie Candida, sono stati generati al fine di costruzione FP ed espressione in Candida. Qui, vi presentiamo una strategia per la costruzione di una fusione FP in una specie di Candida. I plasmidi contenenti il ​​impermeabi nourseothricinnce gene marcatore di trasformazione (NAT1) insieme a sequenze per uno verde, giallo, o ciliegio PQ (GFP, YFP, mCherry) sono utilizzati insieme con gli iniettori che comprendono sequenze gene-specifici in una reazione a catena della polimerasi (PCR) per generare una cassetta FP . Questa cassetta-specific gene ha la capacità di integrarsi nel 3&#39;-end del corrispondente locus genico mediante ricombinazione omologa. Successful fusione in-frame della sequenza FP nel locus gene di interesse viene verificato geneticamente, seguita da analisi dell&#39;espressione della proteina di fusione mediante microscopia e / o metodi immuno-rilevazione. Inoltre, nel caso di proteine ​​altamente espressi, fusioni successo possono essere esaminati per principalmente da tecniche di imaging di fluorescenza.

A titolo di esempio, abbiamo usato il protocollo sopra descritto per la costruzione di GFP e mCherry fusioni di Eno1 in un ceppo di laboratorio C. parapsilosis. Ogni transformant putativo è stato inizialmente restreaked per la crescita. In questo esempio, dal momento che la proteina di fusione risultante è altamente espresso (enolasi) e le PQ sono luminose, siamo stati in grado di schermare trasformanti di microscopia a fluorescenza prima di eseguire una diagnosi mediante PCR ...

Watch this Scientific Journal Video about Generation of Fluorescent Protein Fusions in Candida Species at JoVE.com

Generation of Fluorescent Protein Fusions in Candida Species

Modificazione genetica PCR-mediata può essere utilizzato per generare fusioni di proteine fluorescenti a Candida specie, che facilita la visualizzazione e la quantificazione delle cellule di lievito e proteine. Qui, vi presentiamo una strategia per la costruzione di una fusione proteina fluorescente (Eno1-FP) in Candida parapsilosis.

Generazione di fusioni proteina fluorescente in<em&gt; Candida</em&gt; Specie

Candida species, prevalent colonizers of the intestinal and genitourinary tracts, are the cause of the majority of invasive fungal infections in humans. ...

generation-of-fluorescent-protein-fusions-in-candida-species

Research

JoVE Journal

Genetics

Generation of Fluorescent Protein Fusions in Candida Species

10.6K Views.  University of Minnesota.  Modificazione genetica PCR-mediata può essere utilizzato per generare fusioni di proteine fluorescenti a Candida specie, che facilita la visualizzazione e la quantificazione delle cellule di lievito e proteine. Qui, vi presentiamo una strategia per la costruzione di una fusione proteina fluorescente (Eno1-FP) in Candida parapsilosis. 

Video: Generation of Fluorescent Protein Fusions in Candida Species

High Resolution Fluorescent In Situ Hybridization in Drosophila Embryos and Tissues Using Tyramide Signal Amplification

In our efforts to determine the patterns of expression and subcellular localization of Drosophila RNAs on a genome-wide basis, and in a variety of tissues, we have developed numerous modifications and improvements to our original fluorescent in situ hybridization (FISH) protocol. To facilitate throughput and cost effectiveness, all steps, from probe generation to signal detection, are performed using exon 96-well microtiter plates. Digoxygenin (DIG)-labelled antisense RNA probes are produced using either cDNA clones or genomic DNA as templates. After tissue fixation and permeabilization, probes are hybridized to transcripts of interest and then detected using a succession of anti-DIG antibody conjugated to biotin, streptavidin conjugated to horseradish peroxidase (HRP) and fluorescently conjugated tyramide, which in the presence of HRP, produces a highly reactive intermediate that binds to electron dense regions of immediately adjacent proteins. These amplification and localization steps produce a robust and highly localized signal that facilitates both cellular and subcellular transcript localization. The protocols provided have been optimized to produce highly specific signals in a variety of tissues and developmental stages. References are also provided for additional variations that allow the simultaneous detection of multiple transcripts, or transcripts and proteins, at the same time.

High Resolution Fluorescent In Situ Hybridization in Drosophila Embryos and Tissues Using Tyramide Signal Amplification

The described RNA in situ hybridization protocol allows the detection of RNA in whole Drosophila embryos or dissected tissues. Using 96-well microtiter plates and tyramide signal amplification, transcripts can be detected at high resolution, sensitivity, and throughput, and at a relatively low cost.

Ibridazione fluorescente In Situ ad alta risoluzione in embrioni della drosofila e tessuti mediante amplificazione del segnale Tyramide

In our efforts to determine the patterns of expression and subcellular localization of Drosophila RNAs on a genome-wide basis, and in a variety of ...

Ricerca

Genetica

Targeted Next-generation Sequencing and Bioinformatics Pipeline to Evaluate Genetic Determinants of Constitutional Disease

Next-generation sequencing (NGS) is quickly revolutionizing how research into the genetic determinants of constitutional disease is performed. The technique is highly efficient with millions of sequencing reads being produced in a short time span and at relatively low cost. Specifically, targeted NGS is able to focus investigations to genomic regions of particular interest based on the disease of study. Not only does this further reduce costs and increase the speed of the process, but it lessens the computational burden that often accompanies NGS. Although targeted NGS is restricted to certain regions of the genome, preventing identification of potential novel loci of interest, it can be an excellent technique when faced with a phenotypically and genetically heterogeneous disease, for which there are previously known genetic associations. Because of the complex nature of the sequencing technique, it is important to closely adhere to protocols and methodologies in order to achieve sequencing reads of high coverage and quality. Further, once sequencing reads are obtained, a sophisticated bioinformatics workflow is utilized to accurately map reads to a reference genome, to call variants, and to ensure the variants pass quality metrics. Variants must also be annotated and curated based on their clinical significance, which can be standardized by applying the American College of Medical Genetics and Genomics Pathogenicity Guidelines. The methods presented herein will display the steps involved in generating and analyzing NGS data from a targeted sequencing panel, using the ONDRISeq neurodegenerative disease panel as a model, to identify variants that may be of clinical significance.

Targeted next-generation sequencing is a time- and cost-efficient approach that is becoming increasingly popular in both disease research and clinical diagnostics. The protocol described here presents the complex workflow required for sequencing and the bioinformatics process used to identify genetic variants that contribute to disease.

Sequenziamento di nuova generazione e bioinformatica Pipeline per valutare fattori determinanti genetici della malattia costituzionale mirati

Next-generation sequencing (NGS) is quickly revolutionizing how research into the genetic determinants of constitutional disease is performed. The ...

CRISPR-mediated Genome Editing of the Human Fungal Pathogen Candida albicans

This method describes the efficient CRISPR mediated genome editing of the diploid human fungal pathogen Candida albicans. CRISPR-mediated genome editing in C. albicans requires Cas9, guide RNA, and repair template. A plasmid expressing a yeast codon optimized Cas9 (CaCas9) has been generated. Guide sequences directly upstream from a PAM site (NGG) are cloned into the Cas9 expression vector. A repair template is then made by primer extension in vitro. Cotransformation of the repair template and vector into C. albicans leads to genome editing. Depending on the repair template used, the investigator can introduce nucleotide changes, insertions, or deletions. As C. albicans is a diploid, mutations are made in both alleles of a gene, provided that the A and B alleles do not harbor SNPs that interfere with guide targeting or repair template incorporation. Multimember gene families can be edited in parallel if suitable conserved sequences exist in all family members. The C. albicans CRISPR system described is flanked by FRT sites and encodes flippase. Upon induction of flippase, the antibiotic marker (CaCas9) and guide RNA are removed from the genome. This allows the investigator to perform subsequent edits to the genome. C. albicans CRISPR is a powerful fungal genetic engineering tool, and minor alterations to the described protocols permit the modification of other fungal species including C. glabrata, N. castellii, and S. cerevisiae.

CRISPR-mediated Genome Editing of the Human Fungal Pathogen Candida albicans

Efficient genome engineering of Candida albicans is critical to understanding the pathogenesis and development of therapeutics. Here, we described a protocol to quickly and accurately edit the C. albicans genome using CRISPR. The protocol allows investigators to introduce a wide variety of genetic modifications including point mutations, insertions, and deletions.

CRISPR-mediata Editing genomico agente patogeno fungoso umano Candida albicans

This method describes the efficient CRISPR mediated genome editing of the diploid human fungal pathogen Candida albicans. CRISPR-mediated genome editing ...

Use of Single Molecule Fluorescent In Situ Hybridization (SM-FISH) to Quantify and Localize mRNAs in Murine Oocytes

Current methods routinely used to quantify mRNA in oocytes and embryos include digital reverse-transcription polymerase chain reaction (dPCR), quantitative, real-time RT-PCR (RT-qPCR) and RNA sequencing. When these techniques are performed using a single oocyte or embryo, low-copy mRNAs are not reliably detected. To overcome this problem, oocytes or embryos can be pooled together for analysis; however, this often leads to high variability amongst samples. In this protocol, we describe the use of fluorescence in situ hybridization (FISH) using branched DNA chemistry. This technique identifies the spatial pattern of mRNAs in individual cells. When the technique is coupled with Spot Finding and Tracking&#160;computer software, the abundance of mRNAs in the cell can also be quantified. Using this technique, there is reduced variability within an experimental group and fewer oocytes and embryos are required to detect significant differences between experimental groups. Commercially available branched-DNA SM-FISH kits have been optimized to detect mRNAs in sectioned tissues or adherent cells on slides. However, oocytes do not effectively adhere to slides and some reagents in the kit were too harsh resulting in oocyte lysis. To prevent this lysis, several modifications were made to the FISH kit. Specifically, oocyte permeabilization and wash&#160;buffers designed for the immunofluorescence of oocytes and embryos replaced the proprietary buffers. The permeabilization, washes, and incubations with probes and amplifier were performed in 6-well plates and oocytes were placed on slides at the end of the protocol using mounting media. These modifications were able to overcome the limitations of the commercially available kit, in particular, the oocyte lysis. To accurately and reproducibly count the number of mRNAs in individual oocytes, computer software was used. Together, this protocol represents an alternative to PCR and sequencing to compare the expression of specific transcripts in single cells.

Use of Single Molecule Fluorescent In Situ Hybridization SM-FISH to Quantify and Localize mRNAs in Murine Oocytes

To reproducibly count the numbers of mRNAs in individual oocytes, single molecule RNA fluorescence in situ hybridization (RNA-FISH) was optimized for non-adherent cells. Oocytes were collected, hybridized with the transcript specific probes, and quantified using an image quantification software.

Uso di singola molecola fluorescente ibridazione In Situ (SM-pesce) per quantificare e Localize mRNAs in ovociti murini

Current methods routinely used to quantify mRNA in oocytes and embryos include digital reverse-transcription polymerase chain reaction (dPCR), ...

Mass Spectrometry-Based Proteomics Analyses Using the OpenProt Database to Unveil Novel Proteins Translated from Non-Canonical Open Reading Frames

Genome annotation is central to today's proteomic research as it draws the outlines of the proteomic landscape. Traditional models of open reading frame (ORF) annotation impose two arbitrary criteria: a minimum length of 100 codons and a single ORF per transcript. However, a growing number of studies report expression of proteins from allegedly non-coding regions, challenging the accuracy of current genome annotations. These novel proteins were found encoded either within non-coding RNAs, 5' or 3' untranslated regions (UTRs) of mRNAs, or overlapping a known coding sequence (CDS) in an alternative ORF. OpenProt is the first database that enforces a polycistronic model for eukaryotic genomes, allowing annotation of multiple ORFs per transcript. OpenProt is freely accessible and offers custom downloads of protein sequences across 10 species. Using OpenProt database for proteomic experiments enables novel proteins discovery and highlights the polycistronic nature of eukaryotic genes. The size of OpenProt database (all predicted proteins) is substantial and need be taken in account for the analysis. However, with appropriate false discovery rate (FDR) settings or the use of a restricted OpenProt database, users will gain a more realistic view of the proteomic landscape. Overall, OpenProt is a freely available tool that will foster proteomic discoveries.

OpenProt is a freely accessible database that enforces a polycistronic model of eukaryotic genomes. Here, we present a protocol for the use of OpenProt databases when interrogating mass spectrometry datasets. Using OpenProt database for analysis of proteomic experiments allows for discovery of novel and previously undetectable proteins.

Basati sulla spettrometria di massa proteomica analisi utilizzando il Database di OpenProt a svelare nuove proteine tradotte da Non-Canonical Open Reading Frames

Genome annotation is central to today's proteomic research as it draws the outlines of the proteomic landscape. Traditional models of open reading frame ...

A Bioinformatics Pipeline to Accurately and Efficiently Analyze the MicroRNA Transcriptomes in Plants

MicroRNAs (miRNAs) are 20- to 24-nucleotide (nt) endogenous small RNAs (sRNAs) extensively existing in plants and animals that play potent roles in regulating gene expression at the post-transcriptional level. Sequencing sRNA libraries by Next Generation Sequencing (NGS) methods has been widely employed to identify and analyze miRNA transcriptomes in the last decade, resulting in a rapid increase of miRNA discovery. However, two major challenges arise in plant miRNA annotation due to increasing depth of sequenced sRNA libraries as well as the size and complexity of plant genomes. First, many other types of sRNAs, in particular, short interfering RNAs (siRNAs) from sRNA libraries, are erroneously annotated as miRNAs by many computational tools. Second, it becomes an extremely time-consuming process for analyzing miRNA transcriptomes in plant species with large and complex genomes. To overcome these challenges, we recently upgraded miRDeep-P (a popular tool for miRNA transcriptome analyses) to miRDeep-P2 (miRDP2 for short) by employing a new filtering strategy, overhauling the scoring algorithm and incorporating newly updated plant miRNA annotation criteria. We tested miRDP2 against sequenced sRNA populations in five representative plants with increasing genomic complexity, including Arabidopsis, rice, tomato, maize and wheat. The results indicate that miRDP2 processed these tasks with very high efficiency. In addition, miRDP2 outperformed other prediction tools regarding sensitivity and accuracy. Taken together, our results demonstrate miRDP2 as a fast and accurate tool for analyzing plant miRNA transcriptomes, therefore a useful tool in helping the community better annotate miRNAs in plants.

A bioinformatics pipeline, namely miRDeep-P2 (miRDP2 for short), with updated plant miRNA criteria and an overhauled algorithm, could accurately and efficiently analyze microRNA transcriptomes in plants, especially for species with complex and large genomes.

Una pipeline di bioinformatica per analizzare in modo accurato ed efficiente i trascrittomi di microRNA nelle piante

MicroRNAs (miRNAs) are 20- to 24-nucleotide (nt) endogenous small RNAs (sRNAs) extensively existing in plants and animals that play potent roles in ...

Genetic Mapping of Thermotolerance Differences Between Species of Saccharomyces Yeast via Genome-Wide Reciprocal Hemizygosity Analysis

A central goal of modern genetics is to understand how and why organisms in the wild differ in phenotype. To date, the field has advanced largely on the strength of linkage and association mapping methods, which trace the relationship between DNA sequence variants and phenotype across recombinant progeny from matings between individuals of a species. These approaches, although powerful, are not well suited to trait differences between reproductively isolated species. Here we describe a new method for genome-wide dissection of natural trait variation that can be readily applied to incompatible species. Our strategy, RH-seq, is a genome-wide implementation of the reciprocal hemizygote test. We harnessed it to identify the genes responsible for the striking high temperature growth of the yeast Saccharomyces cerevisiae relative to its sister species S. paradoxus. RH-seq utilizes transposon mutagenesis to create a pool of reciprocal hemizygotes, which are then tracked through a high-temperature competition via high-throughput sequencing. Our RH-seq workflow as laid out here provides a rigorous, unbiased way to dissect ancient, complex traits in the budding yeast clade, with the caveat that resource-intensive deep sequencing is needed to ensure genomic coverage for genetic mapping. As sequencing costs drop, this approach holds great promise for future use across eukaryotes.

Genetic Mapping of Thermotolerance Differences Between Species of Saccharomyces Yeast via Genome-Wide Reciprocal Hemizygosity Analysis

Reciprocal hemizygosity via sequencing (RH-seq) is a powerful new method to map the genetic basis of a trait difference between species. Pools of hemizygotes are generated by transposon mutagenesis and their fitness is tracked through competitive growth using high-throughout sequencing. Analysis of the resulting data pinpoints genes underlying the trait.

Mappatura genetica delle differenze di termotolleranza tra le specie di Saccamici Yeast tramite l'analisi dell'emizigosità reciproca genomica

A central goal of modern genetics is to understand how and why organisms in the wild differ in phenotype. To date, the field has advanced largely on the ...

Generation of Defined Genomic Modifications Using CRISPR-CAS9 in Human Pluripotent Stem Cells

Human pluripotent stem cells offer a powerful system to study gene function and model specific mutations relevant to disease. The generation of precise heterozygous genetic modifications is challenging due to CRISPR-CAS9 mediated indel formation in the second allele. Here, we demonstrate a protocol to help overcome this difficulty by using two repair templates in which only one expresses the desired sequence change, while both templates contain silent mutations to prevent re-cutting and indel formation. This methodology is most advantageous for gene editing coding regions of DNA to generate isogenic control and mutant human stem cell lines for studying human disease and biology. In addition, optimization of transfection and screening methodologies have been performed to reduce labor and cost of a gene editing experiment. Overall, this protocol is widely applicable to many genome editing projects utilizing the human pluripotent stem cell model.

This protocol provides a method to facilitate the generation of defined heterozygous or homozygous nucleotide changes using CRISPR-CAS9 in human pluripotent stem cells.

Generazione di modifiche genomiche definite utilizzando CRISPR-CAS9 nelle cellule staminali pluripotenti umane

Human pluripotent stem cells offer a powerful system to study gene function and model specific mutations relevant to disease. The generation of precise ...

Dissection of Drosophila melanogaster Flight Muscles for Omics Approaches

Drosophila flight muscle is a powerful model to study diverse processes such as transcriptional regulation, alternative splicing, metabolism, and mechanobiology, which all influence muscle development and myofibrillogenesis. Omics data, such as those generated by mass spectrometry or deep sequencing, can provide important mechanistic insights into these biological processes. For such approaches, it is beneficial to analyze tissue-specific samples to increase both selectivity and specificity of the omics fingerprints. Here we present a protocol for dissection of fluorescent-labeled flight muscle from live pupae to generate highly enriched muscle samples for omics applications. We first describe how to dissect flight muscles at early pupal stages (&#60;48 h after puparium formation [APF]), when the muscles are discernable by green fluorescent protein (GFP) labeling. We then describe how to dissect muscles from late pupae (&#62;48 h APF) or adults, when muscles are distinguishable under a dissecting microscope. The accompanying video protocol will make these technically demanding dissections more widely accessible to the muscle and Drosophila research communities. For RNA applications, we assay the quantity and quality of RNA that can be isolated at different time points and with different approaches. We further show that Bruno1 (Bru1) is necessary for a temporal shift in myosin heavy chain (Mhc) splicing, demonstrating that dissected muscles can be used for mRNA-Seq, mass spectrometry, and reverse transcription polymerase chain reaction (RT-PCR) applications. This dissection protocol will help promote tissue-specific omics analyses and can be generally applied to study multiple biological aspects of myogenesis.

Dissection of Drosophila melanogaster Flight Muscles for Omics Approaches

Drosophila flight muscle is a powerful model to study transcriptional regulation, alternative splicing, metabolism, and mechanobiology. We present a protocol for dissection of fluorescent-labeled flight muscle from live pupae to generate highly enriched samples ideal for proteomics and deep-sequencing. These samples can offer important mechanistic insights into diverse aspects of muscle development.

Dissezione dei muscoli di volo di Drosophila melanogaster per gli approcci Omics

Drosophila flight muscle is a powerful model to study diverse processes such as transcriptional regulation, alternative splicing, metabolism, and ...

Application of CRISPR Interference (CRISPRi) for Gene Silencing in Pathogenic Species of Leptospira

Leptospirosis is a global neglected zoonosis, responsible for at least 1 million cases per year and almost 60 thousand deaths. The disease is caused by pathogenic and virulent bacteria of the genus Leptospira, either by direct contact with the bacteria or indirectly by exposure to contaminated water or soil. Domestic and wild animals act as reservoir hosts of infection, shedding leptospires from colonized renal tubules of the kidney, via urine, into the environment. The generation of mutant strains of Leptospira is critical to evaluate and understand pathogenic mechanisms of infection. CRISPR interference (CRISPRi) has proven to be a straightforward, affordable, and specific tool for gene silencing in pathogenic Leptospira. Therefore, the methodological details of obtaining the plasmid constructs containing both dCas9 and guide RNA, delivery of plasmids to Leptospira by conjugation with the E. coli strain &#946;2163, and transconjugant recovery and evaluation, will be described. In addition, the recently described Hornsby-Alt-Nally (HAN) media allows for the relatively rapid isolation and selection of mutant colonies on agar plates.

Application of CRISPR Interference CRISPRi for Gene Silencing in Pathogenic Species of Leptospira

Here, the application of CRISPR interference (CRISPRi) for specific gene silencing in Leptospira species is described. Leptospira cells are transformed by conjugation with plasmids expressing dCas9 (catalytically "dead" Cas9) and a single-guide RNA (sgRNA), responsible for base pairing to the desired genomic target. Methods to validate gene silencing are presented.

Applicazione dell'interferenza CRISPR (CRISPRi) per il silenziamento genico nelle specie patogene di Leptospira

Leptospirosis is a global neglected zoonosis, responsible for at least 1 million cases per year and almost 60 thousand deaths. The disease is caused by ...

Generazione di fusioni proteina fluorescente in

Riepilogo

Esplora Altri Video

Capitoli in questo video