Name: generation of fluorescent protein fusions in candida species
Uploaded: 2017-03-04T15:00:00.000+00:00
Duration: 9 min 27 s
Description: Watch this Scientific Journal Video about Generation of Fluorescent Protein Fusions in Candida Species at JoVE.com

Ringraziamo N. Dean per fornire la sequenza originale mCherry FP, M. Gerami-Nejad per la costruzione di plasmidi, B. Larson per l&#39;assistenza tecnica, e T. Heisel per consigli utili durante lo sviluppo di questo progetto. JB è stato sostenuto dal premio Consiglio europeo della ricerca avanzata 340.087 (RAPLODAPT). sistemi di microscopia e di imaging sono stati forniti dalla University of Minnesota Pediatria Foundation e l&#39;Università del Minnesota Imaging Center.

1. Isolare Template plasmidi da E. coli <ol><li> Grow E. coli contenenti il plasmide modello durante la notte in 10 ml di brodo lisogenia (LB) + 200 mg / L ampicillina (AMP) a 37 ° C con agitazione. </li><li> Celle di raccolta per centrifugazione a 6.000 xg per 2 min. </li><li> Decantare liquido, isolare e purificare il DNA da E. coli cellule con un metodo standard, come descritto in precedenza in Ausubel et al. 8. </li><li> Risospendere DNA in Tris-EDTA (TE; 10 mM Tris, pH 8,0, 1 mM EDTA, pH 8,0) ad una concentrazione di lavoro di 50-100 ng / ml. </li></ol> 2. Primer design <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td fo:width="0.5in" style="width:50px"> Primer </td><td> Sequenza Primer </td></tr><tr><td> F1 </td><td> 5 &#39; <strong&gt; GAGAATTGAAGAAGAGTTGGGAGACAATGCTATCTATGCTGGTAAGGACTTCCACAATGCTCAAACTTTG GGTGGTTCTAAAGGTGAAGAATTATT 3 &#39; </td></tr><tr><td> R1 </td><td> 5 &#39;GAGCGTTTGCACCAACAGGCCATCATTTGTGACGAGAGAAGACCTGACGTCATTAGATTGGCACCTTTGC GTAAAACGACGGCCAGTGAATTC 3 &#39; </td></tr><tr><td> F2 </td><td> 5 &#39;GAGAATTGAAGAAGAGTTGGGAGACAATGCTATCTATGCTGGTAAGGACTTCCACAATGCTCAAACTTTG GGTGGTGTTTCAAAAGGTGAAGAAGATAAT 3 &#39; </td></tr><tr><td> R2 </td><td> 5 &#39;GAGCGTTTGCACCAACAGGCCATCATTTGTGACGAGAGAAGACCTGACGTCATTAGATTGGCACCTTTGC ACTGGATGGCGGCGTTAGTATC 3 &#39; </td></tr></tbody></table> Tabella 1: sequenze di primer utilizzati in questo studio. Testo in corsivo grassetto indica omologia al ENO1 locus genomico, normali le regioni di font sono omologhi di DNA plasmidico. <ol> &lt;li&gt; primer design per essere omologo al plasmide sequenze confinanti la cassetta da amplificare nonché alla estremità 3 &#39;del gene bersaglio di interesse (ad es ENO1) agevolare ricombinazione nel locus genomico del gene (Figura 2 e Tabella 1) . <ol><li> Assicurarsi che le sequenze dei primer forward corrispondono ultimi 70 coppie di basi (bp) del gene di interesse, 5&#39;-3 &#39;, meno il codone di stop, per mantenere il telaio codifica, più la prima di circa 30 bp della sequenza plasmide siano amplificato. Come una nota, il GGTGGTGGTT in ogni primer è un linker poli-glicina senza FP omologia. Da segnalare, in assenza di un linker, non ci può essere la fusione diretta dei domini funzionali, che possono teoricamente portare a misfolding, bassa resa nella produzione di proteine, o bioattività compromessa. </li><li> Assicurarsi che le sequenze primer reverse sono 70 bp solo a valle del gene, 3&#39;5 &#39;, ad esclusione di qualsiasi sequenza genica, più l&#39;ultima approximately 30 bp del marcatore nutrizionale o resistenza ai farmaci utilizzati nel plasmide. </li><li> Usare F1 e R1 per generare GFP NAT1 e YFP- NAT1 cassette con rispettivamente pMG2120 e pMG2263, e F2 e R2 per generare mCherry- NAT1 con pMG2343. </li></ol></li></ol> 3. Generare FP cassette mediante PCR (1 ° giorno) <ol><li> Preparare i reagenti per la PCR. Fare un master mix (500 volume finale mL) aggiungendo i seguenti volumi e concentrazioni in una provetta da 1,5 ml: 50 microlitri di buffer PCR (500 mm cloruro di potassio, 100 mM Tris pH 8,0 in acqua), deoxynucleotides 20 microlitri (dNTP; magazzino miscela di nucleotidi a 10 mm ciascuno), 40 ml di 25 mM cloruro di magnesio, 20 l purificati plasmide (da ~ 50-100 ng / ml di soluzione), 10 ml ciascuno in avanti e di primer (da 10 soluzioni madre mM inversa), 30 ml di Taq polimerasi (generica, 5.000 unità / ml), e 320 ml di acqua. <ol><li> Aliquota 50 ml di master mix in ciascuno dei 10 PCR-compatibLe 0,5 ml tubi. </li></ol></li><li> Mettere provette PCR in termociclatore ed eseguire le seguenti operazioni: 1 ciclo di 5 min a 94 ° C per denaturare dsDNA; 40 cicli in sequenza di 45 secondi a 94 ° C, 30 sec a 55 ° C per consentire primers per temprare di plasmide DNA stampo, e 4 minuti a 68 ° C per l&#39;estensione dei prodotti DNA; e 1 ciclo estensione finale di 15 min a 72 ° C. possono avere bisogno di essere modificato in base alla particolare Taq polimerasi utilizzata master mix PCR e in bicicletta parametri: NOTA. </li><li> Pool tutti i prodotti provenienti dai 10 reazioni PCR in una provetta da 1,5 ml. <ol><li> Oggetto 5 ml di prodotto di PCR in pool a elettroforesi su gel di agarosio per verificare dimensioni amplicone ed ottenere una stima della concentrazione del prodotto, basata sul confronto di una scaletta DNA. In generale, usare ~ 250 mg di DNA cassette in ogni successiva mix di trasformazione. </li><li> Precipitare DNA aggiungendo acetato di 50 microlitri 3 M di sodio seguito da 750 microlitri 95% etanolo per i prodotti e incubare almeno 30 mina -20 ° C. </li><li> Raccogliere i prodotti PCR mediante centrifugazione del tubo a 16.000 xg per 10 min. Rimuovere con cautela e scartare il surnatante e asciugare il pellet durante la notte. Risospendere il DNA cassette pellet essiccati in 40 microlitri TE pH 8,0 e conservare a temperatura ambiente fino al momento dell&#39;uso. </li></ol></li></ol> 4. Trasformare cellule di Candida con FP DNA Cassette <ol><li> Il giorno 1, recuperare ceppo di lievito da trasformare da un glicerolo 15% congelati (-80 ° C) stock strisciando alcuni cristalli raschiati Onto lievito peptone destrosio con adenina (YPAD) agar e incubare a 30 ° C. Dopo il recupero della crescita delle colonie, inoculare una singola colonia in 2 ml di mezzo YPAD liquido in una provetta di vetro con tappo traspirante e incubare una notte a 30 ° C con agitazione. </li><li> Il giorno 2, diluire 300 ml di coltura di lievito durante la notte in 50 ml YPAD fresco (ad un OD finale 600 ~ 0.2) in un 125 ml beuta con un tappo traspirante. Agitare a 30 ° Cper ~ 3 ore (per un diametro finale 600 ~ 0,6-0,8). <ol><li> Versare il cultura durante la notte in una provetta conica da 50 ml e agglomerare le cellule mediante centrifugazione per 5 min a 1 500 xg in una centrifuga da tavolo. </li><li> Eliminare e scartare correttamente il surnatante. Risospendere il pellet di cellule in acqua 5 ml. Re-agglomerare le cellule per centrifugazione ancora per 5 min a 1500 xg in una centrifuga da tavolo. </li><li> Eliminare e scartare correttamente il surnatante. Risospendere le cellule in 500 microlitri TELiAc (TE litio acetato: 10 mM Tris, pH 8,0, 1 mM EDTA, pH 8,0, 0,1 M di litio acetato) durante il trasferimento in una provetta da 1,5 ml. Centrifugare la provetta per 2 minuti a 3000 xg in una microcentrifuga. </li><li> Risospendere le cellule in 250 microlitri TELiAc. Il volume totale compreso il pellet dovrebbe essere ~ 300 microlitri. </li></ol></li><li> Per un (provetta da microcentrifuga diverso in 4.2.4) pulito, aggiungere 5 microlitri vettore DNA (10 mg / ml) e 150 ml di cellule di Candida preparati (da 4.2.4). Questo è il controllo negativo per donnaransformation. <ol><li> Per un secondo tubo da microcentrifuga pulita, aggiungere 5 ml di DNA denaturato (carrier che è stata bollita a 90 ° C per 10 min e raffreddato a 4 ° C), tutti i 40 microlitri del prodotto PCR preparato (da 3.3.1) e 150 pl di cellule di Candida preparati (da 4.2.4). </li><li> Incubare le due miscele di trasformazione per 30 min a temperatura ambiente. </li><li> Per ogni tubo mix trasformazione, aggiungere 700 microlitri della miscela PLATE (10 mM Tris, pH 8,0, 1 mM EDTA, pH 8,0, 0,1 M di litio acetato in 50% di polietilene glicole 3350). Capovolgere i tubi per miscelare e incubare una notte a temperatura ambiente. </li></ol></li><li> Il giorno 3, incubare la trasformazione si mescola a 42 ° C per 1 ora (shock termico). <ol><li> Centrifugare la trasformazione miscele per 30 secondi a 16.000 xg in una microcentrifuga. Rimuovere e gettare correttamente il surnatante. Risospendere ciascuno dei pellet cellulari in 150 microlitri di acqua delicatamente pipettando su e giù in modo da non danneggiare le cellule. </li><li> Per le trasformazioni utilizing geni marcatori auxotrofi (ad esempio URA3), piastra ogni intera miscela pipettando le soluzioni sul appropriata agar terreni selettivi (ad es uridina manca) e diffondere la miscela in modo uniforme utilizzando microsfere di vetro sterili. </li><li> Per trasformazioni utilizzando il gene marcatore di resistenza nourseothricin (NAT1), come descritto qui, piastra di trasformazione mescola prima sul agar YPAD non selettiva e incubare a 30 ° C per 6-12 ore. Questo passo aiuti nel recupero delle cellule, shock post di calore, prima nourseothricin lo stress è applicato. </li><li> Dopo il recupero della crescita parziale, piastra replica le cellule Candida Onto YPAD contenente 400 mg / ml nourseothricin. Per le trasformazioni che utilizzano geni marcatori nutrizionali (per esempio URA3), questa fase intermedia la placcatura non è necessario e le cellule può essere placcato direttamente su supporti di lievito selettivi (ad esempio YPAD manca uridina), come descritto in 4.4.2. NOTA: Se la trasformazione è successo, colOnies dovrebbe apparire da uno a tre giorni (potenzialmente fino a cinque giorni di conseguenza per la selezione su agar nourseothricin contenente). Non ci sono colonie dovrebbero apparire su piastre diffuse con miscele di trasformazione che contengono DNA vettore da solo (controllo negativo). </li></ol></li><li> Per la selezione marcatore auxotrophic e nourseothricin, striscia trasformanti putativi come singole colonie per piastre di agar terreni selettivi freschi e incubare a 30 ° C per propagare cellule di lievito che possono essere sottoposti a screening per la costruzione di successo di fusioni FP. </li><li> Trasformanti dello schermo per la corretta integrazione della cassetta di tagging (vedi Rappresentante dei risultati per un esempio dettagliato). Se il gene di interesse viene espresso in quantità sufficiente, tutta la colonia fluorescenza può verificare tale che è possibile rilevare potenziali candidati integrants utilizzando un sistema di imaging piastra con capacità di rilevamento di fluorescenza. <ol><li> Controllare integrants putativi mediante PCR utilizzando primer omologa a sequenze outside della regione di integrazione per confermare fusione al gene bersaglio. </li><li> Inoltre, in considerazione analisi Western blot per determinare l&#39;espressione e dimensioni della proteina di fusione, come anche per microscopia a fluorescenza di singole cellule per la conferma visiva della localizzazione delle proteine, se noto. </li></ol></li></ol>

<ol>
	<li>Bendel, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colonization+and+epithelial+adhesion+in+the+pathogenesis+of+neonatal+candidiasis.">Colonization and epithelial adhesion in the pathogenesis of neonatal candidiasis.</a> Semin. Perinatol. 27 (5), 357-364 (2003).</li><li>Gerami-Nejad, M., Berman, J., Gale, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cassettes+for+PCR-mediated+construction+of+green,+yellow,+and+cyan+fluorescent+protein+fusions+in+Candida+albicans.">Cassettes for PCR-mediated construction of green, yellow, and cyan fluorescent protein fusions in Candida albicans.</a> Yeast. 18 (9), 859-864 (2001).</li><li>Gerami-Nejad, M., Dulmage, K., Berman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Additional+cassettes+for+epitope+and+fluorescent+fusion+proteins+in+Candida+albicans.">Additional cassettes for epitope and fluorescent fusion proteins in Candida albicans.</a> Yeast. 26 (7), 399-406 (2009).</li><li>Gerami-Nejad, M., Forche, A., McClellan, M., Berman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+protein+function+in+clinical+C.+albicans+isolates.">Analysis of protein function in clinical C. albicans isolates.</a> Yeast. 29 (8), 303-309 (2012).</li><li>Gerami-Nejad, M., Hausauer, D., McClellan, M., Berman, J., Gale, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cassettes+for+the+PCR-mediated+construction+of+regulatable+alleles+in+Candida+albicans.">Cassettes for the PCR-mediated construction of regulatable alleles in Candida albicans.</a> Yeast. 21 (5), 429-436 (2004).</li><li>Gonia, S., Larson, B., Gale, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR-mediated+gene+modification+strategy+for+construction+of+fluorescent+protein+fusions+in+Candida+parapsilosis.">PCR-mediated gene modification strategy for construction of fluorescent protein fusions in Candida parapsilosis.</a> Yeast. 33 (2), 63-69 (2016).</li><li>Milne, S. W., Cheetham, J., Lloyd, D., Aves, S., Bates, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cassettes+for+PCR-+mediated+gene+tagging+in+Candida+albicans+utilizing+nourseothricin+resistance.">Cassettes for PCR- mediated gene tagging in Candida albicans utilizing nourseothricin resistance.</a> Yeast. 28 (12), 833-841 (2011).</li><li>Ausubel, F. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Current Protocols in Molecular Biology. , (1995).</li><li>Wilson, R. B., Davis, D., Mitchell, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+hypothesis+testing+with+Candida+albicans+through+gene+disruption+with+short+homology+regions.">Rapid hypothesis testing with Candida albicans through gene disruption with short homology regions.</a> J. Bacteriol. 181 (6), 1868-1874 (1999).</li><li>Pulver, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rsr1+focuses+Cdc42+activity+at+hyphal+tips+and+promotes+maintenance+of+hyphal+development+in+Candida+albicans.">Rsr1 focuses Cdc42 activity at hyphal tips and promotes maintenance of hyphal development in Candida albicans.</a> Eukaryotic Cell. 12 (4), 482-495 (2013).</li><li>Falgier, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Candida+species+differ+in+their+interactions+with+immature+human+gastrointestinal+epithelial+cells.">Candida species differ in their interactions with immature human gastrointestinal epithelial cells.</a> Pediatr. Res. 69 (5), 384-389 (2011).</li><li>Nosek, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+manipulation+of+the+pathogenic+yeast+Candida+parapsilosis.">Genetic manipulation of the pathogenic yeast Candida parapsilosis.</a> Curr. Genet. 42 (1), 27-35 (2002).</li><li>Zemanova, J., Nosek, J., Tomaska, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-efficiency+transformation+of+the+pathogenic+yeast+Candida+parapsilosis.">High-efficiency transformation of the pathogenic yeast Candida parapsilosis.</a> Curr. Genet. 45 (3), 183-186 (2004).</li><li>Benjamin, D. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neonatal+candidiasis+among+extremely+low+birth+weight+infants:+risk+factors,+mortality+rates,+and+neurodevelopmental+outcomes+at+18+to+22+months.">Neonatal candidiasis among extremely low birth weight infants: risk factors, mortality rates, and neurodevelopmental outcomes at 18 to 22 months.</a> Pediatrics. 117 (1), 84-92 (2006).</li><li>Kullberg, B. J., Arendrup, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Invasive+Candidiasis.">Invasive Candidiasis.</a> N Engl J Med. 373 (15), 1445-1456 (2015).</li></ol>

Gli autori non hanno nulla da rivelare.

Costruzione di epitopo etichettato sequenze in specie Candida utilizzando la strategia di modificazione genetica PCR-mediata sopra descritto possono essere riassunti come un processo in tre fasi. Innanzitutto, una cassetta è fatta da PCR che codifica sia la sequenza desiderata di integrazione e regioni omologa al locus di inserimento nel genoma di lievito. In secondo luogo, le cellule di lievito da trasformare sono chimicamente competenti con acetato di litio e co-incubate con la cassetta. Terzo, le cellule ve...

Specie di Candida sono funghi commensali che colonizzano i tratti intestinali e genito-urinario di tutti gli esseri umani. In condizioni di immunodeficienza, come ad esempio che si verificano con parto prematuro o effetti immunosoppressivi di trattamenti per il cancro, specie Candida possono diventare patogeni opportunisti. Tra le specie di Candida, Candida albicans è il colonizzatore fungina più diffusa e provoca la maggior parte delle infezioni fungine invasive. Altre specie di Candida come C. glabrata, C. parapsilosis, C. tropicalis e C. kruseii anche causare gravi infezioni nei pazienti immunocompromessi, con qualche esibendo resistenza intrinseca alla usati comunemente antibiotici anti-fungine quali fluconazolo e amfotericina B. Quindi, infezioni con alcune di queste specie sono osservati più frequentemente, soprattutto nei pazienti in trattamento profilattico con farmaci anti-fungini. Anche con una appropriata e tempestivatrattamento NTI-fungine, infezioni da Candida invasive continuano ad essere associata a morbidità e mortalità 1 significativa. A causa del significato di specie Candida nella salute umana, vi è l&#39;esigenza di strumenti molecolari prontamente disponibili che permettono lo studio e la spiegazione dei loro meccanismi patogeni. Uno strumento importante che permette ai ricercatori di visualizzare e quantificare le cellule microbiche e le proteine ​​che essi esprimono è tecnologia della fusione FP. Reazione a catena della polimerasi (PCR) mediata modificazione genetica, come descritto in questo documento, permette la costruzione di fusioni, tra le sequenze FP ed una proteina Candida sequenza codificante di interesse al suo locus genomico. Integrazione stabile del costrutto facilita l&#39;analisi dell&#39;espressione della proteina e dinamiche localizzazione della proteina. I plasmidi contenenti sequenze FP, ottimizzati per l&#39;espressione in Candida albicans e che possono essere utilizzati nella g PCR-mediatastrategia modifica ene, è stato costruito in precedenza 2, 3, 4, 5. I plasmidi contengono FP trasformazione &quot;cassette&quot;: una sequenza FP legato ad un gene marcatore nutrizionale che facilita la trasformazione di C. albicans e C. parapsilosis 2, 3, 4, 5, 6, 7. Attualmente plasmidi disponibili contengono una varietà di geni marcatori selezionabili nutrizionali (URA3, HIS1, Arg4) per la trasformazione di ceppi auxotrofi così come marcatore resistenza ai farmaci dominante (NAT1), che facilita la trasformazione di ceppi clinici privi auxotrophies. Inoltre, plasmidi contengono opzioni per un massimo di quattro differenti sequenze FP (verde [GFP], Yellow [YFP], ciano [CFP], e la ciliegia [mCherry]) e sia una sequenza di terminazione ADH1 per la costruzione di fusioni di proteine carbossi-terminale, o di una sequenza promotrice per la costruzione di fusioni di proteine amino-terminale. Primer sono progettati con omologia al DNA plasmidico che circonda la cassetta FP. Inoltre, i primer contengono anche sequenze 5&#39;-estensione recanti omologia con il gene di lievito di interesse per essere etichettato, che facilita l&#39;integrazione della cassetta nel locus genomico tramite ricombinazione omologa (Figura 1). Gene-specifici cassette FP sono generati mediante PCR e poi trasformati in cellule di Candida rese competenti per l&#39;assorbimento di DNA mediante trattamento con acetato di litio. <img alt="Figura 1" src="/files/ftp_upload/55333/55333fig1.jpg" /> Figura 1: Diagramma di come FP fusioni sequenza sono generati in specie di Candida. (A) inclusa, plasmidi DNAes una sequenza FP e una codifica sequenza nourseothricin resistenza (NAT1). posizioni relative di Forward (FWD) e reverse primer (REV) sono mostrati, con porzioni nere dei primer che indica la regione di omologia alla sequenza plasmidi e le porzioni viola denotano la regione di omologia gene-specifica o estensione di primer. Cassette (B) FP si trasformano in Candida e si integrano all&#39;interno del ENO1 locus genomico mediante ricombinazione omologa (linee tratteggiate). (C) risultante FP sequenza di fusione presso il 3&#39;end di ENO1. <a href="http://ecsource.jove.com/files/ftp_upload/55333/55333fig1large.jpg" target="_blank">Clicca qui per vedere una versione più grande di questa figura.</a> Qui, vi presentiamo un esempio di fusione di proteine (Eno1-FP) costruzioni in specie di Candida. Usiamo codifica plasmidi contenenti il gene marcatore NAT1 trasformazione insieme a sequenze codificanti GFP, YFP, omCherry (Figura 2). Questi plasmidi sono utilizzati insieme con primer in PCR per generare cassette gene-specifici che facilitano fusione PQ alla estremità 3 &#39;del ENO1, con conseguente espressione di Eno1 fusa PQ al suo carbossi-terminale. <img alt="figura 2" src="/files/ftp_upload/55333/55333fig2.jpg" /> Figura 2: Mappe di FP plasmidi cassette contenenti. Forward (F) e reverse primer (R) utilizzati per generare le cassette dei plasmidi sono indicati nonché la posizione relativa della loro omologia con i plasmidi. Sequenze primer sono elencati nella tabella 1. F1 e R1 sono stati utilizzati anche per generare la cassetta pYFP- NAT1. Il plasmide contenente la cassetta YFP- NAT1 (pMG2263) è identica a pMG2120 con l&#39;eccezione di YFP al posto della sequenza GFP. Dimensioni cassette: GFP-NAT1, 3.7 KBP; mCherry- NAT1, 3,2 kbp; YFP- NAT1, 3.7 kbp. Questo dato è stato modificato da Gerami-Nejad, et al. 4 <a href="http://ecsource.jove.com/files/ftp_upload/55333/55333fig2large.jpg" target="_blank">Clicca qui per vedere una versione più grande di questa figura.</a>

<table><tbody><tr><td>100 W mercury lamp</td><td>CHIU Technical Corporation</td><td>M-100T</td><td></td></tr><tr><td>95% Ethanol</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Adenine</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Ampicillin</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Carrier DNA</td><td>Ambion</td><td>AM9680</td><td>Sheared Salmon Sperm DNA 10 mg/ml</td></tr><tr><td>CCD Camera</td><td>Photometrics</td><td>CoolSNAP HQ</td><td></td></tr><tr><td>Conical Tube</td><td>Corning</td><td>430828</td><td>50 ml</td></tr><tr><td>Culture Tube Rotator</td><td>New Brunswick</td><td>2013923</td><td>TC-8, or Any Culture Tube Rotator</td></tr><tr><td>Deoxynucleotides (dNTP) PCR Grade</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Eppendorf Tubes</td><td>Eppendorf</td><td>022363719, 022363212</td><td>0.5 ml, 1.5 ml</td></tr><tr><td>Erlenmeyer Flask</td><td>Fisher Scientific</td><td>7250089</td><td>125 ml</td></tr><tr><td>Ethylenediaminetetraacetic Acid (EDTA)</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Freezer (-80 &amp;deg;C)</td><td>Thermo Electron Corporation</td><td>ULT-1386-9-V</td><td>Revco Ultima II</td></tr><tr><td>GFP, YFP and Texas Red Filter Sets</td><td>Chroma Technology Corporation</td><td>49002, 86004v2, 49008</td><td></td></tr><tr><td>Glass culture tubes</td><td>Fisher Scientific</td><td>1496126</td><td>75 mm</td></tr><tr><td>HRP goat anti-mouse antibody</td><td>Santa Cruz Biotechnology</td><td>SC-2005</td><td></td></tr><tr><td>HRP goat anti-rabbit antibody</td><td>Santa Cruz Biotechnology</td><td>SC-2301</td><td></td></tr><tr><td>Incubator (30 &amp;deg;C)</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Lithium Acetate</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Lysogeny Broth (LB) Media</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Magnesium Chloride</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Microcentrifuge</td><td>Eppendorf</td><td>5415 D</td><td></td></tr><tr><td>Microscope</td><td>Nikon</td><td>E600</td><td>Nikon Eclipse E600</td></tr><tr><td>Microscope Image Analysis Software</td><td>Universal Imaging Corporation</td><td>6.3r7</td><td>MetaMorph Software Series 6.3r7</td></tr><tr><td>Mouse anti-GFP antibody</td><td>Roche</td><td>11814460001</td><td></td></tr><tr><td>Nourseothricin</td><td>Fisher Scientific</td><td>50997939</td><td></td></tr><tr><td>PCR Thermocycler</td><td>Applied Biosystems</td><td>9700</td><td>GeneAmp PCR System</td></tr><tr><td>PCR tubes</td><td>BioExpress, GeneMate</td><td>T-3035-1</td><td>0.2 ml</td></tr><tr><td>Polyethylene Glycol 3350</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Potassium Chloride</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Rabbit anti-mCherry antibody</td><td>BioVision</td><td>5993-100</td><td></td></tr><tr><td>Refrigerator (4 &amp;deg;C)</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Sodium Acetate</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Stereomicroscope</td><td>Nikon</td><td>SMZ1500</td><td></td></tr><tr><td>Table Top Centrifuge</td><td>Labnet</td><td>Z 400</td><td>Hermle Z 400</td></tr><tr><td>&lt;em&gt;Taq&lt;/em&gt; DNA Polymerase</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Tris(hydroxymethyl)aminomethane (Tris)</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Vortex Mixer</td><td>Scientific Industries</td><td>SI-0236</td><td>Vortex Genie 2</td></tr><tr><td>Yeast Extract Peptone Dextrose (YPD) Media</td><td>Any</td><td>NA</td><td></td></tr></tbody></table>

generation of fluorescent protein fusions in candida species

Specie di Candida, colonizzatori prevalente dei tratti intestinali e genito-urinario, sono la causa della maggior parte delle infezioni fungine invasive sugli esseri umani. Pertanto, sono necessari strumenti molecolari e genetici per facilitare lo studio dei loro meccanismi patogeni. PCR-mediata modificazione genetica è un metodo semplice e rapido per generare proteine ​​epitopi-tag per facilitare la loro individuazione. In particolare, la proteina fluorescente (FP) fusioni sono potenti strumenti che consentono la visualizzazione e la quantificazione di entrambe le cellule di lievito e proteine ​​da microscopia a fluorescenza e immunoblotting, rispettivamente. I plasmidi contenenti FP sequenze di codifica, insieme con geni marcatori nutrizionali che facilitano la trasformazione delle specie Candida, sono stati generati al fine di costruzione FP ed espressione in Candida. Qui, vi presentiamo una strategia per la costruzione di una fusione FP in una specie di Candida. I plasmidi contenenti il ​​impermeabi nourseothricinnce gene marcatore di trasformazione (NAT1) insieme a sequenze per uno verde, giallo, o ciliegio PQ (GFP, YFP, mCherry) sono utilizzati insieme con gli iniettori che comprendono sequenze gene-specifici in una reazione a catena della polimerasi (PCR) per generare una cassetta FP . Questa cassetta-specific gene ha la capacità di integrarsi nel 3&#39;-end del corrispondente locus genico mediante ricombinazione omologa. Successful fusione in-frame della sequenza FP nel locus gene di interesse viene verificato geneticamente, seguita da analisi dell&#39;espressione della proteina di fusione mediante microscopia e / o metodi immuno-rilevazione. Inoltre, nel caso di proteine ​​altamente espressi, fusioni successo possono essere esaminati per principalmente da tecniche di imaging di fluorescenza.

A titolo di esempio, abbiamo usato il protocollo sopra descritto per la costruzione di GFP e mCherry fusioni di Eno1 in un ceppo di laboratorio C. parapsilosis. Ogni transformant putativo è stato inizialmente restreaked per la crescita. In questo esempio, dal momento che la proteina di fusione risultante è altamente espresso (enolasi) e le PQ sono luminose, siamo stati in grado di schermare trasformanti di microscopia a fluorescenza prima di eseguire una diagnosi mediante PCR ...

Watch this Scientific Journal Video about Generation of Fluorescent Protein Fusions in Candida Species at JoVE.com

Generation of Fluorescent Protein Fusions in Candida Species

Modificazione genetica PCR-mediata può essere utilizzato per generare fusioni di proteine fluorescenti a Candida specie, che facilita la visualizzazione e la quantificazione delle cellule di lievito e proteine. Qui, vi presentiamo una strategia per la costruzione di una fusione proteina fluorescente (Eno1-FP) in Candida parapsilosis.

Generazione di fusioni proteina fluorescente in<em&gt; Candida</em&gt; Specie

Candida species, prevalent colonizers of the intestinal and genitourinary tracts, are the cause of the majority of invasive fungal infections in humans. ...

generation-of-fluorescent-protein-fusions-in-candida-species

Research

JoVE Journal

Genetics

Generation of Fluorescent Protein Fusions in Candida Species

10.6K Views.  University of Minnesota.  Modificazione genetica PCR-mediata può essere utilizzato per generare fusioni di proteine fluorescenti a Candida specie, che facilita la visualizzazione e la quantificazione delle cellule di lievito e proteine. Qui, vi presentiamo una strategia per la costruzione di una fusione proteina fluorescente (Eno1-FP) in Candida parapsilosis. 

Video: Generation of Fluorescent Protein Fusions in Candida Species

The C. elegans Excretory Canal as a Model for Intracellular Lumen Morphogenesis and In Vivo Polarized Membrane Biogenesis in a Single Cell: labeling by GFP-fusions, RNAi Interaction Screen and Imaging

The four C. elegans excretory canals are narrow tubes extended through the length of the animal from a single cell, with almost equally far extended intracellular endotubes that build and stabilize the lumen with a membrane and submembraneous cytoskeleton of apical character. The excretory cell expands its length approximately 2,000 times to generate these canals, making this model unique for the in vivo assessment of de novo polarized membrane biogenesis, intracellular lumen morphogenesis and unicellular tubulogenesis. The protocol presented here shows how to combine standard labeling, gain- and loss-of-function genetic or RNA interference (RNAi)-, and microscopic approaches to use this model to visually dissect and functionally analyze these processes on a molecular level. As an example of a labeling approach, the protocol outlines the generation of transgenic animals with fluorescent fusion proteins for live analysis of tubulogenesis. As an example of a genetic approach, it highlights key points of a visual RNAi-based interaction screen designed to modify a gain-of-function cystic canal phenotype. The specific methods described are how to: label and visualize the canals by expressing fluorescent proteins; construct a targeted RNAi library and strategize RNAi screening for the molecular analysis of canal morphogenesis; visually assess modifications of canal phenotypes; score them by dissecting fluorescence microscopy; characterize subcellular canal components at higher resolution by confocal microscopy; and quantify visual parameters. The approach is useful for the investigator who is interested in taking advantage of the C. elegans excretory canal for identifying and characterizing genes involved in the phylogenetically conserved processes of intracellular lumen and unicellular tube morphogenesis.

The C. elegans Excretory Canal as a Model for Intracellular Lumen Morphogenesis and In Vivo Polarized Membrane Biogenesis in a Single Cell: labeling by GFP-fusions, RNAi Interaction Screen and Imaging

The C. elegans excretory canal is a unique single-cell model for the visual in vivo analysis of de novo polarized membrane biogenesis. This protocol describes a combination of standard genetic/RNAi and imaging approaches, adaptable for the identification and characterization of molecules directing unicellular tubulogenesis, and apical membrane and lumen biogenesis.

Il canale di Excretory c. elegans come un modello per intracellulare Lumen morfogenesi e biogenesi di membrana polarizzata In Vivo in una singola cella: etichettatura di GFP-fusioni, schermata di interazione di RNAi e Imaging

The four C. elegans excretory canals are narrow tubes extended through the length of the animal from a single cell, with almost equally far extended ...

Ricerca

Biologia dello sviluppo

Biolistic Transformation of a Fluorescent Tagged Gene into the Opportunistic Fungal Pathogen Cryptococcus neoformans

The basidiomycete Cryptococcus neoformans, an invasive opportunistic pathogen of the central nervous system, is the most frequent cause of fungal meningitis worldwide resulting in more than 625,000 deaths per year worldwide.&#160;Although electroporation has been developed for the transformation of plasmids in Cryptococcus, only&#160;biolistic&#160;delivery provides&#160;an effective means to transform&#160;linear&#160;DNA&#160;that can be integrated into the genome by homologous recombination.&#160;
Acetate has been shown to be a major fermentation product during cryptococcal infection, but the significance of this is not yet known.&#160;A bacterial pathway composed of the enzymes xylulose-5-phosphate/fructose-6-phosphate phosphoketolase (Xfp) and acetate kinase (Ack) is one of three potential pathways for acetate production in C. neoformans. Here, we demonstrate the biolistic transformation of a construct, which has the gene encoding Ack fused to the fluorescent tag mCherry, into&#160;C. neoformans. We then confirm integration of the ACK-mCherry fusion into the&#160;ACK&#160;locus.

Biolistic Transformation of a Fluorescent Tagged Gene into the Opportunistic Fungal Pathogen Cryptococcus neoformans

Biolistic transformation is a method used to generate stable integration of DNA into the genome of the opportunistic pathogen Cryptococcus neoformans through homologous recombination. We will demonstrate biolistic transformation of a construct, which has the gene encoding acetate kinase fused to the fluorescent tag mCherry into&#160;C. neoformans.

Trasformazione Biolistic di una fluorescente Tagged Gene nel Opportunistic Fungal patogeni<em&gt; Cryptococcus neoformans</em

The basidiomycete Cryptococcus neoformans, an invasive opportunistic pathogen of the central nervous system, is the most frequent cause of fungal ...

Immunologia e infezioni

Visualizing Yeast Organelles with Fluorescent Protein Markers

The budding yeast, Saccharomyces cerevisiae, is a classic model system in studying organelle function and dynamics. In our previous works, we have constructed fluorescent protein-based markers for major organelles and endomembrane structures, including the nucleus, endoplasmic reticulum (ER), Golgi apparatus, endosomes, vacuoles, mitochondria, peroxisomes, lipid droplets, and autophagosomes. The protocol presented here describes the procedures for using these markers in yeast, including DNA preparation for yeast transformation, selection and evaluation of transformants, fluorescent microscopic observation, and the expected outcomes. The text is geared toward researchers who are entering the field of yeast organelle study from other backgrounds. Essential steps are covered, as well as technical notes about microscope hardware considerations and several common pitfalls. It provides a starting point for people to observe yeast subcellular entities by live-cell fluorescent microscopy. These tools and methods can be used to identify protein subcellular localization and track organelles of interest in time-lapse imaging.

Here we describe the use of a set of fluorescent protein-based organelle markers in live-cell imaging of the budding yeast, Saccharomyces cerevisiae.

The budding yeast, Saccharomyces cerevisiae, is a classic model system in studying organelle function and dynamics. In our previous works, we have ...

Biochimica

In vivo Quantification of G Protein Coupled Receptor Interactions using Spectrally Resolved Two-photon Microscopy

The study of protein interactions in living cells is an important area of research because the information accumulated both benefits industrial applications as well as increases basic fundamental biological knowledge. F&ouml;rster (Fluorescence) Resonance Energy Transfer (FRET) between a donor molecule in an electronically excited state and a nearby acceptor molecule has been frequently utilized for studies of protein-protein interactions in living cells. The proteins of interest are tagged with two different types of fluorescent probes and expressed in biological cells. The fluorescent probes are then excited, typically using laser light, and the spectral properties of the fluorescence emission emanating from the fluorescent probes is collected and analyzed. Information regarding the degree of the protein interactions is embedded in the spectral emission data. Typically, the cell must be scanned a number of times in order to accumulate enough spectral information to accurately quantify the extent of the protein interactions for each region of interest within the cell. However, the molecular composition of these regions may change during the course of the acquisition process, limiting the spatial determination of the quantitative values of the apparent FRET efficiencies to an average over entire cells. By means of a spectrally resolved two-photon microscope, we are able to obtain a full set of spectrally resolved images after only one complete excitation scan of the sample of interest. From this pixel-level spectral data, a map of FRET efficiencies throughout the cell is calculated. By applying a simple theory of FRET in oligomeric complexes to the experimentally obtained distribution of FRET efficiencies throughout the cell, a single spectrally resolved scan reveals stoichiometric and structural information about the oligomer complex under study. Here we describe the procedure of preparing biological cells (the yeast Saccharomyces cerevisiae) expressing membrane receptors (sterile 2 &alpha;-factor receptors) tagged with two different types of fluorescent probes. Furthermore, we illustrate critical factors involved in collecting fluorescence data using the spectrally resolved two-photon microscopy imaging system. The use of this protocol may be extended to study any type of protein which can be expressed in a living cell with a fluorescent marker attached to it.

In vivo Quantification of G Protein Coupled Receptor Interactions using Spectrally Resolved Two-photon Microscopy

By employing a spectrally resolved two-photon microscopy imaging system, pixel-level maps of F&ouml;rster Resonance Energy Transfer (FRET) efficiencies are obtained for cells expressing membrane receptors hypothesized to form homo-oligomeric complexes. From the FRET efficiency maps, we are able to estimate stoichiometric information about the oligomer complex under study.

Quantificazione in vivo di G interazioni proteina recettore accoppiato con spettralmente risolte microscopia a due fotoni

The study of protein interactions in living cells is an important area of research because the information accumulated both benefits industrial ...

Biologia

Quantitative Live Cell Fluorescence-microscopy Analysis of Fission Yeast

Several microscopy techniques are available today that can detect a specific protein within the cell. During the last decade live cell imaging using fluorochromes like Green Fluorescent Protein (GFP) directly attached to the protein of interest has become increasingly popular 1. Using GFP and similar fluorochromes the subcellular localisations and movements of proteins can be detected in a fluorescent microscope. Moreover, also the subnuclear localisation of a certain region of a chromosome can be studied using this technique. GFP is fused to the Lac Repressor protein (LacR) and ectopically expressed in the cell where tandem repeats of the lacO sequence has been inserted into the region of interest on the chromosome2. The LacR-GFP will bind to the lacO repeats and that area of the genome will be visible as a green dot in the fluorescence microscope. Yeast is especially suited for this type of manipulation since homologous recombination is very efficient and thereby enables targeted integration of the lacO repeats and engineered fusion proteins with GFP 3. Here we describe a quantitative method for live cell analysis of fission yeast. Additional protocols for live cell analysis of fission yeast can be found, for example on how to make a movie of the meiotic chromosomal behaviour 4. In this particular experiment we focus on subnuclear organisation and how it is affected during gene induction. We have labelled a gene cluster, named Chr1, by the introduction of lacO binding sites in the vicinity of the genes. The gene cluster is enriched for genes that are induced early during nitrogen starvation of fission yeast 5. In the strain the nuclear membrane (NM) is labelled by the attachment of mCherry to the NM protein Cut11 giving rise to a red fluorescent signal. The Spindle Pole body (SPB) compound Sid4 is fused to Red Fluorescent Protein (Sid4-mRFP) 6. In vegetatively growing yeast cells the centromeres are always attached to the SPB that is embedded in the NM 7. The SPB is identified as a large round structure in the NM. By imaging before and 20 minutes after depletion of the nitrogen source we can determine the distance between the gene cluster (GFP) and the NM/SPB. The mean or median distances before and after nitrogen depletion are compared and we can thus quantify whether or not there is a shift in subcellular localisation of the gene cluster after nitrogen depletion.

The fission yeast, Schizosaccharomyces pombe, is a good model system to study basic cellular processes. Here we describe a method to perform quantitative live cell analysis of fission yeast. In this particular experiment we focus on organisation of the genome within the cell nucleus, but the method can also be used to study cytosolic factors.

Quantitativa vivo cellulare-microscopio a fluorescenza Analisi di lievito Fission

Several microscopy techniques are available today that can detect a specific protein within the cell. During the last decade live cell imaging using ...

Use of In Vivo Imaging to Screen for Morphogenesis Phenotypes in Candida albicans Mutant Strains During Active Infection in a Mammalian Host

Candida albicans is an important human pathogen. Its ability to switch between morphologic forms is central to&#160;its pathogenesis; these morphologic changes are regulated by a complex signaling network controlled in response to environmental stimuli. These regulatory components have been highly studied, but almost all studies use a variety of in vitro stimuli to trigger filamentation. To determine how morphogenesis is regulated during the pathogenesis process, we developed an in vivo microscopy system to obtain high spatial resolution images of organisms undergoing hyphal formation within the mammalian host. The protocol presented here describes the use of this system to screen small collections of C. albicans mutant strains, allowing us to identify key regulators of morphogenesis as it occurs at the site of infection. Representative results are presented, demonstrating that some regulators of morphogenesis, such as the transcriptional regulator Efg1, have consistent phenotypes in vitro and in vivo, whereas other regulators, such as adenyl cyclase (Cyr1), have significantly different phenotypes in vivo compared to in vitro.

Use of In Vivo Imaging to Screen for Morphogenesis Phenotypes in Candida albicans Mutant Strains During Active Infection in a Mammalian Host

This manuscript describes a method for screening moderately sized Candida albicans mutant libraries for morphogenesis phenotypes during active infection in a mammalian host using non-invasive confocal microscopy.

Uso dell'imaging in vivo per lo screening dei fenotipi di morfogenesi in ceppi mutanti di Candida albicans durante l'infezione attiva in un ospite di mammifero

Candida albicans is an important human pathogen. Its ability to switch between morphologic forms is central to&#160;its pathogenesis; these morphologic ...

Definizione di un modello murino per l'infezione correlata al catetere associata a Candida albicans

A Catheter-Related Candida albicans Infection Model in Mouse

Catheter-related infection (CRI) is a common nosocomial infection caused by candida albicans during catheter implantation. Typically, biofilms are formed on the outer surface of the catheter and lead to disseminated infections, which are fatal to patients. There are no effective prevention and treatment management in clinics. Therefore, it is urgent to establish an animal model of CRI for the preclinical screening of new strategies for its prevention and treatment. In this study, a polyethylene catheter, a widely used medical catheter, was inserted into the back of the BALB/c mice after hair removal. Candida albicans ATCC MYA-2876 (SC5314) expressing enhanced green fluorescent protein was subsequently inoculated on the skin's surface along the catheter. Intense fluorescence was observed on the surface of the catheter under a fluorescent microscope 3 days later. Mature and thick biofilms were found on the surface of the catheter via scanning electron microscopy. These results indicated the adhesion, colonization, and biofilm formation of candida albicans on the surface of the catheter. The hyperplasia of the epidermis and the infiltration of inflammatory cells in the skin specimens indicated the histopathological changes of the CRI-associated skin. To sum up, a mouse CRI model was successfully established. This model is expected to be helpful in the research and development of therapeutic management for candida albicans associated CRI.

Autore in primo piano: Migliorare il rilevamento della Candida albicans nelle infezioni da catetere utilizzando la marcatura proteica fluorescente 

We establish a mouse model of C.albicans-associated catheter-related infection (CRI), in which biofilm forms on the catheter, and the interaction between C.albicans and host correlates well with the clinical CRI. This model helps screen therapies for C.albicans biofilm-associated CRI, laying a foundation for clinical transformation.

Un modello di infezione da Candida albicans correlato al catetere nel topo

Catheter-related infection (CRI) is a common nosocomial infection caused by candida albicans during catheter implantation. Typically, biofilms are formed ...

Microscopy of Fission Yeast Sexual Lifecycle

The fission yeast Schizosaccharomyces pombe has been an invaluable model system in studying the regulation of the mitotic cell cycle progression, the mechanics of cell division and cell polarity. Furthermore, classical experiments on its sexual reproduction have yielded results pivotal to current understanding of DNA recombination and meiosis. More recent analysis of fission yeast mating has raised interesting questions on extrinsic stimuli response mechanisms, polarized cell growth and cell-cell fusion. To study these topics in detail we have developed a simple protocol for microscopy of the entire sexual lifecycle. The method described here is easily adjusted to study specific mating stages. Briefly, after being grown to exponential phase in a nitrogen-rich medium, cell cultures are shifted to a nitrogen-deprived medium for periods of time suited to the stage of the sexual lifecycle that will be explored. Cells are then mounted on custom, easily built agarose pad chambers for imaging. This approach allows cells to be monitored from the onset of mating to the final formation of spores.

We provide a reproducible basic method for the long-term microscopy of the fission yeast sexual lifecycle. With minor adjustments described, the presented protocol allows research focus on different steps of the reproductive process.

Microscopia di lievito di fissione del ciclo di vita sessuale

The fission yeast Schizosaccharomyces pombe has been an invaluable model system in studying the regulation of the mitotic cell cycle progression, the ...

Generazione di fusioni proteina fluorescente in

Riepilogo

Esplora Altri Video

Capitoli in questo video

Il canale di Excretory c. elegans come un modello per intracellulare Lumen morfogenesi e biogenesi di membrana polarizzata In Vivo in una singola cella: etichettatura di GFP-fusioni, schermata di interazione di RNAi e Imaging

Trasformazione Biolistic di una fluorescente Tagged Gene nel Opportunistic Fungal patogeni

Visualizing Yeast Organelles with Fluorescent Protein Markers

Quantificazione in vivo di G interazioni proteina recettore accoppiato con spettralmente risolte microscopia a due fotoni

Quantitativa vivo cellulare-microscopio a fluorescenza Analisi di lievito Fission

Uso dell'imaging in vivo per lo screening dei fenotipi di morfogenesi in ceppi mutanti di Candida albicans durante l'infezione attiva in un ospite di mammifero

Un modello di infezione da Candida albicans correlato al catetere nel topo

Un modello di infezione da Candida albicans correlato al catetere nel topo

Un modello di infezione da Candida albicans correlato al catetere nel topo

Microscopia di lievito di fissione del ciclo di vita sessuale