We thank N. Dean for providing the original mCherry FP sequence, M. Gerami-Nejad for construction of plasmids, B. Larson for technical assistance, and T. Heisel for helpful advice during the development of this project. J.B. was supported by the European Research Council Advanced Award 340087 (RAPLODAPT). Microscopy and imaging systems were provided by the University of Minnesota Pediatrics Foundation and the University of Minnesota Imaging Center.

1. Isolate Template Plasmids from E. coli
<ol>
	<li>Grow E. coli containing the template plasmid overnight in 10 ml lysogeny broth (LB) + 200 mg/L ampicillin (AMP) at 37 &#176;C with shaking.</li>
	<li>Harvest cells by centrifuging at 6,000 x g for 2 min.</li>
	<li>Decant liquid, isolate and purify DNA from E. coli cells by a standard method as described previously in Ausubel et al.8.</li>
	<li>Resuspend DNA in Tris-EDTA (TE; 10 mM Tris, pH 8.0, 1 mM EDTA, pH 8.0) at a working concentration of 50-100 ng/ml.</li>
</ol>
2. Design Primers

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td fo:width="0.5in" style="width:50px">Primer</td>
			<td>Primer Sequence</td>
		</tr>
		<tr>
			<td>F1</td>
			<td>5&#39;&#160;GAGAATTGAAGAAGAGTTGGGAGACAATGCTATCTATGCTGGTAAGGACTTCCACAATGCTCAAACTTTG 
			GGTGGTTCTAAAGGTGAAGAATTATT 3&#39;</td>
		</tr>
		<tr>
			<td>R1</td>
			<td>5&#39;&#160;GAGCGTTTGCACCAACAGGCCATCATTTGTGACGAGAGAAGACCTGACGTCATTAGATTGGCACCTTTGC 
			GTAAAACGACGGCCAGTGAATTC 3&#39;</td>
		</tr>
		<tr>
			<td>F2</td>
			<td>5&#39;&#160;GAGAATTGAAGAAGAGTTGGGAGACAATGCTATCTATGCTGGTAAGGACTTCCACAATGCTCAAACTTTG 
			GGTGGTGTTTCAAAAGGTGAAGAAGATAAT 3&#39;</td>
		</tr>
		<tr>
			<td>R2</td>
			<td>5&#39;&#160;GAGCGTTTGCACCAACAGGCCATCATTTGTGACGAGAGAAGACCTGACGTCATTAGATTGGCACCTTTGC 
			ACTGGATGGCGGCGTTAGTATC 3&#39;</td>
		</tr>
	</tbody>
</table>
Table 1: Primer sequences used in this study. Bold italicized text indicates homology to the ENO1 genomic locus, normal font regions are homologous to plasmid DNA.
<ol>
	<li>Design primers to be homologous to plasmid sequences bordering the cassette to be amplified as well as to the 3&#39;-end of the target gene of interest (e.g. ENO1) to facilitate recombination into the gene&#39;s genomic locus (Figure 2 and Table 1).
	<ol>
		<li>Ensure that the forward primer sequences match the last 70 base pairs (bp) of the gene of interest, 5&#39;- 3&#39;, minus the stop codon, to maintain the coding frame, plus the first approximately 30 bp of the plasmid sequence to be amplified. As a note, the GGTGGTGGTT in each primer is a poly-glycine linker with no FP homology. Of note, in the absence of a linker, there can be direct fusion of functional domains, which can theoretically lead to protein misfolding, low yield in protein production, or impaired bioactivity.</li>
		<li>Ensure that the reverse primer sequences are 70 bp just downstream of gene, 3&#39;- 5&#39;, not including any gene sequence, plus the last approximately 30 bp of the nutritional or drug resistance marker used in the plasmid.</li>
		<li>Use F1 and R1 to generate GFP-NAT1 and YFP-NAT1 cassettes with pMG2120 and pMG2263, respectively and F2 and R2 to generate mCherry-NAT1 with pMG2343.</li>
	</ol>
	</li>
</ol>
3. Generate FP Cassettes by PCR (Day 1)
<ol>
	<li>Prepare reagents for PCR. Make a master mix (500 &#181;l final volume) by adding the following volumes and concentrations to a 1.5 ml tube: 50 &#181;l PCR buffer (500 mM potassium chloride, 100 mM Tris pH 8.0 in water), 20 &#181;l deoxynucleotides (dNTPs; stock mixture of nucleotides at 10 mM each), 40 &#181;l 25 mM magnesium chloride, 20 &#181;l purified plasmid (from ~50-100 ng/&#181;l stock solution), 10 &#181;l each forward and reverse primer (from 10 mM stock solutions), 30 &#181;l Taq polymerase (generic, 5,000 units/ml), and 320 &#181;l water.
	<ol>
		<li>Aliquot 50 &#181;l of master mix into each of 10 PCR-compatible 0.5 ml tubes.</li>
	</ol>
	</li>
	<li>Place PCR tubes in thermocycler and run the following steps: 1 cycle of 5 min at 94 &#176;C to denature dsDNA; 40 cycles sequentially of 45 sec at 94 &#176;C, 30 sec at 55 &#176;C to allow primers to anneal to plasmid template DNA, and 4 min at 68 &#176;C for extension of DNA products; and 1 final extension cycle of 15 min at 72 &#176;C. 
	NOTE: The PCR master mix and cycling parameters may need to be modified based on the particular Taq polymerase used.</li>
	<li>Pool all products from the 10 PCR reactions in a 1.5 ml tube.
	<ol>
		<li>Subject 5 &#181;l of pooled PCR product to agarose gel electrophoresis to verify amplicon size and obtain an estimate of product concentration, based on comparison to a DNA ladder. Generally, use ~250 &#181;g of cassette DNA in each subsequent transformation mix.</li>
		<li>Precipitate DNA by adding 50 &#181;l 3 M sodium acetate followed by 750 &#181;l 95% ethanol to the products and incubate at least 30 min at -20&#176; C.</li>
		<li>Harvest the PCR products by centrifuging the tube at 16,000 x g for 10 min. Carefully remove and discard the supernatant and dry the pellet overnight. Resuspend the dried DNA cassette pellet in 40 &#181;l TE pH 8.0 and store at room temperature until use.</li>
	</ol>
	</li>
</ol>
4. Transform Candida Cells with FP DNA Cassettes
<ol>
	<li>On Day 1, recover yeast strain to be transformed from a 15% glycerol frozen (-80 &#176;C) stock by streaking a few scraped crystals onto yeast peptone dextrose with adenine (YPAD) agar and incubate at 30 &#176;C. After recovery of colony growth, inoculate a single colony into 2 ml liquid YPAD medium in a glass culture tube with a breathable cap and incubate overnight at 30 &#176;C with agitation.</li>
	<li>On Day 2, dilute 300 &#181;l of overnight yeast culture into 50 ml fresh YPAD (to a final OD600 of ~0.2) in a 125 ml Erlenmeyer flask with a breathable cap. Shake at 30 &#176;C for ~3 hr (to a final OD600 ~0.6-0.8).
	<ol>
		<li>Pour the overnight culture into a 50 ml conical tube and pellet the cells by spinning for 5 min at 1 500 x g in a table top centrifuge.</li>
		<li>Pour off and properly discard the supernatant. Resuspend the cell pellet in 5 ml water. Re-pellet the cells by centrifuging again for 5 min at 1,500 x g in a table top centrifuge.</li>
		<li>Pour off and properly discard the supernatant. Resuspend the cells in 500 &#181;l TELiAc (TE lithium acetate: 10 mM Tris, pH 8.0, 1 mM EDTA, pH 8.0, 0.1 M lithium acetate) while transferring to a 1.5 ml tube. Centrifuge the tube for 2 min at 3,000 x g in a microcentrifuge.</li>
		<li>Resuspend cells in 250 &#181;l TELiAc. The total volume including the pellet should be ~300 &#181;l.</li>
	</ol>
	</li>
	<li>To a clean (different microfuge tube than in 4.2.4), add 5 &#181;l carrier DNA (10 mg/ml) and 150 &#181;l of prepared Candida cells (from 4.2.4). This is the negative control for transformation.
	<ol>
		<li>To a second clean microfuge tube, add 5 &#181;l of denatured carrier DNA (that has been boiled at 90 &#176;C for 10 min and cooled to 4 &#176;C), all 40 &#181;l of the prepared PCR product (from 3.3.1) and 150 &#181;l of prepared Candida cells (from 4.2.4).</li>
		<li>Incubate the two transformation mixes for 30 min at room temperature.</li>
		<li>To each transformation mix tube, add 700 &#181;l PLATE mix (10 mM Tris, pH 8.0, 1 mM EDTA, pH 8.0, 0.1 M lithium acetate in 50% polyethylene glycol 3350). Invert the tubes to mix and incubate them overnight at RT.</li>
	</ol>
	</li>
	<li>On Day 3, incubate the transformation mixes at 42 &#176;C for 1 hr (heat shock).
	<ol>
		<li>Centrifuge the transformation mixes for 30 sec at 16,000 x g in a microcentrifuge. Remove and properly discard the supernatant. Resuspend each of the cell pellets in 150 &#181;l water by gently pipetting up and down so as to not to damage the cells.</li>
		<li>For transformations utilizing auxotrophic marker genes (e.g. URA3), plate each entire mixture by pipetting the solutions onto the appropriate selective media agar (e.g. lacking uridine) and spread the mixture evenly using sterile glass beads.</li>
		<li>For transformations utilizing the nourseothricin resistance marker gene (NAT1), as described here, plate transformation mixes first onto non-selective YPAD agar and incubate at 30 &#176;C for 6-12 hr. This step aids in cell recovery, post heat shock, before nourseothricin stress is applied.</li>
		<li>After partial growth recovery, replica plate the Candida cells onto YPAD containing 400 &#181;g/ml nourseothricin. For transformations utilizing nutritional marker genes (e.g. URA3), this intermediate plating step is not needed and cells can be directly plated onto selective yeast media (e.g. YPAD lacking uridine) as described in 4.4.2. 
		NOTE: If the transformation is successful, colonies should appear within one to three days (potentially up to five days of outgrowth for selection on nourseothricin-containing agar). No colonies should appear on plates spread with transformation mixes containing carrier DNA alone (negative control).</li>
	</ol>
	</li>
	<li>For auxotrophic and nourseothricin marker selection, streak putative transformants as single colonies to fresh selective media agar plates and incubate at 30 &#176;C to propagate yeast cells that can be screened for successful construction of FP fusions.</li>
	<li>Screen transformants for correct integration of the tagging cassette (see Representative Results for a detailed example). If the gene of interest is expressed at sufficient amounts, whole colony fluorescence may occur such that it is possible to detect potential candidate integrants using a plate imaging system with fluorescence detection ability.
	<ol>
		<li>Check putative integrants by PCR using primers homologous to sequences outside of the region of integration to confirm fusion to the target gene.</li>
		<li>In addition, consider Western blot analysis to determine the expression and size of the fusion protein, as well as by fluorescence microscopy of single cells for visual confirmation of protein localization, if known.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Bendel, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colonization+and+epithelial+adhesion+in+the+pathogenesis+of+neonatal+candidiasis.">Colonization and epithelial adhesion in the pathogenesis of neonatal candidiasis.</a> Semin. Perinatol. 27 (5), 357-364 (2003).</li><li>Gerami-Nejad, M., Berman, J., Gale, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cassettes+for+PCR-mediated+construction+of+green,+yellow,+and+cyan+fluorescent+protein+fusions+in+Candida+albicans.">Cassettes for PCR-mediated construction of green, yellow, and cyan fluorescent protein fusions in Candida albicans.</a> Yeast. 18 (9), 859-864 (2001).</li><li>Gerami-Nejad, M., Dulmage, K., Berman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Additional+cassettes+for+epitope+and+fluorescent+fusion+proteins+in+Candida+albicans.">Additional cassettes for epitope and fluorescent fusion proteins in Candida albicans.</a> Yeast. 26 (7), 399-406 (2009).</li><li>Gerami-Nejad, M., Forche, A., McClellan, M., Berman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+protein+function+in+clinical+C.+albicans+isolates.">Analysis of protein function in clinical C. albicans isolates.</a> Yeast. 29 (8), 303-309 (2012).</li><li>Gerami-Nejad, M., Hausauer, D., McClellan, M., Berman, J., Gale, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cassettes+for+the+PCR-mediated+construction+of+regulatable+alleles+in+Candida+albicans.">Cassettes for the PCR-mediated construction of regulatable alleles in Candida albicans.</a> Yeast. 21 (5), 429-436 (2004).</li><li>Gonia, S., Larson, B., Gale, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR-mediated+gene+modification+strategy+for+construction+of+fluorescent+protein+fusions+in+Candida+parapsilosis.">PCR-mediated gene modification strategy for construction of fluorescent protein fusions in Candida parapsilosis.</a> Yeast. 33 (2), 63-69 (2016).</li><li>Milne, S. W., Cheetham, J., Lloyd, D., Aves, S., Bates, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cassettes+for+PCR-+mediated+gene+tagging+in+Candida+albicans+utilizing+nourseothricin+resistance.">Cassettes for PCR- mediated gene tagging in Candida albicans utilizing nourseothricin resistance.</a> Yeast. 28 (12), 833-841 (2011).</li><li>Ausubel, F. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Current Protocols in Molecular Biology. , (1995).</li><li>Wilson, R. B., Davis, D., Mitchell, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+hypothesis+testing+with+Candida+albicans+through+gene+disruption+with+short+homology+regions.">Rapid hypothesis testing with Candida albicans through gene disruption with short homology regions.</a> J. Bacteriol. 181 (6), 1868-1874 (1999).</li><li>Pulver, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rsr1+focuses+Cdc42+activity+at+hyphal+tips+and+promotes+maintenance+of+hyphal+development+in+Candida+albicans.">Rsr1 focuses Cdc42 activity at hyphal tips and promotes maintenance of hyphal development in Candida albicans.</a> Eukaryotic Cell. 12 (4), 482-495 (2013).</li><li>Falgier, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Candida+species+differ+in+their+interactions+with+immature+human+gastrointestinal+epithelial+cells.">Candida species differ in their interactions with immature human gastrointestinal epithelial cells.</a> Pediatr. Res. 69 (5), 384-389 (2011).</li><li>Nosek, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+manipulation+of+the+pathogenic+yeast+Candida+parapsilosis.">Genetic manipulation of the pathogenic yeast Candida parapsilosis.</a> Curr. Genet. 42 (1), 27-35 (2002).</li><li>Zemanova, J., Nosek, J., Tomaska, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-efficiency+transformation+of+the+pathogenic+yeast+Candida+parapsilosis.">High-efficiency transformation of the pathogenic yeast Candida parapsilosis.</a> Curr. Genet. 45 (3), 183-186 (2004).</li><li>Benjamin, D. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neonatal+candidiasis+among+extremely+low+birth+weight+infants:+risk+factors,+mortality+rates,+and+neurodevelopmental+outcomes+at+18+to+22+months.">Neonatal candidiasis among extremely low birth weight infants: risk factors, mortality rates, and neurodevelopmental outcomes at 18 to 22 months.</a> Pediatrics. 117 (1), 84-92 (2006).</li><li>Kullberg, B. J., Arendrup, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Invasive+Candidiasis.">Invasive Candidiasis.</a> N Engl J Med. 373 (15), 1445-1456 (2015).</li></ol>

The authors have nothing to disclose.

Construction of epitope tagged sequences in Candida species using the PCR-mediated gene modification strategy described above can be summarized as a three-step process. First, a cassette is made by PCR that encodes both the sequence desired for integration and regions homologous to the locus of insertion into the yeast genome. Second, the yeast cells to be transformed are made chemically competent with lithium acetate and co-incubated with the cassette. Third, the cells are plated on selective media to recover t...

Candida species are commensal fungi that colonize the intestinal and genitourinary tracts of all humans. Under conditions of immunodeficiency, such as that occur with premature birth or immunosuppressive effects from treatments for cancer, Candida species can become opportunistic pathogens. Of the Candida species, Candida albicans is the most prevalent fungal colonizer and causes the majority of invasive fungal infections. Other Candida species such as C. glabrata, C. parapsilosis, C. tropicalis, and C. kruseii also cause serious infections in immunocompromised patients, with some exhibiting intrinsic resistance to commonly used anti-fungal antibiotics such as fluconazole and amphotericin B. Hence, infections with some of these species are being observed more frequently, especially in patients being treated prophylactically with anti-fungal agents. Even with appropriate and timely anti-fungal treatment, invasive Candida infections continue to be associated with significant morbidity and mortality1. Because of the significance of Candida species in human health, there is a need for readily available molecular tools that allow the study and elucidation of their pathogenesis mechanisms.
One important tool that allows researchers to visualize and quantify microbial cells and the proteins that they express is FP fusion technology. Polymerase chain reaction (PCR)-mediated gene modification, as described in this paper, allows the construction of fusions, between FP sequences and a Candida protein coding sequence of interest at its genomic locus. Stable integration of the construct facilitates analysis of protein expression as well as protein localization dynamics. Plasmids containing FP sequences, optimized for expression in Candida albicans and that can be used in the PCR-mediated gene modification strategy, have been previously constructed2,3,4,5. Plasmids contain FP transformation &#34;cassettes&#34;: a FP sequence linked to a nutritional marker gene that facilitates the transformation of C. albicans and C. parapsilosis2,3,4,5,6,7. Currently available plasmids contain a variety of selectable nutritional marker genes (URA3, HIS1, ARG4) for transformation of auxotrophic strains as well as a dominant drug resistance marker (NAT1), which facilitates transformation of clinical strains lacking auxotrophies. In addition, plasmids contain options for up to four different FP sequences (green [GFP], yellow [YFP], cyan [CFP], and cherry [mCherry]) and either an ADH1 termination sequence for construction of carboxy-terminus protein fusions, or a promoter sequence for construction of amino-terminus protein fusions. Primers are designed with homology to the plasmid DNA surrounding the FP cassette. In addition, the primers also contain 5&#39;-extension sequences bearing homology to the yeast gene of interest to be tagged, which facilitates integration of the cassette into the genomic locus via homologous recombination (Figure 1). Gene-specific FP cassettes are generated by PCR and then transformed into Candida cells made competent for uptake of DNA by treatment with lithium acetate.
<img alt="Figure 1" src="/files/ftp_upload/55333/55333fig1.jpg" /> 
Figure 1: Diagram of how FP sequence fusions are generated in Candida species. (A) Plasmid DNA includes a FP sequence and a sequence encoding nourseothricin resistance (NAT1). Relative locations of Forward (FWD) and reverse (REV) primers are shown, with black portions of the primers indicating the region of homology to the plasmid sequence and the purple portions denoting the gene-specific homology region or primer extension. (B) FP cassettes are transformed into Candida and integrate within the ENO1 genomic locus via homologous recombination (dotted lines). (C) Resulting FP fusion sequence at the 3&#39;end of ENO1. <a href="http://cloudflare.jove.com/files/ftp_upload/55333/55333fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Herein, we present an example of protein fusion (Eno1-FP) constructions in Candida species. We use tagging plasmids containing the NAT1 transformation marker gene along with sequences encoding GFP, YFP, or mCherry (Figure 2). These plasmids are used along with primers in PCR to generate gene-specific cassettes that facilitate fusion of FPs to the 3&#39;-end of ENO1, resulting in expression of Eno1 fused to FPs at its carboxy-terminus.
<img alt="Figure 2" src="/files/ftp_upload/55333/55333fig2.jpg" /> 
Figure 2: Maps of FP cassette-containing plasmids. Forward (F) and reverse (R) primers used to generate the cassettes from the plasmids are indicated along with the relative location of their homology to the plasmids. Primer sequences are as listed in Table 1. F1 and R1 were also used to generate the pYFP-NAT1 cassette. The plasmid containing the YFP-NAT1 cassette (pMG2263) is identical to pMG2120 with the exception of YFP in place of the GFP sequence. Cassette sizes: GFP-NAT1, 3.7 kbp; mCherry-NAT1, 3.2 kbp; YFP-NAT1, 3.7 kbp. This figure has been modified from Gerami-Nejad, et al.4 <a href="http://cloudflare.jove.com/files/ftp_upload/55333/55333fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>100W mercury lamp</td>
			<td>CHIU Technical Corporation</td>
			<td>M-100T</td>
			<td></td>
		</tr>
		<tr>
			<td>95% Ethanol</td>
			<td>Any</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Adenine</td>
			<td>Any</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Any</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Carrier DNA</td>
			<td>Ambion</td>
			<td>AM9680</td>
			<td>Sheared Salmon Sperm DNA 10 mg/ml</td>
		</tr>
		<tr>
			<td>CCD Camera</td>
			<td>Photometrics</td>
			<td>CoolSNAP HQ</td>
			<td></td>
		</tr>
		<tr>
			<td>Conical Tube</td>
			<td>Corning</td>
			<td>430828</td>
			<td>50ml</td>
		</tr>
		<tr>
			<td>Culture Tube Rotator</td>
			<td>New Brunswick</td>
			<td>2013923</td>
			<td>TC-8, or Any Culture Tube Rotator</td>
		</tr>
		<tr>
			<td>Deoxynucleotides (dNTP) PCR Grade</td>
			<td>Any</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Eppendorf Tubes</td>
			<td>Eppendorf</td>
			<td>022363719, 022363212</td>
			<td>0.5ml, 1.5ml</td>
		</tr>
		<tr>
			<td>Erlenmeyer Flask</td>
			<td>Fisher Scientific</td>
			<td>7250089</td>
			<td>125ml</td>
		</tr>
		<tr>
			<td>Ethylenediaminetetraacetic Acid (EDTA)</td>
			<td>Any</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Freezer (-80 &#176;C )</td>
			<td>Thermo Electron Corporation</td>
			<td>ULT-1386-9-V</td>
			<td>Revco Ultima II</td>
		</tr>
		<tr>
			<td>GFP, YFP and Texas Red Filter Sets</td>
			<td>Chroma Technology Corporation</td>
			<td>49002, 86004v2, 49008</td>
			<td></td>
		</tr>
		<tr>
			<td>Glass culture tubes</td>
			<td>Fisher Scientific</td>
			<td>1496126</td>
			<td>75mm</td>
		</tr>
		<tr>
			<td>HRP goat anti-mouse antibody</td>
			<td>Santa Cruz Biotechnology</td>
			<td>SC-2005</td>
			<td></td>
		</tr>
		<tr>
			<td>HRP goat anti-rabbit antibody</td>
			<td>Santa Cruz Biotechnology</td>
			<td>SC-2301</td>
			<td></td>
		</tr>
		<tr>
			<td>Incubator (30 &#176;C )</td>
			<td>Any</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Lithium Acetate</td>
			<td>Any</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Lysogeny Broth (LB) Media</td>
			<td>Any</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Magnesium Chloride</td>
			<td>Any</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Microcentrifuge</td>
			<td>Eppendorf</td>
			<td>5415 D</td>
			<td></td>
		</tr>
		<tr>
			<td>Microscope</td>
			<td>Nikon</td>
			<td>E600</td>
			<td>Nikon Eclipse E600</td>
		</tr>
		<tr>
			<td>Microscope Image Analysis Software</td>
			<td>Universal Imaging Corporation</td>
			<td>6.3r7</td>
			<td>MetaMorph Software Series 6.3r7</td>
		</tr>
		<tr>
			<td>Mouse anti-GFP antibody</td>
			<td>Roche</td>
			<td>11814460001</td>
			<td></td>
		</tr>
		<tr>
			<td>Nourseothricin</td>
			<td>Fisher Scientific</td>
			<td>50997939</td>
			<td></td>
		</tr>
		<tr>
			<td>PCR Thermocycler</td>
			<td>Applied Biosystems</td>
			<td>9700</td>
			<td>GeneAmp PCR System</td>
		</tr>
		<tr>
			<td>PCR tubes</td>
			<td>BioExpress, GeneMate</td>
			<td>T-3035-1</td>
			<td>0.2ml</td>
		</tr>
		<tr>
			<td>Polyethylene Glycol 3350</td>
			<td>Any</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Potassium Chloride</td>
			<td>Any</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Rabbit anti-mCherry antibody</td>
			<td>BioVision</td>
			<td>5993-100</td>
			<td></td>
		</tr>
		<tr>
			<td>Refrigerator (4&#176;C)</td>
			<td>Any</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Sodium Acetate</td>
			<td>Any</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Stereomicroscope</td>
			<td>Nikon</td>
			<td>SMZ1500</td>
			<td></td>
		</tr>
		<tr>
			<td>Table Top Centrifuge</td>
			<td>Labnet</td>
			<td>Z 400</td>
			<td>Hermle Z 400</td>
		</tr>
		<tr>
			<td>Taq DNA Polymerase</td>
			<td>Any</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Tris(hydroxymethyl)aminomethane (Tris)</td>
			<td>Any</td>
			<td>NA</td>
			<td></td>
		</tr>
		<tr>
			<td>Vortex Mixer</td>
			<td>Scientific Industries</td>
			<td>SI-0236</td>
			<td>Vortex Genie 2</td>
		</tr>
		<tr>
			<td>Yeast Extract Peptone Dextrose (YPD) Media</td>
			<td>Any</td>
			<td>NA</td>
			<td></td>
		</tr>
	</tbody>
</table>

generation of fluorescent protein fusions in candida species

Candida species, prevalent colonizers of the intestinal and genitourinary tracts, are the cause of the majority of invasive fungal infections in humans. Thus, molecular and genetic tools are needed to facilitate the study of their pathogenesis mechanisms. PCR-mediated gene modification is a straightforward and quick approach to generate epitope-tagged proteins to facilitate their detection. In particular, fluorescent protein (FP) fusions are powerful tools that allow visualization and quantitation of both yeast cells and proteins by fluorescence microscopy and immunoblotting, respectively. Plasmids containing FP encoding sequences, along with nutritional marker genes that facilitate the transformation of Candida species, have been generated for the purpose of FP construction and expression in Candida. Herein, we present a strategy for constructing a FP fusion in a Candida species. Plasmids containing the nourseothricin resistance transformation marker gene (NAT1) along with sequences for either green, yellow, or cherry FPs (GFP, YFP, mCherry) are used along with primers that include gene-specific sequences in a polymerase chain reaction (PCR) to generate a FP cassette. This gene-specific cassette has the ability to integrate into the 3'-end of the corresponding gene locus via homologous recombination. Successful in-frame fusion of the FP sequence into the gene locus of interest is verified genetically, followed by analysis of fusion protein expression by microscopy and/or immuno-detection methods. In addition, for the case of highly expressed proteins, successful fusions can be screened for primarily by fluorescence imaging techniques.

As an example, we used the protocol described above to construct GFP and mCherry fusions to Eno1 in a C. parapsilosis laboratory strain. Each putative transformant was initially restreaked for growth. In this example, since the resultant fusion protein is highly expressed (enolase) and the FPs are bright, we were able to screen transformants by fluorescence microscopy prior to performing diagnostic PCR (Figure 3)6.
<p class="jove_conte...

Watch this Scientific Journal Video about Generation of Fluorescent Protein Fusions in Candida Species at JoVE.com

Generation of Fluorescent Protein Fusions in Candida Species

PCR-mediated gene modification can be used to generate fluorescent protein fusions in Candida species, which facilitates visualization and quantitation of yeast cells and proteins. Herein, we present a strategy for constructing a fluorescent protein fusion (Eno1-FP) in Candida parapsilosis.

Generation of Fluorescent Protein Fusions in Candida Species

Candida species, prevalent colonizers of the intestinal and genitourinary tracts, are the cause of the majority of invasive fungal infections in humans. ...

generation-of-fluorescent-protein-fusions-in-candida-species

Research

JoVE Journal

Genetics

10.6K Views.  University of Minnesota. PCR-mediated gene modification can be used to generate fluorescent protein fusions in Candida species, which facilitates visualization and quantitation of yeast cells and proteins. Herein, we present a strategy for constructing a fluorescent protein fusion (Eno1-FP) in Candida parapsilosis.

Video: Generation of Fluorescent Protein Fusions in Candida Species

High Resolution Fluorescent In Situ Hybridization in Drosophila Embryos and Tissues Using Tyramide Signal Amplification

In our efforts to determine the patterns of expression and subcellular localization of Drosophila RNAs on a genome-wide basis, and in a variety of tissues, we have developed numerous modifications and improvements to our original fluorescent in situ hybridization (FISH) protocol. To facilitate throughput and cost effectiveness, all steps, from probe generation to signal detection, are performed using exon 96-well microtiter plates. Digoxygenin (DIG)-labelled antisense RNA probes are produced using either cDNA clones or genomic DNA as templates. After tissue fixation and permeabilization, probes are hybridized to transcripts of interest and then detected using a succession of anti-DIG antibody conjugated to biotin, streptavidin conjugated to horseradish peroxidase (HRP) and fluorescently conjugated tyramide, which in the presence of HRP, produces a highly reactive intermediate that binds to electron dense regions of immediately adjacent proteins. These amplification and localization steps produce a robust and highly localized signal that facilitates both cellular and subcellular transcript localization. The protocols provided have been optimized to produce highly specific signals in a variety of tissues and developmental stages. References are also provided for additional variations that allow the simultaneous detection of multiple transcripts, or transcripts and proteins, at the same time.

High Resolution Fluorescent In Situ Hybridization in Drosophila Embryos and Tissues Using Tyramide Signal Amplification

The described RNA in situ hybridization protocol allows the detection of RNA in whole Drosophila embryos or dissected tissues. Using 96-well microtiter plates and tyramide signal amplification, transcripts can be detected at high resolution, sensitivity, and throughput, and at a relatively low cost.

In our efforts to determine the patterns of expression and subcellular localization of Drosophila RNAs on a genome-wide basis, and in a variety of ...

Targeted Next-generation Sequencing and Bioinformatics Pipeline to Evaluate Genetic Determinants of Constitutional Disease

Next-generation sequencing (NGS) is quickly revolutionizing how research into the genetic determinants of constitutional disease is performed. The technique is highly efficient with millions of sequencing reads being produced in a short time span and at relatively low cost. Specifically, targeted NGS is able to focus investigations to genomic regions of particular interest based on the disease of study. Not only does this further reduce costs and increase the speed of the process, but it lessens the computational burden that often accompanies NGS. Although targeted NGS is restricted to certain regions of the genome, preventing identification of potential novel loci of interest, it can be an excellent technique when faced with a phenotypically and genetically heterogeneous disease, for which there are previously known genetic associations. Because of the complex nature of the sequencing technique, it is important to closely adhere to protocols and methodologies in order to achieve sequencing reads of high coverage and quality. Further, once sequencing reads are obtained, a sophisticated bioinformatics workflow is utilized to accurately map reads to a reference genome, to call variants, and to ensure the variants pass quality metrics. Variants must also be annotated and curated based on their clinical significance, which can be standardized by applying the American College of Medical Genetics and Genomics Pathogenicity Guidelines. The methods presented herein will display the steps involved in generating and analyzing NGS data from a targeted sequencing panel, using the ONDRISeq neurodegenerative disease panel as a model, to identify variants that may be of clinical significance.

Targeted next-generation sequencing is a time- and cost-efficient approach that is becoming increasingly popular in both disease research and clinical diagnostics. The protocol described here presents the complex workflow required for sequencing and the bioinformatics process used to identify genetic variants that contribute to disease.

Next-generation sequencing (NGS) is quickly revolutionizing how research into the genetic determinants of constitutional disease is performed. The ...

CRISPR-mediated Genome Editing of the Human Fungal Pathogen Candida albicans

This method describes the efficient CRISPR mediated genome editing of the diploid human fungal pathogen Candida albicans. CRISPR-mediated genome editing in C. albicans requires Cas9, guide RNA, and repair template. A plasmid expressing a yeast codon optimized Cas9 (CaCas9) has been generated. Guide sequences directly upstream from a PAM site (NGG) are cloned into the Cas9 expression vector. A repair template is then made by primer extension in vitro. Cotransformation of the repair template and vector into C. albicans leads to genome editing. Depending on the repair template used, the investigator can introduce nucleotide changes, insertions, or deletions. As C. albicans is a diploid, mutations are made in both alleles of a gene, provided that the A and B alleles do not harbor SNPs that interfere with guide targeting or repair template incorporation. Multimember gene families can be edited in parallel if suitable conserved sequences exist in all family members. The C. albicans CRISPR system described is flanked by FRT sites and encodes flippase. Upon induction of flippase, the antibiotic marker (CaCas9) and guide RNA are removed from the genome. This allows the investigator to perform subsequent edits to the genome. C. albicans CRISPR is a powerful fungal genetic engineering tool, and minor alterations to the described protocols permit the modification of other fungal species including C. glabrata, N. castellii, and S. cerevisiae.

CRISPR-mediated Genome Editing of the Human Fungal Pathogen Candida albicans

Efficient genome engineering of Candida albicans is critical to understanding the pathogenesis and development of therapeutics. Here, we described a protocol to quickly and accurately edit the C. albicans genome using CRISPR. The protocol allows investigators to introduce a wide variety of genetic modifications including point mutations, insertions, and deletions.

This method describes the efficient CRISPR mediated genome editing of the diploid human fungal pathogen Candida albicans. CRISPR-mediated genome editing ...

Use of Single Molecule Fluorescent In Situ Hybridization (SM-FISH) to Quantify and Localize mRNAs in Murine Oocytes

Current methods routinely used to quantify mRNA in oocytes and embryos include digital reverse-transcription polymerase chain reaction (dPCR), quantitative, real-time RT-PCR (RT-qPCR) and RNA sequencing. When these techniques are performed using a single oocyte or embryo, low-copy mRNAs are not reliably detected. To overcome this problem, oocytes or embryos can be pooled together for analysis; however, this often leads to high variability amongst samples. In this protocol, we describe the use of fluorescence in situ hybridization (FISH) using branched DNA chemistry. This technique identifies the spatial pattern of mRNAs in individual cells. When the technique is coupled with Spot Finding and Tracking&#160;computer software, the abundance of mRNAs in the cell can also be quantified. Using this technique, there is reduced variability within an experimental group and fewer oocytes and embryos are required to detect significant differences between experimental groups. Commercially available branched-DNA SM-FISH kits have been optimized to detect mRNAs in sectioned tissues or adherent cells on slides. However, oocytes do not effectively adhere to slides and some reagents in the kit were too harsh resulting in oocyte lysis. To prevent this lysis, several modifications were made to the FISH kit. Specifically, oocyte permeabilization and wash&#160;buffers designed for the immunofluorescence of oocytes and embryos replaced the proprietary buffers. The permeabilization, washes, and incubations with probes and amplifier were performed in 6-well plates and oocytes were placed on slides at the end of the protocol using mounting media. These modifications were able to overcome the limitations of the commercially available kit, in particular, the oocyte lysis. To accurately and reproducibly count the number of mRNAs in individual oocytes, computer software was used. Together, this protocol represents an alternative to PCR and sequencing to compare the expression of specific transcripts in single cells.

Use of Single Molecule Fluorescent In Situ Hybridization SM-FISH to Quantify and Localize mRNAs in Murine Oocytes

To reproducibly count the numbers of mRNAs in individual oocytes, single molecule RNA fluorescence in situ hybridization (RNA-FISH) was optimized for non-adherent cells. Oocytes were collected, hybridized with the transcript specific probes, and quantified using an image quantification software.

Current methods routinely used to quantify mRNA in oocytes and embryos include digital reverse-transcription polymerase chain reaction (dPCR), ...

Mass Spectrometry-Based Proteomics Analyses Using the OpenProt Database to Unveil Novel Proteins Translated from Non-Canonical Open Reading Frames

Genome annotation is central to today's proteomic research as it draws the outlines of the proteomic landscape. Traditional models of open reading frame (ORF) annotation impose two arbitrary criteria: a minimum length of 100 codons and a single ORF per transcript. However, a growing number of studies report expression of proteins from allegedly non-coding regions, challenging the accuracy of current genome annotations. These novel proteins were found encoded either within non-coding RNAs, 5' or 3' untranslated regions (UTRs) of mRNAs, or overlapping a known coding sequence (CDS) in an alternative ORF. OpenProt is the first database that enforces a polycistronic model for eukaryotic genomes, allowing annotation of multiple ORFs per transcript. OpenProt is freely accessible and offers custom downloads of protein sequences across 10 species. Using OpenProt database for proteomic experiments enables novel proteins discovery and highlights the polycistronic nature of eukaryotic genes. The size of OpenProt database (all predicted proteins) is substantial and need be taken in account for the analysis. However, with appropriate false discovery rate (FDR) settings or the use of a restricted OpenProt database, users will gain a more realistic view of the proteomic landscape. Overall, OpenProt is a freely available tool that will foster proteomic discoveries.

OpenProt is a freely accessible database that enforces a polycistronic model of eukaryotic genomes. Here, we present a protocol for the use of OpenProt databases when interrogating mass spectrometry datasets. Using OpenProt database for analysis of proteomic experiments allows for discovery of novel and previously undetectable proteins.

Genome annotation is central to today's proteomic research as it draws the outlines of the proteomic landscape. Traditional models of open reading frame ...

A Bioinformatics Pipeline to Accurately and Efficiently Analyze the MicroRNA Transcriptomes in Plants

MicroRNAs (miRNAs) are 20- to 24-nucleotide (nt) endogenous small RNAs (sRNAs) extensively existing in plants and animals that play potent roles in regulating gene expression at the post-transcriptional level. Sequencing sRNA libraries by Next Generation Sequencing (NGS) methods has been widely employed to identify and analyze miRNA transcriptomes in the last decade, resulting in a rapid increase of miRNA discovery. However, two major challenges arise in plant miRNA annotation due to increasing depth of sequenced sRNA libraries as well as the size and complexity of plant genomes. First, many other types of sRNAs, in particular, short interfering RNAs (siRNAs) from sRNA libraries, are erroneously annotated as miRNAs by many computational tools. Second, it becomes an extremely time-consuming process for analyzing miRNA transcriptomes in plant species with large and complex genomes. To overcome these challenges, we recently upgraded miRDeep-P (a popular tool for miRNA transcriptome analyses) to miRDeep-P2 (miRDP2 for short) by employing a new filtering strategy, overhauling the scoring algorithm and incorporating newly updated plant miRNA annotation criteria. We tested miRDP2 against sequenced sRNA populations in five representative plants with increasing genomic complexity, including Arabidopsis, rice, tomato, maize and wheat. The results indicate that miRDP2 processed these tasks with very high efficiency. In addition, miRDP2 outperformed other prediction tools regarding sensitivity and accuracy. Taken together, our results demonstrate miRDP2 as a fast and accurate tool for analyzing plant miRNA transcriptomes, therefore a useful tool in helping the community better annotate miRNAs in plants.

A bioinformatics pipeline, namely miRDeep-P2 (miRDP2 for short), with updated plant miRNA criteria and an overhauled algorithm, could accurately and efficiently analyze microRNA transcriptomes in plants, especially for species with complex and large genomes.

MicroRNAs (miRNAs) are 20- to 24-nucleotide (nt) endogenous small RNAs (sRNAs) extensively existing in plants and animals that play potent roles in ...

Genetic Mapping of Thermotolerance Differences Between Species of Saccharomyces Yeast via Genome-Wide Reciprocal Hemizygosity Analysis

A central goal of modern genetics is to understand how and why organisms in the wild differ in phenotype. To date, the field has advanced largely on the strength of linkage and association mapping methods, which trace the relationship between DNA sequence variants and phenotype across recombinant progeny from matings between individuals of a species. These approaches, although powerful, are not well suited to trait differences between reproductively isolated species. Here we describe a new method for genome-wide dissection of natural trait variation that can be readily applied to incompatible species. Our strategy, RH-seq, is a genome-wide implementation of the reciprocal hemizygote test. We harnessed it to identify the genes responsible for the striking high temperature growth of the yeast Saccharomyces cerevisiae relative to its sister species S. paradoxus. RH-seq utilizes transposon mutagenesis to create a pool of reciprocal hemizygotes, which are then tracked through a high-temperature competition via high-throughput sequencing. Our RH-seq workflow as laid out here provides a rigorous, unbiased way to dissect ancient, complex traits in the budding yeast clade, with the caveat that resource-intensive deep sequencing is needed to ensure genomic coverage for genetic mapping. As sequencing costs drop, this approach holds great promise for future use across eukaryotes.

Genetic Mapping of Thermotolerance Differences Between Species of Saccharomyces Yeast via Genome-Wide Reciprocal Hemizygosity Analysis

Reciprocal hemizygosity via sequencing (RH-seq) is a powerful new method to map the genetic basis of a trait difference between species. Pools of hemizygotes are generated by transposon mutagenesis and their fitness is tracked through competitive growth using high-throughout sequencing. Analysis of the resulting data pinpoints genes underlying the trait.

A central goal of modern genetics is to understand how and why organisms in the wild differ in phenotype. To date, the field has advanced largely on the ...

Generation of Defined Genomic Modifications Using CRISPR-CAS9 in Human Pluripotent Stem Cells

Human pluripotent stem cells offer a powerful system to study gene function and model specific mutations relevant to disease. The generation of precise heterozygous genetic modifications is challenging due to CRISPR-CAS9 mediated indel formation in the second allele. Here, we demonstrate a protocol to help overcome this difficulty by using two repair templates in which only one expresses the desired sequence change, while both templates contain silent mutations to prevent re-cutting and indel formation. This methodology is most advantageous for gene editing coding regions of DNA to generate isogenic control and mutant human stem cell lines for studying human disease and biology. In addition, optimization of transfection and screening methodologies have been performed to reduce labor and cost of a gene editing experiment. Overall, this protocol is widely applicable to many genome editing projects utilizing the human pluripotent stem cell model.

This protocol provides a method to facilitate the generation of defined heterozygous or homozygous nucleotide changes using CRISPR-CAS9 in human pluripotent stem cells.

Human pluripotent stem cells offer a powerful system to study gene function and model specific mutations relevant to disease. The generation of precise ...

Dissection of Drosophila melanogaster Flight Muscles for Omics Approaches

Drosophila flight muscle is a powerful model to study diverse processes such as transcriptional regulation, alternative splicing, metabolism, and mechanobiology, which all influence muscle development and myofibrillogenesis. Omics data, such as those generated by mass spectrometry or deep sequencing, can provide important mechanistic insights into these biological processes. For such approaches, it is beneficial to analyze tissue-specific samples to increase both selectivity and specificity of the omics fingerprints. Here we present a protocol for dissection of fluorescent-labeled flight muscle from live pupae to generate highly enriched muscle samples for omics applications. We first describe how to dissect flight muscles at early pupal stages (&#60;48 h after puparium formation [APF]), when the muscles are discernable by green fluorescent protein (GFP) labeling. We then describe how to dissect muscles from late pupae (&#62;48 h APF) or adults, when muscles are distinguishable under a dissecting microscope. The accompanying video protocol will make these technically demanding dissections more widely accessible to the muscle and Drosophila research communities. For RNA applications, we assay the quantity and quality of RNA that can be isolated at different time points and with different approaches. We further show that Bruno1 (Bru1) is necessary for a temporal shift in myosin heavy chain (Mhc) splicing, demonstrating that dissected muscles can be used for mRNA-Seq, mass spectrometry, and reverse transcription polymerase chain reaction (RT-PCR) applications. This dissection protocol will help promote tissue-specific omics analyses and can be generally applied to study multiple biological aspects of myogenesis.

Dissection of Drosophila melanogaster Flight Muscles for Omics Approaches

Drosophila flight muscle is a powerful model to study transcriptional regulation, alternative splicing, metabolism, and mechanobiology. We present a protocol for dissection of fluorescent-labeled flight muscle from live pupae to generate highly enriched samples ideal for proteomics and deep-sequencing. These samples can offer important mechanistic insights into diverse aspects of muscle development.

Drosophila flight muscle is a powerful model to study diverse processes such as transcriptional regulation, alternative splicing, metabolism, and ...

Application of CRISPR Interference (CRISPRi) for Gene Silencing in Pathogenic Species of Leptospira

Leptospirosis is a global neglected zoonosis, responsible for at least 1 million cases per year and almost 60 thousand deaths. The disease is caused by pathogenic and virulent bacteria of the genus Leptospira, either by direct contact with the bacteria or indirectly by exposure to contaminated water or soil. Domestic and wild animals act as reservoir hosts of infection, shedding leptospires from colonized renal tubules of the kidney, via urine, into the environment. The generation of mutant strains of Leptospira is critical to evaluate and understand pathogenic mechanisms of infection. CRISPR interference (CRISPRi) has proven to be a straightforward, affordable, and specific tool for gene silencing in pathogenic Leptospira. Therefore, the methodological details of obtaining the plasmid constructs containing both dCas9 and guide RNA, delivery of plasmids to Leptospira by conjugation with the E. coli strain &#946;2163, and transconjugant recovery and evaluation, will be described. In addition, the recently described Hornsby-Alt-Nally (HAN) media allows for the relatively rapid isolation and selection of mutant colonies on agar plates.

Application of CRISPR Interference CRISPRi for Gene Silencing in Pathogenic Species of Leptospira

Here, the application of CRISPR interference (CRISPRi) for specific gene silencing in Leptospira species is described. Leptospira cells are transformed by conjugation with plasmids expressing dCas9 (catalytically "dead" Cas9) and a single-guide RNA (sgRNA), responsible for base pairing to the desired genomic target. Methods to validate gene silencing are presented.

Leptospirosis is a global neglected zoonosis, responsible for at least 1 million cases per year and almost 60 thousand deaths. The disease is caused by ...