Agradecemos N. Dean para fornecer a sequência mCherry FP original, M. Gerami-Nejad para a construção de plasmídeos, B. Larson para a assistência técnica, e T. Heisel para o conselho útil durante o desenvolvimento deste projeto. JB foi apoiado pelo Prémio Europeu Conselho de Pesquisa Avançada 340.087 (RAPLODAPT). sistemas de microscopia e de imagem foram fornecidos pela Universidade de Minnesota Pediatria Foundation e da Universidade de Minnesota Imaging Center.

1. Modelo Isolar os plasmídeos a partir de E. coli <ol><li> Crescer E. coli contendo o plasmídeo molde durante a noite em 10 ml de caldo de lisogenia (LB) com 200 mg / L de ampicilina (AMP), a 37 ° C com agitação. </li><li> Células colheita por centrifugação a 6000 xg durante 2 min. </li><li> Decantar líquido, isolar e purificar DNA a partir de células de E. coli por um método padrão tal como previamente descrito em Ausubel et al. 8. </li><li> ADN Ressuspender em Tris-EDTA (TE; Tris 10 mM, pH 8,0, EDTA 1 mM, pH 8,0) a uma concentração de trabalho de 50-100 ng / ml. </li></ol> 2. Projeto Primers <table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always"><tbody><tr><td fo:width="0.5in" style="width:50px"> cartilha </td><td> sequência iniciadora </td></tr><tr><td> F1 </td><td> 5 &#39; <strong&gt; GAGAATTGAAGAAGAGTTGGGAGACAATGCTATCTATGCTGGTAAGGACTTCCACAATGCTCAAACTTTG GGTGGTTCTAAAGGTGAAGAATTATT 3 &#39; </td></tr><tr><td> R1 </td><td> 5 &#39;GAGCGTTTGCACCAACAGGCCATCATTTGTGACGAGAGAAGACCTGACGTCATTAGATTGGCACCTTTGC GTAAAACGACGGCCAGTGAATTC 3 &#39; </td></tr><tr><td> F2 </td><td> 5 &#39;GAGAATTGAAGAAGAGTTGGGAGACAATGCTATCTATGCTGGTAAGGACTTCCACAATGCTCAAACTTTG GGTGGTGTTTCAAAAGGTGAAGAAGATAAT 3 &#39; </td></tr><tr><td> R2 </td><td> 5 &#39;GAGCGTTTGCACCAACAGGCCATCATTTGTGACGAGAGAAGACCTGACGTCATTAGATTGGCACCTTTGC ACTGGATGGCGGCGTTAGTATC 3 &#39; </td></tr></tbody></table> Tabela 1: As sequências dos iniciadores utilizados neste estudo. Texto em itálico a negrito indica homologia com o locus genómico ENO1, as regiões de fonte normais são homólogas ao plasmídeo de ADN. <ol> &lt;li&gt; conceber iniciadores para ser homólogo ao plasmídeo sequências limítrofes da cassete a ser amplificado, bem como para a extremidade 3 &#39;do gene alvo de interesse (por exemplo, ENO1) para facilitar a recombinação em local genómico do gene (Figura 2 e Tabela 1) . <ol><li> Assegure-se que as sequências de iniciador de sentido directo corresponder aos últimos 70 pares de bases (pb) do gene de interesse, 5&#39;-3 &#39;, menos o codão de paragem, para manter a grelha de codificação, além do primeiro, aproximadamente 30 pb da sequência de plasmídeo a ser amplificado. Como uma nota, o GGTGGTGGTT em cada iniciador é um ligante de poli-glicina com nenhuma homologia de FP. É de notar, na ausência de um agente de ligação, pode haver fusão directa de domínios funcionais, o que pode teoricamente conduzir a enrolamento incorrecto da proteína, baixo rendimento na produção de proteínas, ou bioactividade prejudicada. </li><li> Certifique-se que as sequências de primer reverso são 70 bp a jusante do gene, 3&#39;-5 &#39;, não incluindo qualquer sequência do gene, mais a última approdamente 30 pb do marcador nutricional ou resistência a drogas usadas no plasmídeo. </li><li> Uso F1 e R1 a gerar cassetes GFP NAT1 e YFP- NAT1 com pMG2120 e pMG2263, respectivamente e F2 e R2 para gerar mCherry- NAT1 com pMG2343. </li></ol></li></ol> 3. Gerar FP Cassetes por PCR (Dia 1) <ol><li> Prepare os reagentes para a PCR. Adicione uma mistura principal (500 volume final ul), adicionando os seguintes volumes e concentrações para um tubo de 1,5 ml: 50 ul de tampão de PCR (cloreto de potássio 500 mM, Tris 100 mM, pH 8,0 em água), desoxinucleótidos 20 ul (dNTPs; mistura estoque de nucleótidos em 10 mM de cada), cloreto de magnésio 40 ul de 25 mM, 20 ul do plasmídeo (~ 50-100 ng de solução de estoque / ul purificada), 10 ul de cada iniciador directo e (a partir de soluções de estoque 10 mM reverso), 30 ul de Taq polimerase (genérico, 5.000 unidades / ml), e 320 ul de água. <ol><li> Alíquota de 50 ul da mistura principal em cada um dos 10-PCR compatible 0,5 ml de tubos. </li></ol></li><li> Colocar os tubos de PCR no termociclador e executar os passos seguintes: 1 ciclo de 5 minutos a 94 ° C para desnaturar ADNcd; 40 ciclos de 45 s sequencialmente a 94 ° C, 30 seg a 55 ° C para permitir que os iniciadores para hibridar com o ADN molde de plasmídeo, e 4 min a 68 ° C para extensão de produtos de ADN; e um ciclo de extensão final de 15 min a 72 ° C. NOTA: A PCR Master Mix e ciclismo parâmetros podem precisar de ser modificado com base na polimerase Taq particular usado. </li><li> Piscina todos os produtos das reações 10 de PCR em um tubo de 1,5 ml. <ol><li> Sujeito 5 ul de produtos de PCR reunidos para electroforese em gel de agarose para verificar a dimensão do amplicon e obter uma estimativa da concentração do produto, com base em comparação com uma escada de ADN. Geralmente, utilizar ~ 250 ug de ADN em cada cassete de mistura de transformação subsequente. </li><li> Precipitar o DNA por adição de acetato de 50 ul de sódio 3M seguida por 750 ul de etanol a 95% para os produtos e incubar pelo menos 30 mina -20 ° C. </li><li> Colher os produtos de PCR por centrifugação do tubo a 16.000 xg durante 10 min. Remova cuidadosamente e elimine o sobrenadante e secar o sedimento durante a noite. Ressuspender o sedimento cassete de ADN secou-se em 40 ul de TE, pH 8,0 e armazenar a temperatura ambiente até à sua utilização. </li></ol></li></ol> 4. transformar células de Candida com FP DNA Cassetes <ol><li> No Dia 1, recuperar estirpe de levedura a ser transformada a partir de uma glicerol 15% congelado (-80 ° C) da riscando algumas cristais raspados Onto dextrose de levedura peptona de agar com adenina (YPAD) e incubar a 30 ° C. Após a recuperação do crescimento de colónias, inocular uma única colónia em 2 ml de meio YPAD líquido num tubo de cultura de vidro com uma tampa respirável e incubar durante a noite a 30 ° C com agitação. </li><li> No Dia 2, dilui-se a 300 ul de cultura de levedura durante a noite em 50 ml YPAD fresco (para uma DO final de 600 ~ 0,2) num balão de Erlenmeyer de 125 ml com uma tampa respirável. Agitar a 30 ° Cpara ~ 3 horas (a um OD final de 600 ~ 0,6-0,8). <ol><li> Verter a cultura durante a noite num tubo cónico de 50 ml e sedimentar as células por centrifugação durante 5 min a 1 500 xg numa centrifugadora de bancada. </li><li> Deitar fora e descartar adequadamente o sobrenadante. Ressuspender o sedimento de células em 5 ml de água. Re-sedimentar as células por centrifugação novamente durante 5 min a 1500 xg numa centrifugadora de bancada. </li><li> Deitar fora e descartar adequadamente o sobrenadante. Ressuspender as células em 500 ul TELiAc (acetato de lítio TE: Tris 10 mM, pH 8,0, EDTA 1 mM, pH 8,0, acetato de lítio 0,1 M) durante a transferência para um tubo de 1,5 ml. Centrifugar o tubo durante 2 min a 3000 x g numa microcentrífuga. </li><li> Ressuspender as células em 250 ul TELiAc. O volume total, incluindo o sedimento deve ser ~ 300 uL. </li></ol></li><li> Para um (tubo de microcentrífuga diferente do que em 4.2.4) limpo, adicionar 5 uL de ADN transportador (10 mg / ml) e 150 ul de células de Candida preparada (a partir de 4.2.4). Este é o controlo negativo para o transformation. <ol><li> Para um segundo tubo de microcentrífuga limpo, adicionam-se 5 ul de ADN de transporte (desnaturado que foi fervida a 90 ° C durante 10 min e arrefeceu-se para 4 ° C), todos os 40 ul do produto de PCR preparado (a partir de 3.3.1) e 150 ul de células de Candida preparado (a partir de 4.2.4). </li><li> Incubam-se as duas misturas de transformação durante 30 min à temperatura ambiente. </li><li> Para cada tubo de mistura de transformação, adicionar 700 ul de mistura placa (Tris 10 mM, pH 8,0, EDTA 1 mM, pH 8,0, acetato de lítio 0,1 M em 50% de polietileno glicol 3350). Inverta os tubos para misturar e incubar durante a noite à RT. </li></ol></li><li> No Dia 3, incubar a transformação mistura a 42 ° C durante 1 h (choque térmico). <ol><li> Centrifugar a transformação mistura durante 30 segundos a 16000 xg numa microcentrífuga. Retirar e descartar adequadamente o sobrenadante. Ressuspender cada um dos sedimentos celulares em 150 ul de água por suavemente pipetando para cima e para baixo de modo a não danificar as células. </li><li> Para transformações UTilizing genes marcadores auxotróf icos (por exemplo, URA3), cada placa totalidade da mistura pipetando as soluções para o meio de agar selectivo apropriado (por exemplo, uridina falta) e espalhar a mistura uniformemente com esferas de vidro estéreis. </li><li> Para transformações utilizando o gene marcador de resistência nourseothricin (NAT1), como descrito aqui, a transformação placa primeira mistura em agar YPAD não selectivo e incuba-se a 30 ° C durante 6-12 h. Este passo ajuda na recuperação das células, choque pós calor, antes nourseothricin estresse é aplicado. </li><li> Após a recuperação parcial de crescimento, placa replica as células de Candida Onto YPAD contendo 400 ug / ml nourseothricin. Para transformações utilizando genes marcadores nutricionais (por exemplo, URA3), este passo intermediário chapeamento não é necessária e as células podem ser directamente plaqueadas em meios selectivos de levedura (por exemplo, falta de uridina YPAD) tal como descrito em 4.4.2. NOTA: Se a transformação for bem sucedida, colonies deve aparecer dentro de um a três dias (potencialmente até cinco dias de crescimento para a seleção no agar contendo nourseothricin-). Há colônias devem aparecer em placas espalhadas com misturas de transformação contendo DNA transportador sozinho (controle negativo). </li></ol></li><li> Para a selecção do marcador auxotrófico e nourseothricin, raia transformantes putativos como colónias individuais para placas frescas de agar de meio selectivo e incuba-se a 30 ° C, para propagar as células de levedura que podem ser rastreados para a construção de fusões bem sucedidas FP. </li><li> Transformantes de tela para a integração correta da cassete de marcação (ver resultados representativos para um exemplo detalhado). Se o gene de interesse é expresso em quantidades suficientes, toda colónia de fluorescência pode ocorrer de tal modo que é possível detectar integrantes candidatos potenciais, utilizando um sistema de imagem da placa com capacidade de detecção de fluorescência. <ol><li> Verificar integrantes putativos por PCR utilizando iniciadores homólogos às sequências Outside da região de integração para confirmar a fusão do gene alvo. </li><li> Além disso, considerar a análise de transferência de Western para determinar a expressão e o tamanho da proteína de fusão, bem como por microscopia de fluorescência de células individuais para a confirmação visual da localização da proteína, se for conhecida. </li></ol></li></ol>

<ol>
	<li>Bendel, C. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colonization+and+epithelial+adhesion+in+the+pathogenesis+of+neonatal+candidiasis.">Colonization and epithelial adhesion in the pathogenesis of neonatal candidiasis.</a> Semin. Perinatol. 27 (5), 357-364 (2003).</li><li>Gerami-Nejad, M., Berman, J., Gale, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cassettes+for+PCR-mediated+construction+of+green,+yellow,+and+cyan+fluorescent+protein+fusions+in+Candida+albicans.">Cassettes for PCR-mediated construction of green, yellow, and cyan fluorescent protein fusions in Candida albicans.</a> Yeast. 18 (9), 859-864 (2001).</li><li>Gerami-Nejad, M., Dulmage, K., Berman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Additional+cassettes+for+epitope+and+fluorescent+fusion+proteins+in+Candida+albicans.">Additional cassettes for epitope and fluorescent fusion proteins in Candida albicans.</a> Yeast. 26 (7), 399-406 (2009).</li><li>Gerami-Nejad, M., Forche, A., McClellan, M., Berman, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+protein+function+in+clinical+C.+albicans+isolates.">Analysis of protein function in clinical C. albicans isolates.</a> Yeast. 29 (8), 303-309 (2012).</li><li>Gerami-Nejad, M., Hausauer, D., McClellan, M., Berman, J., Gale, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cassettes+for+the+PCR-mediated+construction+of+regulatable+alleles+in+Candida+albicans.">Cassettes for the PCR-mediated construction of regulatable alleles in Candida albicans.</a> Yeast. 21 (5), 429-436 (2004).</li><li>Gonia, S., Larson, B., Gale, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=PCR-mediated+gene+modification+strategy+for+construction+of+fluorescent+protein+fusions+in+Candida+parapsilosis.">PCR-mediated gene modification strategy for construction of fluorescent protein fusions in Candida parapsilosis.</a> Yeast. 33 (2), 63-69 (2016).</li><li>Milne, S. W., Cheetham, J., Lloyd, D., Aves, S., Bates, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cassettes+for+PCR-+mediated+gene+tagging+in+Candida+albicans+utilizing+nourseothricin+resistance.">Cassettes for PCR- mediated gene tagging in Candida albicans utilizing nourseothricin resistance.</a> Yeast. 28 (12), 833-841 (2011).</li><li>Ausubel, F. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Current Protocols in Molecular Biology. , (1995).</li><li>Wilson, R. B., Davis, D., Mitchell, A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rapid+hypothesis+testing+with+Candida+albicans+through+gene+disruption+with+short+homology+regions.">Rapid hypothesis testing with Candida albicans through gene disruption with short homology regions.</a> J. Bacteriol. 181 (6), 1868-1874 (1999).</li><li>Pulver, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Rsr1+focuses+Cdc42+activity+at+hyphal+tips+and+promotes+maintenance+of+hyphal+development+in+Candida+albicans.">Rsr1 focuses Cdc42 activity at hyphal tips and promotes maintenance of hyphal development in Candida albicans.</a> Eukaryotic Cell. 12 (4), 482-495 (2013).</li><li>Falgier, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Candida+species+differ+in+their+interactions+with+immature+human+gastrointestinal+epithelial+cells.">Candida species differ in their interactions with immature human gastrointestinal epithelial cells.</a> Pediatr. Res. 69 (5), 384-389 (2011).</li><li>Nosek, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+manipulation+of+the+pathogenic+yeast+Candida+parapsilosis.">Genetic manipulation of the pathogenic yeast Candida parapsilosis.</a> Curr. Genet. 42 (1), 27-35 (2002).</li><li>Zemanova, J., Nosek, J., Tomaska, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-efficiency+transformation+of+the+pathogenic+yeast+Candida+parapsilosis.">High-efficiency transformation of the pathogenic yeast Candida parapsilosis.</a> Curr. Genet. 45 (3), 183-186 (2004).</li><li>Benjamin, D. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Neonatal+candidiasis+among+extremely+low+birth+weight+infants:+risk+factors,+mortality+rates,+and+neurodevelopmental+outcomes+at+18+to+22+months.">Neonatal candidiasis among extremely low birth weight infants: risk factors, mortality rates, and neurodevelopmental outcomes at 18 to 22 months.</a> Pediatrics. 117 (1), 84-92 (2006).</li><li>Kullberg, B. J., Arendrup, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Invasive+Candidiasis.">Invasive Candidiasis.</a> N Engl J Med. 373 (15), 1445-1456 (2015).</li></ol>

Os autores não têm nada a revelar.

Construção de sequências de epitopo etiquetado em espécies de Candida, utilizando a estratégia de modificação de genes mediada por PCR acima descrito pode ser resumido como um processo em três etapas. Em primeiro lugar, a cassete é feita por PCR que codifica a sequência desejada, tanto por integração e regiões homólogas para o locus da inserção no genoma da levedura. Em segundo lugar, as células de levedura a ser transformadas são feitas quimicamente competente com acetato de lítio e co-incub...

Espécies de Candida são fungos comensais que colonizam as vias intestinais e genito-urinário de todos os seres humanos. Sob condições de imunodeficiência, tal como o que ocorre com o nascimento prematuro ou efeitos imunossupressores de tratamentos para o cancro, espécies de Cândida pode tornar-se agentes patogénicos oportunistas. Das espécies de Candida, Candida albicans é o colonizador fúngica mais prevalente e faz com que a maioria das infecções fúngicas invasivas. Outras espécies de Candida, como C. glabrata, C. parapsilosis, C. tropicalis e C. kruseii também causar infecções graves em pacientes imunocomprometidos, com algumas apresentando resistência intrínseca aos comumente utilizados antibióticos anti-fúngicas, como fluconazol e anfotericina B. Assim, infecções com algumas destas espécies estão sendo observados com maior frequência, especialmente em pacientes que estão sendo tratados profilaticamente com agentes anti-fúngicos. Mesmo com uma adequada e atempadatratamento nti-fúngica, infecções por Candida invasivos continuem a ser associado com uma morbidade e mortalidade significativas. Devido à importância de espécies de Candida em saúde humana, existe uma necessidade para ferramentas moleculares prontamente disponíveis que permitem o estudo e a elucidação dos seus mecanismos de patogénese. Uma importante ferramenta que permite que os pesquisadores para visualizar e quantificar células microbianas e as proteínas que eles expressam é a tecnologia de fusão FP. Reacção em cadeia da polimerase (PCR) do gene mediada por modificação, tal como descrito no presente documento, permite a construção de fusões, entre as sequências de FP e uma proteína Candida sequência codificante de interesse no seu locus genómico. A integração estável da construção facilita a análise da expressão da proteína, bem como dinâmica localização de proteínas. Os plasmídeos contendo as sequências de PF, optimizado para a expressão em Cândida albicans e que pode ser utilizado no g mediada por PCRestratégia de modificação eno, foram previamente construídas 2, 3, 4, 5. Os plasmídeos contêm FP transformação de &quot;cassetes&quot;: uma sequência de FP ligado a um gene marcador nutricional que facilita a transformação de C. albicans e C. parapsilosis 2, 3, 4, 5, 6, 7. Actualmente plasmídeos disponíveis contêm uma variedade de genes de selecção marcadores nutricionais (URA3, His1, ARG4) para a transformação de estirpes auxotróf iças, bem como um marcador de resistência a droga dominante (NAT1), o que facilita a transformação de estirpes clínicas falta auxotrophies. Além disso, os plasmídeos contêm opções para até quatro sequências FP diferentes (verde [GFP], yelloW [YFP], ciano [PCP], e cereja [mCherry]) e, ou uma sequência de terminação de ADH1 para construção de fusões de proteína carboxi-terminal, ou uma sequência promotora para a construção de proteínas de fusão do terminal amino. Os iniciadores foram concebidos com homologia com o ADN de plasmídeo em torno da cassete de FP. Além disso, os iniciadores contêm também sequências 5&#39;-extensão portadoras de homologia para o gene de levedura de interesse a ser marcado, o que facilita a integração da cassete no locus genómico através de recombinação homóloga (Figura 1). Cassetes de genes específicos de FP são gerados por PCR e, em seguida, transformados em células de Candida tornadas competentes para a absorção de ADN por meio do tratamento com acetato de lítio. <img alt="figura 1" src="/files/ftp_upload/55333/55333fig1.jpg" /> Figura 1: Diagrama de como fusões de sequências de FP são geradas em espécies de Candida. (A) inclu O DNA de plasmídeoes uma sequência FP e uma sequência que codifica nourseothricin resistência (NAT1). localizações relativas da frente (FWD) e inverso (REV) iniciadores são mostrados, com porções pretas dos iniciadores que indicam a região de homologia com a sequência de plasmídeo e as porções roxo que denotam a região de homologia específico para o gene ou a extensão do iniciador. Cassetes (B) FP são transformados em Candida e integrar dentro do locus genómico ENO1 através de recombinação homóloga (linhas pontilhadas). (C) resultante sequência de fusão de FP na extremidade 3 &#39;de ENO1. <a href="http://ecsource.jove.com/files/ftp_upload/55333/55333fig1large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a> Aqui, apresentamos um exemplo de proteína de fusão (ENO1-FP) construções em espécies de Candida. Nós utilizam a marcação de plasmídeos contendo o gene NAT1 transformação marcador juntamente com as sequências que codificam GFP, YFP, oumCherry (Figura 2). Estes plasmídeos são usados juntamente com iniciadores de PCR para gerar cassetes de gene-específicos que facilitam a fusão de PQ para a extremidade 3 &#39;de ENO1, resultando em expressão de ENO1 fundido com PQ no seu terminal carboxi. <img alt="Figura 2" src="/files/ftp_upload/55333/55333fig2.jpg" /> Figura 2: Mapas de FP plasmídeos contendo cassetes. Para a frente (F) e inverso (R) iniciadores utilizados para gerar as cassetes dos plasmídeos estão indicados juntamente com a localização relativa da sua homologia com os plasmídeos. As sequências dos iniciadores são como listados na Tabela 1. F1 e R1 também foram utilizadas para gerar a cassete pYFP- NAT1. O plasmídeo contendo a cassete de YFP- NAT1 (pMG2263) é idêntico ao pMG2120 com excepção da YFP no lugar da sequência de GFP. Formatos de cassete: GFP-NAT1, 3,7 kbp; mCherry- NAT1, 3,2 kpb; YFP- NAT1, 3.7 kpb. Este valor foi modificado a partir Gerami-Nejad, et al. 4 <a href="http://ecsource.jove.com/files/ftp_upload/55333/55333fig2large.jpg" target="_blank">Por favor clique aqui para ver uma versão maior desta figura.</a>

<table><tbody><tr><td>100 W mercury lamp</td><td>CHIU Technical Corporation</td><td>M-100T</td><td></td></tr><tr><td>95% Ethanol</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Adenine</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Ampicillin</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Carrier DNA</td><td>Ambion</td><td>AM9680</td><td>Sheared Salmon Sperm DNA 10 mg/ml</td></tr><tr><td>CCD Camera</td><td>Photometrics</td><td>CoolSNAP HQ</td><td></td></tr><tr><td>Conical Tube</td><td>Corning</td><td>430828</td><td>50 ml</td></tr><tr><td>Culture Tube Rotator</td><td>New Brunswick</td><td>2013923</td><td>TC-8, or Any Culture Tube Rotator</td></tr><tr><td>Deoxynucleotides (dNTP) PCR Grade</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Eppendorf Tubes</td><td>Eppendorf</td><td>022363719, 022363212</td><td>0.5 ml, 1.5 ml</td></tr><tr><td>Erlenmeyer Flask</td><td>Fisher Scientific</td><td>7250089</td><td>125 ml</td></tr><tr><td>Ethylenediaminetetraacetic Acid (EDTA)</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Freezer (-80 &amp;deg;C)</td><td>Thermo Electron Corporation</td><td>ULT-1386-9-V</td><td>Revco Ultima II</td></tr><tr><td>GFP, YFP and Texas Red Filter Sets</td><td>Chroma Technology Corporation</td><td>49002, 86004v2, 49008</td><td></td></tr><tr><td>Glass culture tubes</td><td>Fisher Scientific</td><td>1496126</td><td>75 mm</td></tr><tr><td>HRP goat anti-mouse antibody</td><td>Santa Cruz Biotechnology</td><td>SC-2005</td><td></td></tr><tr><td>HRP goat anti-rabbit antibody</td><td>Santa Cruz Biotechnology</td><td>SC-2301</td><td></td></tr><tr><td>Incubator (30 &amp;deg;C)</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Lithium Acetate</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Lysogeny Broth (LB) Media</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Magnesium Chloride</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Microcentrifuge</td><td>Eppendorf</td><td>5415 D</td><td></td></tr><tr><td>Microscope</td><td>Nikon</td><td>E600</td><td>Nikon Eclipse E600</td></tr><tr><td>Microscope Image Analysis Software</td><td>Universal Imaging Corporation</td><td>6.3r7</td><td>MetaMorph Software Series 6.3r7</td></tr><tr><td>Mouse anti-GFP antibody</td><td>Roche</td><td>11814460001</td><td></td></tr><tr><td>Nourseothricin</td><td>Fisher Scientific</td><td>50997939</td><td></td></tr><tr><td>PCR Thermocycler</td><td>Applied Biosystems</td><td>9700</td><td>GeneAmp PCR System</td></tr><tr><td>PCR tubes</td><td>BioExpress, GeneMate</td><td>T-3035-1</td><td>0.2 ml</td></tr><tr><td>Polyethylene Glycol 3350</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Potassium Chloride</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Rabbit anti-mCherry antibody</td><td>BioVision</td><td>5993-100</td><td></td></tr><tr><td>Refrigerator (4 &amp;deg;C)</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Sodium Acetate</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Stereomicroscope</td><td>Nikon</td><td>SMZ1500</td><td></td></tr><tr><td>Table Top Centrifuge</td><td>Labnet</td><td>Z 400</td><td>Hermle Z 400</td></tr><tr><td>&lt;em&gt;Taq&lt;/em&gt; DNA Polymerase</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Tris(hydroxymethyl)aminomethane (Tris)</td><td>Any</td><td>NA</td><td></td></tr><tr><td>Vortex Mixer</td><td>Scientific Industries</td><td>SI-0236</td><td>Vortex Genie 2</td></tr><tr><td>Yeast Extract Peptone Dextrose (YPD) Media</td><td>Any</td><td>NA</td><td></td></tr></tbody></table>

generation of fluorescent protein fusions in candida species

Espécies de Candida, colonizadores prevalentes das vias intestinais e genito-urinário, são a causa da maioria das infecções fúngicas invasivas em humanos. Assim, ferramentas moleculares e genéticos são necessários para facilitar o estudo de seus mecanismos de patogénese. modificação do gene mediada por PCR é uma abordagem simples e rápida para gerar proteínas marcadas no epitopo para facilitar a sua detecção. Em particular, a proteína fluorescente (FP) fusões são ferramentas poderosas que permitem a visualização e quantificação de ambas as células de levedura e proteínas por microscopia de fluorescência e imunotransferência, respectivamente. Os plasmídeos contendo as sequências de codificação de FP, juntamente com genes marcadores nutricionais que facilitam a transformação de espécies de Cândida, foram geradas com a finalidade de construção e expressão em FP Candida. Aqui, nós apresentamos uma estratégia para a construção de uma fusão FP em uma espécie de Candida. Os plasmídeos contendo o trabalho a prova nourseothricingene transformação marcador NCE (NAT1), juntamente com sequências, quer para verde, amarelo, ou cereja PQ (GFP, YFP, mCherry) são utilizados juntamente com iniciadores que incluem sequências específicas de gene numa reacção em cadeia da polimerase (PCR) para gerar uma cassete de FP . Esta cassete de gene-específico tem a capacidade de se integrar na extremidade 3 &#39;do locus do gene correspondente através de recombinação homóloga. Bem sucedida de fusão em-quadro da sequência de FP no locus do gene de interesse é verificada geneticamente, seguido por análise de expressão de proteína de fusão por microscopia e / ou métodos de detecção de imuno. Além disso, para o caso de proteínas altamente expressas, fusões bem sucedidas pode ser rastreada para principalmente por técnicas de imagem por fluorescência.

Como um exemplo, utilizou-se o protocolo descrito acima para GFP e mCherry fusões de ENO1 numa estirpe de laboratório C. parapsilosis. Cada transformante putativo foi inicialmente novamente riscados para o crescimento. Neste exemplo, uma vez que a proteína de fusão resultante é altamente expresso (enolase) e PQ são brilhantes, fomos capazes de rastrear os transformantes por microscopia de fluorescência, antes de realizar PCR de diagnóstico (Figura 3) <su...

Watch this Scientific Journal Video about Generation of Fluorescent Protein Fusions in Candida Species at JoVE.com

Generation of Fluorescent Protein Fusions in Candida Species

Modificação do gene mediada por PCR pode ser usado para gerar fusões de proteínas fluorescentes em espécies de Candida, o que facilita a visualização e quantificação das células de levedura e proteínas. Aqui, nós apresentamos uma estratégia para a construção de uma fusão proteína fluorescente (ENO1-FP) em Candida parapsilosis.

Produção de fusões de proteína fluorescente em<em&gt; Candida</em&gt; Espécies

Candida species, prevalent colonizers of the intestinal and genitourinary tracts, are the cause of the majority of invasive fungal infections in humans. ...

generation-of-fluorescent-protein-fusions-in-candida-species

Research

JoVE Journal

Genetics

Generation of Fluorescent Protein Fusions in Candida Species

10.6K visualizações.  University of Minnesota.  Modificação do gene mediada por PCR pode ser usado para gerar fusões de proteínas fluorescentes em espécies de Candida, o que facilita a visualização e quantificação das células de levedura e proteínas. Aqui, nós apresentamos uma estratégia para a construção de uma fusão proteína fluorescente (ENO1-FP) em Candida parapsilosis. 

Vídeo: Generation of Fluorescent Protein Fusions in Candida Species

The C. elegans Excretory Canal as a Model for Intracellular Lumen Morphogenesis and In Vivo Polarized Membrane Biogenesis in a Single Cell: labeling by GFP-fusions, RNAi Interaction Screen and Imaging

The four C. elegans excretory canals are narrow tubes extended through the length of the animal from a single cell, with almost equally far extended intracellular endotubes that build and stabilize the lumen with a membrane and submembraneous cytoskeleton of apical character. The excretory cell expands its length approximately 2,000 times to generate these canals, making this model unique for the in vivo assessment of de novo polarized membrane biogenesis, intracellular lumen morphogenesis and unicellular tubulogenesis. The protocol presented here shows how to combine standard labeling, gain- and loss-of-function genetic or RNA interference (RNAi)-, and microscopic approaches to use this model to visually dissect and functionally analyze these processes on a molecular level. As an example of a labeling approach, the protocol outlines the generation of transgenic animals with fluorescent fusion proteins for live analysis of tubulogenesis. As an example of a genetic approach, it highlights key points of a visual RNAi-based interaction screen designed to modify a gain-of-function cystic canal phenotype. The specific methods described are how to: label and visualize the canals by expressing fluorescent proteins; construct a targeted RNAi library and strategize RNAi screening for the molecular analysis of canal morphogenesis; visually assess modifications of canal phenotypes; score them by dissecting fluorescence microscopy; characterize subcellular canal components at higher resolution by confocal microscopy; and quantify visual parameters. The approach is useful for the investigator who is interested in taking advantage of the C. elegans excretory canal for identifying and characterizing genes involved in the phylogenetically conserved processes of intracellular lumen and unicellular tube morphogenesis.

The C. elegans Excretory Canal as a Model for Intracellular Lumen Morphogenesis and In Vivo Polarized Membrane Biogenesis in a Single Cell: labeling by GFP-fusions, RNAi Interaction Screen and Imaging

The C. elegans excretory canal is a unique single-cell model for the visual in vivo analysis of de novo polarized membrane biogenesis. This protocol describes a combination of standard genetic/RNAi and imaging approaches, adaptable for the identification and characterization of molecules directing unicellular tubulogenesis, and apical membrane and lumen biogenesis.

O Canal de Excretory c. elegans como modelo para intracelular Lumen morfogênese e Vivo na biogênese de membrana polarizada em uma única célula: rotulagem por GFP-fusões, tela de interação de RNAi e Imaging

The four C. elegans excretory canals are narrow tubes extended through the length of the animal from a single cell, with almost equally far extended ...

Biologia do Desenvolvimento

Biolistic Transformation of a Fluorescent Tagged Gene into the Opportunistic Fungal Pathogen Cryptococcus neoformans

The basidiomycete Cryptococcus neoformans, an invasive opportunistic pathogen of the central nervous system, is the most frequent cause of fungal meningitis worldwide resulting in more than 625,000 deaths per year worldwide.&#160;Although electroporation has been developed for the transformation of plasmids in Cryptococcus, only&#160;biolistic&#160;delivery provides&#160;an effective means to transform&#160;linear&#160;DNA&#160;that can be integrated into the genome by homologous recombination.&#160;
Acetate has been shown to be a major fermentation product during cryptococcal infection, but the significance of this is not yet known.&#160;A bacterial pathway composed of the enzymes xylulose-5-phosphate/fructose-6-phosphate phosphoketolase (Xfp) and acetate kinase (Ack) is one of three potential pathways for acetate production in C. neoformans. Here, we demonstrate the biolistic transformation of a construct, which has the gene encoding Ack fused to the fluorescent tag mCherry, into&#160;C. neoformans. We then confirm integration of the ACK-mCherry fusion into the&#160;ACK&#160;locus.

Biolistic Transformation of a Fluorescent Tagged Gene into the Opportunistic Fungal Pathogen Cryptococcus neoformans

Biolistic transformation is a method used to generate stable integration of DNA into the genome of the opportunistic pathogen Cryptococcus neoformans through homologous recombination. We will demonstrate biolistic transformation of a construct, which has the gene encoding acetate kinase fused to the fluorescent tag mCherry into&#160;C. neoformans.

Transformação Biolistic de uma fluorescente Tagged Gene para o oportunista fúngica Pathogen<em&gt; Cryptococcus neoformans</em

The basidiomycete Cryptococcus neoformans, an invasive opportunistic pathogen of the central nervous system, is the most frequent cause of fungal ...

Imunologia e Infecção

Visualizing Yeast Organelles with Fluorescent Protein Markers

The budding yeast, Saccharomyces cerevisiae, is a classic model system in studying organelle function and dynamics. In our previous works, we have constructed fluorescent protein-based markers for major organelles and endomembrane structures, including the nucleus, endoplasmic reticulum (ER), Golgi apparatus, endosomes, vacuoles, mitochondria, peroxisomes, lipid droplets, and autophagosomes. The protocol presented here describes the procedures for using these markers in yeast, including DNA preparation for yeast transformation, selection and evaluation of transformants, fluorescent microscopic observation, and the expected outcomes. The text is geared toward researchers who are entering the field of yeast organelle study from other backgrounds. Essential steps are covered, as well as technical notes about microscope hardware considerations and several common pitfalls. It provides a starting point for people to observe yeast subcellular entities by live-cell fluorescent microscopy. These tools and methods can be used to identify protein subcellular localization and track organelles of interest in time-lapse imaging.

<meta charset="utf8"></head><body>Visualizando organelas de levedura com marcadores de proteína fluorescentes

Here we describe the use of a set of fluorescent protein-based organelle markers in live-cell imaging of the budding yeast, Saccharomyces cerevisiae.

Visualizando organelas de levedura com marcadores de proteína fluorescentes

The budding yeast, Saccharomyces cerevisiae, is a classic model system in studying organelle function and dynamics. In our previous works, we have ...

Bioquímica

In vivo Quantification of G Protein Coupled Receptor Interactions using Spectrally Resolved Two-photon Microscopy

The study of protein interactions in living cells is an important area of research because the information accumulated both benefits industrial applications as well as increases basic fundamental biological knowledge. F&ouml;rster (Fluorescence) Resonance Energy Transfer (FRET) between a donor molecule in an electronically excited state and a nearby acceptor molecule has been frequently utilized for studies of protein-protein interactions in living cells. The proteins of interest are tagged with two different types of fluorescent probes and expressed in biological cells. The fluorescent probes are then excited, typically using laser light, and the spectral properties of the fluorescence emission emanating from the fluorescent probes is collected and analyzed. Information regarding the degree of the protein interactions is embedded in the spectral emission data. Typically, the cell must be scanned a number of times in order to accumulate enough spectral information to accurately quantify the extent of the protein interactions for each region of interest within the cell. However, the molecular composition of these regions may change during the course of the acquisition process, limiting the spatial determination of the quantitative values of the apparent FRET efficiencies to an average over entire cells. By means of a spectrally resolved two-photon microscope, we are able to obtain a full set of spectrally resolved images after only one complete excitation scan of the sample of interest. From this pixel-level spectral data, a map of FRET efficiencies throughout the cell is calculated. By applying a simple theory of FRET in oligomeric complexes to the experimentally obtained distribution of FRET efficiencies throughout the cell, a single spectrally resolved scan reveals stoichiometric and structural information about the oligomer complex under study. Here we describe the procedure of preparing biological cells (the yeast Saccharomyces cerevisiae) expressing membrane receptors (sterile 2 &alpha;-factor receptors) tagged with two different types of fluorescent probes. Furthermore, we illustrate critical factors involved in collecting fluorescence data using the spectrally resolved two-photon microscopy imaging system. The use of this protocol may be extended to study any type of protein which can be expressed in a living cell with a fluorescent marker attached to it.

In vivo Quantification of G Protein Coupled Receptor Interactions using Spectrally Resolved Two-photon Microscopy

By employing a spectrally resolved two-photon microscopy imaging system, pixel-level maps of F&ouml;rster Resonance Energy Transfer (FRET) efficiencies are obtained for cells expressing membrane receptors hypothesized to form homo-oligomeric complexes. From the FRET efficiency maps, we are able to estimate stoichiometric information about the oligomer complex under study.

Em Quantificação in vivo de proteínas G Interações Receptor Acoplado usando espectral Resolvido Microscopia de dois fótons

The study of protein interactions in living cells is an important area of research because the information accumulated both benefits industrial ...

Biologia

Quantitative Live Cell Fluorescence-microscopy Analysis of Fission Yeast

Several microscopy techniques are available today that can detect a specific protein within the cell. During the last decade live cell imaging using fluorochromes like Green Fluorescent Protein (GFP) directly attached to the protein of interest has become increasingly popular 1. Using GFP and similar fluorochromes the subcellular localisations and movements of proteins can be detected in a fluorescent microscope. Moreover, also the subnuclear localisation of a certain region of a chromosome can be studied using this technique. GFP is fused to the Lac Repressor protein (LacR) and ectopically expressed in the cell where tandem repeats of the lacO sequence has been inserted into the region of interest on the chromosome2. The LacR-GFP will bind to the lacO repeats and that area of the genome will be visible as a green dot in the fluorescence microscope. Yeast is especially suited for this type of manipulation since homologous recombination is very efficient and thereby enables targeted integration of the lacO repeats and engineered fusion proteins with GFP 3. Here we describe a quantitative method for live cell analysis of fission yeast. Additional protocols for live cell analysis of fission yeast can be found, for example on how to make a movie of the meiotic chromosomal behaviour 4. In this particular experiment we focus on subnuclear organisation and how it is affected during gene induction. We have labelled a gene cluster, named Chr1, by the introduction of lacO binding sites in the vicinity of the genes. The gene cluster is enriched for genes that are induced early during nitrogen starvation of fission yeast 5. In the strain the nuclear membrane (NM) is labelled by the attachment of mCherry to the NM protein Cut11 giving rise to a red fluorescent signal. The Spindle Pole body (SPB) compound Sid4 is fused to Red Fluorescent Protein (Sid4-mRFP) 6. In vegetatively growing yeast cells the centromeres are always attached to the SPB that is embedded in the NM 7. The SPB is identified as a large round structure in the NM. By imaging before and 20 minutes after depletion of the nitrogen source we can determine the distance between the gene cluster (GFP) and the NM/SPB. The mean or median distances before and after nitrogen depletion are compared and we can thus quantify whether or not there is a shift in subcellular localisation of the gene cluster after nitrogen depletion.

The fission yeast, Schizosaccharomyces pombe, is a good model system to study basic cellular processes. Here we describe a method to perform quantitative live cell analysis of fission yeast. In this particular experiment we focus on organisation of the genome within the cell nucleus, but the method can also be used to study cytosolic factors.

Quantitativas de células vivas de Análise de microscopia de fluorescência de levedura

Several microscopy techniques are available today that can detect a specific protein within the cell. During the last decade live cell imaging using ...

Use of In Vivo Imaging to Screen for Morphogenesis Phenotypes in Candida albicans Mutant Strains During Active Infection in a Mammalian Host

Candida albicans is an important human pathogen. Its ability to switch between morphologic forms is central to&#160;its pathogenesis; these morphologic changes are regulated by a complex signaling network controlled in response to environmental stimuli. These regulatory components have been highly studied, but almost all studies use a variety of in vitro stimuli to trigger filamentation. To determine how morphogenesis is regulated during the pathogenesis process, we developed an in vivo microscopy system to obtain high spatial resolution images of organisms undergoing hyphal formation within the mammalian host. The protocol presented here describes the use of this system to screen small collections of C. albicans mutant strains, allowing us to identify key regulators of morphogenesis as it occurs at the site of infection. Representative results are presented, demonstrating that some regulators of morphogenesis, such as the transcriptional regulator Efg1, have consistent phenotypes in vitro and in vivo, whereas other regulators, such as adenyl cyclase (Cyr1), have significantly different phenotypes in vivo compared to in vitro.

Use of In Vivo Imaging to Screen for Morphogenesis Phenotypes in Candida albicans Mutant Strains During Active Infection in a Mammalian Host

This manuscript describes a method for screening moderately sized Candida albicans mutant libraries for morphogenesis phenotypes during active infection in a mammalian host using non-invasive confocal microscopy.

Uso de imagens in vivo para rastrear fenótipos de morfogênese em cepas mutantes de Candida albicans durante a infecção ativa em um hospedeiro mamífero

Candida albicans is an important human pathogen. Its ability to switch between morphologic forms is central to&#160;its pathogenesis; these morphologic ...

Estabelecendo um modelo de camundongo para infecção relacionada a cateter associada a Candida albicans

A Catheter-Related Candida albicans Infection Model in Mouse

Catheter-related infection (CRI) is a common nosocomial infection caused by candida albicans during catheter implantation. Typically, biofilms are formed on the outer surface of the catheter and lead to disseminated infections, which are fatal to patients. There are no effective prevention and treatment management in clinics. Therefore, it is urgent to establish an animal model of CRI for the preclinical screening of new strategies for its prevention and treatment. In this study, a polyethylene catheter, a widely used medical catheter, was inserted into the back of the BALB/c mice after hair removal. Candida albicans ATCC MYA-2876 (SC5314) expressing enhanced green fluorescent protein was subsequently inoculated on the skin's surface along the catheter. Intense fluorescence was observed on the surface of the catheter under a fluorescent microscope 3 days later. Mature and thick biofilms were found on the surface of the catheter via scanning electron microscopy. These results indicated the adhesion, colonization, and biofilm formation of candida albicans on the surface of the catheter. The hyperplasia of the epidermis and the infiltration of inflammatory cells in the skin specimens indicated the histopathological changes of the CRI-associated skin. To sum up, a mouse CRI model was successfully established. This model is expected to be helpful in the research and development of therapeutic management for candida albicans associated CRI.

Autor em destaque: Aprimorando a detecção de Candida albicans em infecções por cateter usando marcação de proteína fluorescente 

We establish a mouse model of C.albicans-associated catheter-related infection (CRI), in which biofilm forms on the catheter, and the interaction between C.albicans and host correlates well with the clinical CRI. This model helps screen therapies for C.albicans biofilm-associated CRI, laying a foundation for clinical transformation.

Modelo de Infecção por Candida albicans Relacionada a Cateter em Camundongos

Catheter-related infection (CRI) is a common nosocomial infection caused by candida albicans during catheter implantation. Typically, biofilms are formed ...

Produção de fusões de proteína fluorescente em

Resumo

Explore mais vídeos

Capítulos neste vídeo

O Canal de Excretory c. elegans como modelo para intracelular Lumen morfogênese e Vivo na biogênese de membrana polarizada em uma única célula: rotulagem por GFP-fusões, tela de interação de RNAi e Imaging

Transformação Biolistic de uma fluorescente Tagged Gene para o oportunista fúngica Pathogen

Visualizando organelas de levedura com marcadores de proteína fluorescentes

Visualizando organelas de levedura com marcadores de proteína fluorescentes

Em Quantificação in vivo de proteínas G Interações Receptor Acoplado usando espectral Resolvido Microscopia de dois fótons

Quantitativas de células vivas de Análise de microscopia de fluorescência de levedura

Uso de imagens in vivo para rastrear fenótipos de morfogênese em cepas mutantes de Candida albicans durante a infecção ativa em um hospedeiro mamífero

Modelo de Infecção por Candida albicans Relacionada a Cateter em Camundongos

Modelo de Infecção por Candida albicans Relacionada a Cateter em Camundongos

Modelo de Infecção por Candida albicans Relacionada a Cateter em Camundongos