우리는 원래 mCherry FP 순서를 제공 N. 딘 감사, M. Gerami-Nejad 플라스미드의 건설이 프로젝트의 개발 기간 동안 도움이되는 조언을 기술 지원 B. 라슨, 그리고 T. Heisel. JB는 유럽 연구위원회 고급 상 340087 (RAPLODAPT)에 의해 지원되었다. 현미경 및 이미징 시스템은 미네소타 소아 과학 재단의 대학과 미네소타 이미징 센터의 대학에 의해 제공되었다.

대장균 1. 격리 템플릿 플라스미드 <ol><li> 진탕 37 ° C에서 10 ml의 원성 국물 (LB) + 200 ㎎ / ℓ의 암피실린 (AMP)에서 하룻밤 템플릿 플라스미드를 포함하는 대장균 성장. </li><li> 2 분 동안 6,000 XG에 원심 분리하여 수확 세포. </li><li> 액체를 가만히 따르다 분리 및 문헌 [Ausubel 등 이전에 설명 된대로 E. 표준 방법에 의해 세포를 대장균에서 DNA를 정화. 8. </li><li> 50 ~ 100 ng를 / ㎖의 작업 농도, 트리스 - EDTA (10 mM 트리스, 산도 8.0, 1 mM의 EDTA, pH가 8.0 TE)에 재현 탁의 DNA. </li></ol> 2. 디자인 프라이머 <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td fo:width="0.5in" style="width:50px"> 뇌관 </td><td> 프라이머 시퀀스 </td></tr><tr><td> F1 </td><td> 5 &#39; <strong&gt; GAGAATTGAAGAAGAGTTGGGAGACAATGCTATCTATGCTGGTAAGGACTTCCACAATGCTCAAACTTTG GGTGGTTCTAAAGGTGAAGAATTATT 3 &#39; </td></tr><tr><td> R1 </td><td> 5 &#39;GAGCGTTTGCACCAACAGGCCATCATTTGTGACGAGAGAAGACCTGACGTCATTAGATTGGCACCTTTGC GTAAAACGACGGCCAGTGAATTC 3 &#39; </td></tr><tr><td> F2 </td><td> 5 &#39;GAGAATTGAAGAAGAGTTGGGAGACAATGCTATCTATGCTGGTAAGGACTTCCACAATGCTCAAACTTTG GGTGGTGTTTCAAAAGGTGAAGAAGATAAT 3 &#39; </td></tr><tr><td> R2 </td><td> 5 &#39;GAGCGTTTGCACCAACAGGCCATCATTTGTGACGAGAGAAGACCTGACGTCATTAGATTGGCACCTTTGC ACTGGATGGCGGCGTTAGTATC 3 &#39; </td></tr></tbody></table> 표 1 : 본 연구에 사용 된 프라이머 서열. 굵은 이탤릭체 텍스트가 ENO1 게놈 유전자좌에 상 동성을 나타내고, 정상 폰트 영역 DNA 플라스미드 상동이다. <ol> &lt;리&gt; 설계 프라이머 카세트 경계 서열이 유전자의 게놈 유전자좌로 재결합을 용이하게하기 위해 관심있는 표적 유전자 (예 ENO1)의 3&#39;- 말단뿐만 아니라 증폭하는 플라스미드 상동 될 (도 2 및 표 1) . <ol><li> 정방향 프라이머 서열은 지난 70 염기쌍 관심 유전자 (BP), 5&#39;-3 &#39;을 뺀 종결 코돈과 일치하는 부호화 프레임을 유지하기 위해, 플러스 플라스미드 서열의 처음 약 30 염기쌍이되고 있는지 확인 증폭. 참고로, 각 프라이머의 GGTGGTGGTT없이 FP 상 동성을 가진 폴리 글리신 링커입니다. 참고로, 링커가없는 경우에, 이론적으로 단백질 미스 폴딩 단백질 생산 수율이 낮거나 손상된 생체 활성을 초래할 수 기능적 도메인을 직접 융합있을 수있다. </li><li> 역방향 프라이머 서열이 유전자의 70 bp의 하류 있는지 확인 3&#39;- 5 &#39;, 어떤 유전자 서열, 플러스 마지막 아프로을 포함하지 않는ximately 플라스미드에서 사용되는 영양 또는 약물 내성 마커의 30 염기쌍. </li><li> 사용 F1과 R1은 pMG2343와 mCherry- NAT1를 생성하는 pMG2120 및 pMG2263, 각각 및 F2와 R2와 GFP- NAT1 및 YFP- NAT1 카세트를 생성합니다. </li></ol></li></ol> 3. PCR에 의해 FP 카세트를 생성 (1 일) <ol><li> PCR 용 시약을 준비합니다. 1.5 ㎖의 튜브에 다음의 양과 농도를 첨가하여 마스터 믹스 (500 ㎕의 최종 부피) 확인 : 50 ㎕의 PCR 완충액 (500 mM의 염화칼륨, 물 100 mM 트리스 pH를 8.0) 20 μL의 데 옥시 뉴클레오티드 (dNTPs를 단계; 스톡 혼합물 10 mM의 각), 40 ㎕의 25 mM의 염화 마그네슘에서 뉴클레오티드의 20 μL는) 10 μl를 앞으로 각각 10 mM의 스톡 솔루션에서 프라이머 (역방향), 30 ㎕의 DNA 형성 촉매를 ~ 50 ~ 100 NG / μL 원액에서 플라스미드 (정제 중합 효소 (일반, 5,000 단위 / ㎖) 320 ㎕를 물. <ol><li> 10 PCR-compatib 각각에 마스터 믹스의 분취 액 50 μL제작 : 0.5 ml의 튜브. </li></ol></li><li> 다음 단계를 열 순환기에 PCR 튜브를 놓고 실행 : 1주기 분 (5)의 94 ° C에서 dsDNA를 변성; 94 ° C에서 45 초 40주기를 순차적으로, 55 ° C에서 30 초 프라이머 플라스미드 템플릿 DNA에 어닐링 할 수 있도록하고, DNA 제품의 확장을위한 68 ° C에서 4 분하는 단계; 72 ° C에서 15 분의 1 최종 확장 사이클. 참고 : PCR 마스터 믹스와 자전거 매개 변수가 사용되는 특정 Taq 중합 효소에 따라 수정해야 할 수도 있습니다. </li><li> 풀 1.5 ML 튜브에서 10 PCR 반응에서 모든 제품. <ol><li> 아가 로스 겔 전기 풀링 된 PCR 산물의 제목 5 μL은 DNA 사다리 비교에 기초하여, 앰플 리콘의 크기를 확인하고 제품 농도의 추정치를 얻었다. 일반적으로, 각각의 후속 변환 믹스에 카세트 DNA의 ~ 250 μg의를 사용합니다. </li><li> 제품을 750 ㎕의 95 % 에탄올에 이어 50 ㎕의 3 M 아세트산 나트륨을 첨가하여 DNA를 침전 적어도 30 분 부화-20 ℃에서 </li><li> 10 분 동안 16,000 XG에서 튜브를 원심 분리하여 PCR 산물 수확. 조심스럽게 제거하고 상층 액을 버리고 밤새 펠렛을 건조. 40 ㎕의 TE의 pH 8.0에서 건조 DNA 카세트 펠렛을 재현 탁하고 사용할 때까지 실온에서 저장합니다. </li></ol></li></ol> 4. FP DNA 카세트와 칸디다 셀 변환 <ol><li> 1 일에, 효모 균주를 복구하는 아데닌 (YPAD) 한천과 효모 펩톤 덱 스트로스 상에 약간의 긁힌 결정을 질주하고 30 ° C에서 부화하여 (-80 ° C) 주식 냉동 15 % 글리세롤에서 변환 할 수 있습니다. 콜로니의 성장을 회수 한 후, 통기성 캡 유리 배양 관에 2 ㎖의 액체 YPAD 매체에 단일 콜로니를 접종하고 교반하면서 30 ℃에서 밤새 배양한다. </li><li> 제 2 일에, 통기성 캡 125 ㎖의 삼각 플라스크에 50 ㎖에 (최종 OD 600 ~ 0.2) 신선한 YPAD 밤새 효모 배양 300 μl를 희석. 30 ° C에서 흔들어(최종 OD ~ 0.6-0.8 600) ~ 3 시간 동안. <ol><li> 50 ML 원뿔 튜브에 하룻밤 문화를 붓고 테이블 위에 원심 분리기 1 500 XG에서 5 분 동안 회전시켜 세포 펠렛. </li><li> 붓고 제대로 상층 액을 버린다. 5 ㎖의 물에서 세포 펠렛을 재현 탁. 테이블 탑 원심 분리기에서 1,500 XG에서 5 분간 다시 원심 분리하여 세포를 다시하는 것은-펠렛. </li><li> 붓고 제대로 상층 액을 버린다. 1.5 ㎖의 튜브에 전송하는 동안 500 μL TELiAc (10 mM 트리스, pH가 8.0, 1 mM의 EDTA, pH가 8.0, 0.1 M 아세트산 리튬 TE 리튬 아세테이트)에 세포를 재현 탁. 미세 원심에서 3,000 XG에서 2 분 동안 튜브를 원심 분리기. </li><li> 250 μL TELiAc에 재현 탁 세포. 펠렛을 포함하여 총 부피는 ~ 300 ㎕를해야한다. </li></ol></li><li> 클린 (4.2.4에서 다른 미세 원심 분리 튜브)에 5 μL 캐리어 DNA (10 ㎎ / ㎖)과 (4.2.4)에서 제조 된 칸디다 세포 150 μl를 추가합니다. 이 t에 대한 부정적인 컨트롤입니다ransformation. <ol><li> 제 깨끗한 미세 원심 분리 관에 변성 캐리어 DNA의 5 μL (즉, 10 분간 90 ℃에서 비등하고 4 ℃로 냉각되었다) (3.3.1)에서 준비된 PCR 산물의 모든 40 μL, 150을 추가 (4.2.4)에서 제조 칸디다 셀 μL. </li><li> 실온에서 30 분 동안 두 변환 믹스 부화. </li><li> 각 변환 믹스 튜브에 700 μL PLATE 믹스 (10 mM 트리스, pH가 8.0, 1 mM의 EDTA, pH가 8.0, 50 % 폴리에틸렌 글리콜 3350 0.1 M 리튬 아세테이트)를 추가한다. 혼합 RT에서 하룻밤을 배양하기 위해 튜브를 반전. </li></ol></li><li> 3 일에, 변환 1 시간 동안 42 ° C (열 충격)에서 혼합 배양한다. <ol><li> 원심 분리기 변환은 마이크로 원심에서 16,000 XG에 30 초 동안 혼합합니다. 제거하고 제대로 상층 액을 버린다. 세포를 손상시키지 않도록하기 위해서 아래로 부드럽게 피펫 팅하여 150 ㎕의 물에서 세포 펠렛을 각각 재현 탁하고. </li><li> 변환의 유타에 대한영양 요 구성 마커 유전자 (예를 들어 URA3)을 ilizing 적절한 선택 배지에 한천 용액을 피펫 팅 (예를 들어 결여 딘)에 의해 각 전 혼합 접시에 균일하게 멸균 유리 비드를 사용하여 혼합물을 분산. </li><li> 여기에 설명 된 바와 같이 nourseothricin 저항 마커 유전자 (NAT1)를 이용한 변환의 경우, 변환 판은 비 선택적 YPAD 한천 상에 제 혼합물 및 6-12 시간 동안 30 ℃에서 배양한다. 스트레스를 nourseothricin 전에 세포 복구, 후 열 충격이 단계 에이즈가 적용된다. </li><li> 부분적인 성장 복구 후 YPAD 상에 복제 판 칸디다 세포는 400 μg의가 / ㎖ nourseothricin 포함. 영양 마커 유전자 (예를 들어 URA3)를 이용한 변환의 경우,이 중간 도금 단계가 필요하지 않은 세포를 직접적 4.4.2에 기술 된 바와 같이 선택적 효모 매체 (예 YPAD 결여 딘) 상에 도금 될 수있다. 주 : 변환이 성공적이면, COLonies은 1 ~ 3 일 내에 표시 (잠재적 nourseothricin 함유 한천에 선택에 대한 파생물 5 일까지)한다. 어떤 식민지 단독 (대조군)을 캐리어 DNA를 포함하는 변환 믹스와 확산 판에 표시되지 않아야합니다. </li></ol></li><li> 영양 요 구성 및 nourseothricin 마커 선택, 신선한 선택적 매체 한천 플레이트에 하나의 식민지로 행진 추정 형질 전환 및 들어 FP 융합의 성공적인 건설을위한 검사를 할 수 있습니다 효모 세포를 전파하기 위해 30 ° C에서 품어. </li><li> 화면 형질 전환 체는 태그 카세트의 올바른 통합 (자세한 예를 들어 대표 결과를 참조). 관심의 유전자를 충분한 양으로 발현되는 경우, 콜로니 전체의 형광은 형광 검출 능력 판 촬상 시스템을 이용하여 잠재적 인 후보 통합 체를 검출 할 수 있도록 발생할 수있다. <ol><li> PCR은 outsid 시퀀스 프라이머 동성을 사용하여 추정 통합 체를 확인통합의 영역의 전자는 표적 유전자에 융합을 확인한다. </li><li> 또한, 웨스턴 융합 단백질의 발현 및 크기를 결정하기 위해 오점 분석뿐만 아니라 알려진 경우 단백질 지역화 시각적 확인을 위해 단 전지의 형광 현미경을 고려한다. </li></ol></li></ol>

<ol>
	<li>Bendel, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colonization+and+epithelial+adhesion+in+the+pathogenesis+of+neonatal+candidiasis.">Colonization and epithelial adhesion in the pathogenesis of neonatal candidiasis.</a> Semin. Perinatol. 27 (5), 357-364 (2003).</li><li>Gerami-Nejad, M., Berman, J., Gale, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cassettes+for+PCR-mediated+construction+of+green,+yellow,+and+cyan+fluorescent+protein+fusions+in+Candida+albicans.">Cassettes for PCR-mediated construction of green, yellow, and cyan fluorescent protein fusions in Candida albicans.</a> Yeast. 18 (9), 859-864 (2001).</li><li>Gerami-Nejad, M., Dulmage, K., Berman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Additional+cassettes+for+epitope+and+fluorescent+fusion+proteins+in+Candida+albicans.">Additional cassettes for epitope and fluorescent fusion proteins in Candida albicans.</a> Yeast. 26 (7), 399-406 (2009).</li><li>Gerami-Nejad, M., Forche, A., McClellan, M., Berman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+protein+function+in+clinical+C.+albicans+isolates.">Analysis of protein function in clinical C. albicans isolates.</a> Yeast. 29 (8), 303-309 (2012).</li><li>Gerami-Nejad, M., Hausauer, D., McClellan, M., Berman, J., Gale, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cassettes+for+the+PCR-mediated+construction+of+regulatable+alleles+in+Candida+albicans.">Cassettes for the PCR-mediated construction of regulatable alleles in Candida albicans.</a> Yeast. 21 (5), 429-436 (2004).</li><li>Gonia, S., Larson, B., Gale, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR-mediated+gene+modification+strategy+for+construction+of+fluorescent+protein+fusions+in+Candida+parapsilosis.">PCR-mediated gene modification strategy for construction of fluorescent protein fusions in Candida parapsilosis.</a> Yeast. 33 (2), 63-69 (2016).</li><li>Milne, S. W., Cheetham, J., Lloyd, D., Aves, S., Bates, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cassettes+for+PCR-+mediated+gene+tagging+in+Candida+albicans+utilizing+nourseothricin+resistance.">Cassettes for PCR- mediated gene tagging in Candida albicans utilizing nourseothricin resistance.</a> Yeast. 28 (12), 833-841 (2011).</li><li>Ausubel, F. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Current Protocols in Molecular Biology. , (1995).</li><li>Wilson, R. B., Davis, D., Mitchell, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+hypothesis+testing+with+Candida+albicans+through+gene+disruption+with+short+homology+regions.">Rapid hypothesis testing with Candida albicans through gene disruption with short homology regions.</a> J. Bacteriol. 181 (6), 1868-1874 (1999).</li><li>Pulver, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rsr1+focuses+Cdc42+activity+at+hyphal+tips+and+promotes+maintenance+of+hyphal+development+in+Candida+albicans.">Rsr1 focuses Cdc42 activity at hyphal tips and promotes maintenance of hyphal development in Candida albicans.</a> Eukaryotic Cell. 12 (4), 482-495 (2013).</li><li>Falgier, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Candida+species+differ+in+their+interactions+with+immature+human+gastrointestinal+epithelial+cells.">Candida species differ in their interactions with immature human gastrointestinal epithelial cells.</a> Pediatr. Res. 69 (5), 384-389 (2011).</li><li>Nosek, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+manipulation+of+the+pathogenic+yeast+Candida+parapsilosis.">Genetic manipulation of the pathogenic yeast Candida parapsilosis.</a> Curr. Genet. 42 (1), 27-35 (2002).</li><li>Zemanova, J., Nosek, J., Tomaska, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-efficiency+transformation+of+the+pathogenic+yeast+Candida+parapsilosis.">High-efficiency transformation of the pathogenic yeast Candida parapsilosis.</a> Curr. Genet. 45 (3), 183-186 (2004).</li><li>Benjamin, D. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neonatal+candidiasis+among+extremely+low+birth+weight+infants:+risk+factors,+mortality+rates,+and+neurodevelopmental+outcomes+at+18+to+22+months.">Neonatal candidiasis among extremely low birth weight infants: risk factors, mortality rates, and neurodevelopmental outcomes at 18 to 22 months.</a> Pediatrics. 117 (1), 84-92 (2006).</li><li>Kullberg, B. J., Arendrup, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Invasive+Candidiasis.">Invasive Candidiasis.</a> N Engl J Med. 373 (15), 1445-1456 (2015).</li></ol>

저자는 공개 아무것도 없어.

에피토프의 구조는 상술 한 PCR 매개 유전자 변형 전략을 사용하는 칸디다 종의 서열은 세 단계로 요약 될 수있다 태그. 먼저, 카세트 모두 효모 게놈 내로 삽입 궤적 상동 통합 영역에 대해 원하는 서열을 코딩하는 PCR에 의해 이루어진다. 둘째로, 변환 될 수있는 효모 세포 리튬 아세테이트 카세트가 공동 인큐베이션 화학적 능력 만들어진다. 셋째, 세포 형질 전환 체를 복구하는 선택 배지 ?...

칸디다 종은 모든 인간의 장 및 비뇨 생식기 책자를 식민지 공생 균이다. 그러한 즉 조산 또는 암 치료에서 면역 억제 효과 발생과 같은 면역 결핍의 조건에서, 칸디다 종은 기회 병원균이 될 수 있습니다. 칸디다 종, 칸디다 알비 칸스 (Candida albicans)가 가장 널리 진균 식민이며 침습성 진균 감염의 대부분을 야기한다. 이러한 C. 글라 브라, C.의 실로 시스, C.의 tropicalis 및 C와 같은 다른 칸디다 종, 일부 나타내는 고유 저항, 면역 저하 환자에서 심각한 감염을 일으킬 kruseii 일반적 따라서 이러한 플루코나졸과 암포 테리 신 B와 항진균 항생제를 사용하는 이 종의 일부와 감염은 특히 항 곰팡이 제와 예방 치료를 받고있는 환자에서 더 자주 관찰되고있다. 심지어 적절하고 적시에NTI 곰팡이 처리, 침략 칸디다 감염은 상당한 이환율과 사망률 1과 연관 될 것을 계속한다. 이 때문에 인체의 칸디다 종의 중요성, 그 병인 기전 연구 및 해명 있도록 쉽게 구할 분자 도구에 대한 요구가있다. 연구진은 시각화하고 미생물 세포와 그들이 표현하는 단백질을 정량화 할 수 있습니다 하나의 중요한 도구는 FP 융합 기술입니다. 중합 효소 연쇄 반응 (PCR) - 매개 유전자 변형이 논문에 기재된 바와 같이, FP 서열 및 게놈 유전자좌 관심 서열을 코딩 칸디다 단백질 간의 융합의 구성을 허용한다. 구조물의 안정적 통합은 단백질 발현의 분석뿐만 아니라 단백질 현지화 역학을 용이하게한다. FP 서열을 함유하는 플라스미드는, 칸디다 알비 칸스의 발현을 최적화하고는 PCR 매개 g 사용될 수있다엔 변형 전략은 이전에 2, 3, 4, 5를 구성 하였다. C. 알비 칸스 및 C. 실로 시스 2, 3, 4, 5, 6, 7의 변환을 용이하게하는 영양 마커 유전자에 연결된 FP 서열 플라스미드 FP 변환 &quot;카세트&quot;을 포함한다. 현재 사용 가능한 플라스미드를 선택 영양 영양 요 구성 균주의 변환을위한 마커 유전자 (URA3, HIS1, ARG4)뿐만 아니라 auxotrophies이 결여 된 임상 균주의 변환을 용이하게하는 지배적 인 약물 내성 마커 (NAT1)의 다양한 포함되어 있습니다. 또한, 플라스미드 여보 쇼 최대 네 개의 다른 FP 시퀀스 (녹색 [GFP]에 대한 옵션을 포함[YFP] w, 시안 [CFP], 체리 [mCherry]) 및 카르복시 말단 단백질 융합의 건설, 또는 아미노 말단 단백질 융합의 건설을위한 프로모터 서열에 대한 ADH1 종결 서열 중 하나. 프라이머는 FP 카세트를 둘러싼 플라스미드 DNA에 동성으로 설계되었습니다. 또한, 프라이머는 상동 재조합 (그림 1)를 통해 게놈 궤적에 카세트의 통합을 용이하게 태그 할 관심있는 효모 유전자에 상 동성을 베어링 5&#39;-확장 시퀀스가 포함되어 있습니다. 유전자 특이 FP 카세트를 PCR에 의해 생성 된 리튬 아세테이트로 처리하여 DNA의 흡수를위한 제작 능력 칸디다 세포로 형질 전환된다. <img alt="그림 1" src="/files/ftp_upload/55333/55333fig1.jpg" /> 그림 1 : FP 시퀀스 융합은 칸디다 종에서 생성하는 방법의 다이어그램. (A) 플라스미드 DNA를 포함하여에스 FP 순서 및 저항 (NAT1) nourseothricin 시퀀스 인코딩. 앞으로 (FWD) 및 역방향 (REV) 프라이머의 상대 위치는 플라스미드 서열 상 동성의 영역을 나타내는 프라이머 및 유전자 고유 동성 영역 또는 프라이머 확장을 나타내는 보라색 부분의 검은 부분으로 표시됩니다. (B) FP 카세트는 칸디다로 변환 및 상동 재조합 (점선)를 통해 ENO1 게놈 궤적 내에 통합되어있다. ENO1의 말단에 FP 융합 시퀀스를 생성 (C). <a href="http://ecsource.jove.com/files/ftp_upload/55333/55333fig1large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a> 여기서, 우리는 칸디다 단백질 융합 (Eno1-FP) 구조의 일례를 제시한다. 우리는 GFP, YFP를 코딩하는 서열과 함께 NAT1 변환 마커 유전자를 포함하는 플라스미드에 태그 또는 사용mCherry (그림 2). 이러한 플라스미드의 카르복시 말단에 융합 FPS Eno1 발현 결과 ENO1의 3&#39;- 말단에 FPS의 융합을 촉진 유전자 특이 카세트를 생성하기 위해 PCR에서 프라이머와 함께 사용된다. <img alt="그림 2" src="/files/ftp_upload/55333/55333fig2.jpg" /> 그림 2 : FP 카세트 함유 플라스미드의지도. 앞으로 (F) 및 플라스미드에서 카세트를 생성하는 데 사용 역 (R) 프라이머는 플라스미드에 자신의 동성의 상대 위치와 함께 표시됩니다. 표 1에 열거 된 프라이머 서열이다. F1과 R1은 또한 pYFP- NAT1 카세트를 생성 하였다. YFP- NAT1 카세트 (pMG2263)를 함유하는 플라스미드 GFP 서열 대신 YFP 제외한 pMG2120 동일하다. 카세트 크기 : GFP-NAT1, 3.7 KBP; mCherry- NAT1, 3.2 KBP; YFP- NAT1, 3.7 KBP. 이 그림은 Gerami-Nejad, 등에서 수정되었습니다. 4 <a href="http://ecsource.jove.com/files/ftp_upload/55333/55333fig2large.jpg" target="_blank">이 그림의 더 큰 버전을 보려면 여기를 클릭하십시오.</a>

<table><tbody><tr><td>100 W mercury lamp</td><td>CHIU Technical Corporation</td><td>M-100T</td><td></td></tr><tr><td>95% Ethanol</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Adenine</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Ampicillin</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Carrier DNA</td><td>Ambion</td><td>AM9680</td><td>Sheared Salmon Sperm DNA 10 mg/ml</td></tr><tr><td>CCD Camera</td><td>Photometrics</td><td>CoolSNAP HQ</td><td></td></tr><tr><td>Conical Tube</td><td>Corning</td><td>430828</td><td>50 ml</td></tr><tr><td>Culture Tube Rotator</td><td>New Brunswick</td><td>2013923</td><td>TC-8, or Any Culture Tube Rotator</td></tr><tr><td>Deoxynucleotides (dNTP) PCR Grade</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Eppendorf Tubes</td><td>Eppendorf</td><td>022363719, 022363212</td><td>0.5 ml, 1.5 ml</td></tr><tr><td>Erlenmeyer Flask</td><td>Fisher Scientific</td><td>7250089</td><td>125 ml</td></tr><tr><td>Ethylenediaminetetraacetic Acid (EDTA)</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Freezer (-80 &amp;deg;C)</td><td>Thermo Electron Corporation</td><td>ULT-1386-9-V</td><td>Revco Ultima II</td></tr><tr><td>GFP, YFP and Texas Red Filter Sets</td><td>Chroma Technology Corporation</td><td>49002, 86004v2, 49008</td><td></td></tr><tr><td>Glass culture tubes</td><td>Fisher Scientific</td><td>1496126</td><td>75 mm</td></tr><tr><td>HRP goat anti-mouse antibody</td><td>Santa Cruz Biotechnology</td><td>SC-2005</td><td></td></tr><tr><td>HRP goat anti-rabbit antibody</td><td>Santa Cruz Biotechnology</td><td>SC-2301</td><td></td></tr><tr><td>Incubator (30 &amp;deg;C)</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Lithium Acetate</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Lysogeny Broth (LB) Media</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Magnesium Chloride</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Microcentrifuge</td><td>Eppendorf</td><td>5415 D</td><td></td></tr><tr><td>Microscope</td><td>Nikon</td><td>E600</td><td>Nikon Eclipse E600</td></tr><tr><td>Microscope Image Analysis Software</td><td>Universal Imaging Corporation</td><td>6.3r7</td><td>MetaMorph Software Series 6.3r7</td></tr><tr><td>Mouse anti-GFP antibody</td><td>Roche</td><td>11814460001</td><td></td></tr><tr><td>Nourseothricin</td><td>Fisher Scientific</td><td>50997939</td><td></td></tr><tr><td>PCR Thermocycler</td><td>Applied Biosystems</td><td>9700</td><td>GeneAmp PCR System</td></tr><tr><td>PCR tubes</td><td>BioExpress, GeneMate</td><td>T-3035-1</td><td>0.2 ml</td></tr><tr><td>Polyethylene Glycol 3350</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Potassium Chloride</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Rabbit anti-mCherry antibody</td><td>BioVision</td><td>5993-100</td><td></td></tr><tr><td>Refrigerator (4 &amp;deg;C)</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Sodium Acetate</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Stereomicroscope</td><td>Nikon</td><td>SMZ1500</td><td></td></tr><tr><td>Table Top Centrifuge</td><td>Labnet</td><td>Z 400</td><td>Hermle Z 400</td></tr><tr><td>&lt;em&gt;Taq&lt;/em&gt; DNA Polymerase</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Tris(hydroxymethyl)aminomethane (Tris)</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Vortex Mixer</td><td>Scientific Industries</td><td>SI-0236</td><td>Vortex Genie 2</td></tr><tr><td>Yeast Extract Peptone Dextrose (YPD) Media</td><td>Any</td><td>NA</td><td></td></tr></tbody></table>

generation of fluorescent protein fusions in candida species

칸디다 종, 장 및 비뇨 생식기 책자의 유행 식민지 개척자는, 인간의 침습성 진균 감염의 대부분의 원인이다. 따라서, 분자 유전 도구들은 발병 메커니즘에 대한 연구를 촉진하기 위해 필요하다. PCR 매개 유전자 변형은 검출을 용이하게하기 위해 에피토프 태그 된 단백질을 생성하는 간단하고 빠른 방법이다. 특히, 형광 단백질 (FP) 융합은 각각 형광 현미경 및 면역에 의해 모두 효모 세포와 단백질의 시각화 및 정량 분석을 할 수있는 강력한 도구입니다. 칸디다 종의 형질 전환을 용이하게 영양 마커 유전자와 함께 FP 인코딩 서열을 포함하는 플라스미드, 칸디다 FP의 구축 및 발현을 목적으로 생성되었다. 여기서, 우리는 칸디다 종의 FP 융합을 구성하기위한 전략을 제시한다. nourseothricin resista를 포함하는 플라스미드어느 녹색, 황색, 또는 체리 FPS (GFP, YFP, mCherry)는 폴리머 라제 연쇄 반응 (PCR)의 유전자 - 특이 서열을 포함하는 프라이머와 함께 사용되는 FP 카세트를 생성하기위한 서열과 함께 NCE 변환 마커 유전자 (NAT1) . 이 유전자 특이 카세트를 상동 재조합을 통해 대응 유전자좌의 3&#39;- 말단에 통합 할 수있는 능력을 갖는다. 관심의 유전자 유전자좌에 FP 서열의 성공적인 프레임 내 융합 현미경 및 / 또는 면역 검출 방법에 의한 융합 단백질의 발현을 분석 한 후, 유전자가 확인되어있다. 또한, 고도로 발현 된 단백질의 경우에 성공적인 융합체 형광 이미징 기술에 의해 주로 대해 스크리닝 할 수있다.

예를 들어, 우리는 C. 실로 시스 실험실 균주에 Eno1하는 GFP 및 mCherry 융합을 구성하기 위해 위에서 설명한 프로토콜을 사용했다. 각각의 추정 형질 전환 초기 성장 restreaked했다. 생성 된 융합 단백질이 높은 (에 놀라 제)를 표현하고, FPS 밝은 때문에이 예에서, 우리는 (도 3) 종래의 진단 PCR 수행을 형광 현미경에 의해 형질 전환 체를 선별 할 수 있었다 <sup ...

Watch this Scientific Journal Video about Generation of Fluorescent Protein Fusions in Candida Species at JoVE.com

Generation of Fluorescent Protein Fusions in Candida Species

PCR 매개 유전자 변형은 시각화 및 효모 세포 및 단백질의 정량을 용이 칸디다 종의 형광 단백질 융합체를 생성하기 위해 사용될 수있다. 여기서, 우리는 칸디다에서 형광 단백질 융합 (Eno1-FP)을 구축하기위한 전략을 제시한다.

에 형광 단백질 융합의 시대<em&gt; 칸디다</em&gt; 종

Candida species, prevalent colonizers of the intestinal and genitourinary tracts, are the cause of the majority of invasive fungal infections in humans. ...

generation-of-fluorescent-protein-fusions-in-candida-species

Research

JoVE Journal

Genetics

Generation of Fluorescent Protein Fusions in Candida Species

10.6K 조회수.  University of Minnesota.  PCR 매개 유전자 변형은 시각화 및 효모 세포 및 단백질의 정량을 용이 칸디다 종의 형광 단백질 융합체를 생성하기 위해 사용될 수있다. 여기서, 우리는 칸디다에서 형광 단백질 융합 (Eno1-FP)을 구축하기위한 전략을 제시한다. 

비디오: Generation of Fluorescent Protein Fusions in Candida Species

The C. elegans Excretory Canal as a Model for Intracellular Lumen Morphogenesis and In Vivo Polarized Membrane Biogenesis in a Single Cell: labeling by GFP-fusions, RNAi Interaction Screen and Imaging

The four C. elegans excretory canals are narrow tubes extended through the length of the animal from a single cell, with almost equally far extended intracellular endotubes that build and stabilize the lumen with a membrane and submembraneous cytoskeleton of apical character. The excretory cell expands its length approximately 2,000 times to generate these canals, making this model unique for the in vivo assessment of de novo polarized membrane biogenesis, intracellular lumen morphogenesis and unicellular tubulogenesis. The protocol presented here shows how to combine standard labeling, gain- and loss-of-function genetic or RNA interference (RNAi)-, and microscopic approaches to use this model to visually dissect and functionally analyze these processes on a molecular level. As an example of a labeling approach, the protocol outlines the generation of transgenic animals with fluorescent fusion proteins for live analysis of tubulogenesis. As an example of a genetic approach, it highlights key points of a visual RNAi-based interaction screen designed to modify a gain-of-function cystic canal phenotype. The specific methods described are how to: label and visualize the canals by expressing fluorescent proteins; construct a targeted RNAi library and strategize RNAi screening for the molecular analysis of canal morphogenesis; visually assess modifications of canal phenotypes; score them by dissecting fluorescence microscopy; characterize subcellular canal components at higher resolution by confocal microscopy; and quantify visual parameters. The approach is useful for the investigator who is interested in taking advantage of the C. elegans excretory canal for identifying and characterizing genes involved in the phylogenetically conserved processes of intracellular lumen and unicellular tube morphogenesis.

The C. elegans Excretory Canal as a Model for Intracellular Lumen Morphogenesis and In Vivo Polarized Membrane Biogenesis in a Single Cell: labeling by GFP-fusions, RNAi Interaction Screen and Imaging

The C. elegans excretory canal is a unique single-cell model for the visual in vivo analysis of de novo polarized membrane biogenesis. This protocol describes a combination of standard genetic/RNAi and imaging approaches, adaptable for the identification and characterization of molecules directing unicellular tubulogenesis, and apical membrane and lumen biogenesis.

세포내 루멘 Morphogenesis 그리고 Vivo에서 편광 막 속 단일 셀에 대 한 모델로 선 충 C. Excretory 운하: GFP 융해, RNAi 상호 작용 화면 및 이미징 라벨

The four C. elegans excretory canals are narrow tubes extended through the length of the animal from a single cell, with almost equally far extended ...

연구

발생학

Biolistic Transformation of a Fluorescent Tagged Gene into the Opportunistic Fungal Pathogen Cryptococcus neoformans

The basidiomycete Cryptococcus neoformans, an invasive opportunistic pathogen of the central nervous system, is the most frequent cause of fungal meningitis worldwide resulting in more than 625,000 deaths per year worldwide.&#160;Although electroporation has been developed for the transformation of plasmids in Cryptococcus, only&#160;biolistic&#160;delivery provides&#160;an effective means to transform&#160;linear&#160;DNA&#160;that can be integrated into the genome by homologous recombination.&#160;
Acetate has been shown to be a major fermentation product during cryptococcal infection, but the significance of this is not yet known.&#160;A bacterial pathway composed of the enzymes xylulose-5-phosphate/fructose-6-phosphate phosphoketolase (Xfp) and acetate kinase (Ack) is one of three potential pathways for acetate production in C. neoformans. Here, we demonstrate the biolistic transformation of a construct, which has the gene encoding Ack fused to the fluorescent tag mCherry, into&#160;C. neoformans. We then confirm integration of the ACK-mCherry fusion into the&#160;ACK&#160;locus.

Biolistic Transformation of a Fluorescent Tagged Gene into the Opportunistic Fungal Pathogen Cryptococcus neoformans

Biolistic transformation is a method used to generate stable integration of DNA into the genome of the opportunistic pathogen Cryptococcus neoformans through homologous recombination. We will demonstrate biolistic transformation of a construct, which has the gene encoding acetate kinase fused to the fluorescent tag mCherry into&#160;C. neoformans.

편의적 곰팡이 병원균에 형광 태그 유전자의과 유전자 변형<em&gt; 크립토 콕 쿠스 네오 포르</em

The basidiomycete Cryptococcus neoformans, an invasive opportunistic pathogen of the central nervous system, is the most frequent cause of fungal ...

면역학 및 감염병학

Visualizing Yeast Organelles with Fluorescent Protein Markers

The budding yeast, Saccharomyces cerevisiae, is a classic model system in studying organelle function and dynamics. In our previous works, we have constructed fluorescent protein-based markers for major organelles and endomembrane structures, including the nucleus, endoplasmic reticulum (ER), Golgi apparatus, endosomes, vacuoles, mitochondria, peroxisomes, lipid droplets, and autophagosomes. The protocol presented here describes the procedures for using these markers in yeast, including DNA preparation for yeast transformation, selection and evaluation of transformants, fluorescent microscopic observation, and the expected outcomes. The text is geared toward researchers who are entering the field of yeast organelle study from other backgrounds. Essential steps are covered, as well as technical notes about microscope hardware considerations and several common pitfalls. It provides a starting point for people to observe yeast subcellular entities by live-cell fluorescent microscopy. These tools and methods can be used to identify protein subcellular localization and track organelles of interest in time-lapse imaging.

<meta charset="utf8"></head><body>Visualizing Yeast Organelles with Fluorescent Protein Markers

Here we describe the use of a set of fluorescent protein-based organelle markers in live-cell imaging of the budding yeast, Saccharomyces cerevisiae.

The budding yeast, Saccharomyces cerevisiae, is a classic model system in studying organelle function and dynamics. In our previous works, we have ...

생화학

In vivo Quantification of G Protein Coupled Receptor Interactions using Spectrally Resolved Two-photon Microscopy

The study of protein interactions in living cells is an important area of research because the information accumulated both benefits industrial applications as well as increases basic fundamental biological knowledge. F&ouml;rster (Fluorescence) Resonance Energy Transfer (FRET) between a donor molecule in an electronically excited state and a nearby acceptor molecule has been frequently utilized for studies of protein-protein interactions in living cells. The proteins of interest are tagged with two different types of fluorescent probes and expressed in biological cells. The fluorescent probes are then excited, typically using laser light, and the spectral properties of the fluorescence emission emanating from the fluorescent probes is collected and analyzed. Information regarding the degree of the protein interactions is embedded in the spectral emission data. Typically, the cell must be scanned a number of times in order to accumulate enough spectral information to accurately quantify the extent of the protein interactions for each region of interest within the cell. However, the molecular composition of these regions may change during the course of the acquisition process, limiting the spatial determination of the quantitative values of the apparent FRET efficiencies to an average over entire cells. By means of a spectrally resolved two-photon microscope, we are able to obtain a full set of spectrally resolved images after only one complete excitation scan of the sample of interest. From this pixel-level spectral data, a map of FRET efficiencies throughout the cell is calculated. By applying a simple theory of FRET in oligomeric complexes to the experimentally obtained distribution of FRET efficiencies throughout the cell, a single spectrally resolved scan reveals stoichiometric and structural information about the oligomer complex under study. Here we describe the procedure of preparing biological cells (the yeast Saccharomyces cerevisiae) expressing membrane receptors (sterile 2 &alpha;-factor receptors) tagged with two different types of fluorescent probes. Furthermore, we illustrate critical factors involved in collecting fluorescence data using the spectrally resolved two-photon microscopy imaging system. The use of this protocol may be extended to study any type of protein which can be expressed in a living cell with a fluorescent marker attached to it.

In vivo Quantification of G Protein Coupled Receptor Interactions using Spectrally Resolved Two-photon Microscopy

By employing a spectrally resolved two-photon microscopy imaging system, pixel-level maps of F&ouml;rster Resonance Energy Transfer (FRET) efficiencies are obtained for cells expressing membrane receptors hypothesized to form homo-oligomeric complexes. From the FRET efficiency maps, we are able to estimate stoichiometric information about the oligomer complex under study.

Spectrally 해결된 두 광자 현미경을 사용하여 G 단백질 결합 수용체 상호 작용의 생체내 부량에서

The study of protein interactions in living cells is an important area of research because the information accumulated both benefits industrial ...

생물학

Quantitative Live Cell Fluorescence-microscopy Analysis of Fission Yeast

Several microscopy techniques are available today that can detect a specific protein within the cell. During the last decade live cell imaging using fluorochromes like Green Fluorescent Protein (GFP) directly attached to the protein of interest has become increasingly popular 1. Using GFP and similar fluorochromes the subcellular localisations and movements of proteins can be detected in a fluorescent microscope. Moreover, also the subnuclear localisation of a certain region of a chromosome can be studied using this technique. GFP is fused to the Lac Repressor protein (LacR) and ectopically expressed in the cell where tandem repeats of the lacO sequence has been inserted into the region of interest on the chromosome2. The LacR-GFP will bind to the lacO repeats and that area of the genome will be visible as a green dot in the fluorescence microscope. Yeast is especially suited for this type of manipulation since homologous recombination is very efficient and thereby enables targeted integration of the lacO repeats and engineered fusion proteins with GFP 3. Here we describe a quantitative method for live cell analysis of fission yeast. Additional protocols for live cell analysis of fission yeast can be found, for example on how to make a movie of the meiotic chromosomal behaviour 4. In this particular experiment we focus on subnuclear organisation and how it is affected during gene induction. We have labelled a gene cluster, named Chr1, by the introduction of lacO binding sites in the vicinity of the genes. The gene cluster is enriched for genes that are induced early during nitrogen starvation of fission yeast 5. In the strain the nuclear membrane (NM) is labelled by the attachment of mCherry to the NM protein Cut11 giving rise to a red fluorescent signal. The Spindle Pole body (SPB) compound Sid4 is fused to Red Fluorescent Protein (Sid4-mRFP) 6. In vegetatively growing yeast cells the centromeres are always attached to the SPB that is embedded in the NM 7. The SPB is identified as a large round structure in the NM. By imaging before and 20 minutes after depletion of the nitrogen source we can determine the distance between the gene cluster (GFP) and the NM/SPB. The mean or median distances before and after nitrogen depletion are compared and we can thus quantify whether or not there is a shift in subcellular localisation of the gene cluster after nitrogen depletion.

The fission yeast, Schizosaccharomyces pombe, is a good model system to study basic cellular processes. Here we describe a method to perform quantitative live cell analysis of fission yeast. In this particular experiment we focus on organisation of the genome within the cell nucleus, but the method can also be used to study cytosolic factors.

분열 효모의 양적 라이브 세포 형광 - 현미경 분석

Several microscopy techniques are available today that can detect a specific protein within the cell. During the last decade live cell imaging using ...

Use of In Vivo Imaging to Screen for Morphogenesis Phenotypes in Candida albicans Mutant Strains During Active Infection in a Mammalian Host

Candida albicans is an important human pathogen. Its ability to switch between morphologic forms is central to&#160;its pathogenesis; these morphologic changes are regulated by a complex signaling network controlled in response to environmental stimuli. These regulatory components have been highly studied, but almost all studies use a variety of in vitro stimuli to trigger filamentation. To determine how morphogenesis is regulated during the pathogenesis process, we developed an in vivo microscopy system to obtain high spatial resolution images of organisms undergoing hyphal formation within the mammalian host. The protocol presented here describes the use of this system to screen small collections of C. albicans mutant strains, allowing us to identify key regulators of morphogenesis as it occurs at the site of infection. Representative results are presented, demonstrating that some regulators of morphogenesis, such as the transcriptional regulator Efg1, have consistent phenotypes in vitro and in vivo, whereas other regulators, such as adenyl cyclase (Cyr1), have significantly different phenotypes in vivo compared to in vitro.

Use of In Vivo Imaging to Screen for Morphogenesis Phenotypes in Candida albicans Mutant Strains During Active Infection in a Mammalian Host

This manuscript describes a method for screening moderately sized Candida albicans mutant libraries for morphogenesis phenotypes during active infection in a mammalian host using non-invasive confocal microscopy.

포유류 숙주에서 활성 감염 중 칸디다 알비칸스 돌연변이 균주에서 형태형성 표현형을 스크리닝하기 위한 생체 내 이미징 사용

Candida albicans is an important human pathogen. Its ability to switch between morphologic forms is central to&#160;its pathogenesis; these morphologic ...

칸디다 알비칸스 관련 카테터 관련 감염에 대한 마우스 모델 확립

A Catheter-Related Candida albicans Infection Model in Mouse

Catheter-related infection (CRI) is a common nosocomial infection caused by candida albicans during catheter implantation. Typically, biofilms are formed on the outer surface of the catheter and lead to disseminated infections, which are fatal to patients. There are no effective prevention and treatment management in clinics. Therefore, it is urgent to establish an animal model of CRI for the preclinical screening of new strategies for its prevention and treatment. In this study, a polyethylene catheter, a widely used medical catheter, was inserted into the back of the BALB/c mice after hair removal. Candida albicans ATCC MYA-2876 (SC5314) expressing enhanced green fluorescent protein was subsequently inoculated on the skin's surface along the catheter. Intense fluorescence was observed on the surface of the catheter under a fluorescent microscope 3 days later. Mature and thick biofilms were found on the surface of the catheter via scanning electron microscopy. These results indicated the adhesion, colonization, and biofilm formation of candida albicans on the surface of the catheter. The hyperplasia of the epidermis and the infiltration of inflammatory cells in the skin specimens indicated the histopathological changes of the CRI-associated skin. To sum up, a mouse CRI model was successfully established. This model is expected to be helpful in the research and development of therapeutic management for candida albicans associated CRI.

저자 스포트라이트: Enhancing Candida albicans Detection in Catheter Infections Using Fluorescent Protein Tagging(형광 단백질 태깅을 사용하여 카테터 감염에서 칸디다 알비칸스 검출 향상) 

We establish a mouse model of C.albicans-associated catheter-related infection (CRI), in which biofilm forms on the catheter, and the interaction between C.albicans and host correlates well with the clinical CRI. This model helps screen therapies for C.albicans biofilm-associated CRI, laying a foundation for clinical transformation.

마우스의 카테터 관련 칸디다 알비칸스 감염 모델

Catheter-related infection (CRI) is a common nosocomial infection caused by candida albicans during catheter implantation. Typically, biofilms are formed ...

에 형광 단백질 융합의 시대

요약

더 많은 비디오 탐색

이 비디오의 챕터

세포내 루멘 Morphogenesis 그리고 Vivo에서 편광 막 속 단일 셀에 대 한 모델로 선 충 C. Excretory 운하: GFP 융해, RNAi 상호 작용 화면 및 이미징 라벨

편의적 곰팡이 병원균에 형광 태그 유전자의과 유전자 변형

Visualizing Yeast Organelles with Fluorescent Protein Markers

Visualizing Yeast Organelles with Fluorescent Protein Markers

Spectrally 해결된 두 광자 현미경을 사용하여 G 단백질 결합 수용체 상호 작용의 생체내 부량에서

분열 효모의 양적 라이브 세포 형광 - 현미경 분석

포유류 숙주에서 활성 감염 중 칸디다 알비칸스 돌연변이 균주에서 형태형성 표현형을 스크리닝하기 위한 생체 내 이미징 사용

마우스의 카테터 관련 칸디다 알비칸스 감염 모델

마우스의 카테터 관련 칸디다 알비칸스 감염 모델

마우스의 카테터 관련 칸디다 알비칸스 감염 모델