We thank Shanghai Tolo Biotech for their technical assistance during the development of the C-Brick standard. This work was supported by grants from the Strategic Priority Research Program of the Chinese Academy of Sciences (Grant No. XDB19040200).

1. Preparation of crRNA
<ol>
	<li>Preparation of crRNA templates
	<ol>
		<li>Re-suspend individual oligonucleotides (Table 1) in RNase-free water to a concentration of 10 &#181;M.</li>
		<li>Add 22.5 &#181;L of top-strand oligonucleotide (T7-F in Table 1), 22.5 &#181;L of bottom-strand oligonucleotide (Table 1), and 5 &#181;L of 10x annealing buffer to a 0.2 mL PCR tube. Ensure that the total volume is 50 &#181;L. 
		NOTE: Six different bottom-strand oligonucleotides are shown in Table 1, each of which should be individually paired with the top-strand T7-F. The lowercase letters in Table 1 represent the sequence to be transcribed into the guide sequence of crRNA. 10x Taq PCR buffer can be used instead of the 10x annealing buffer.</li>
		<li>Place the PCR tube into a thermocycler.</li>
		<li>Run the annealing program: initial denaturation at 95 &#176;C for 5 min and then a cooldown from 95-20 &#176;C, with a 1 &#176;C decrease per min on the thermocycler. 
		NOTE: Immediately use the samples for step 1.2.1.</li>
	</ol>
	</li>
	<li>Transcription and purification of crRNA
	<ol>
		<li>Add 38 &#181;L of RNase-free water, 8 &#181;L of the template from step 1.1.4, 20 &#181;L of 5x T7 transcription buffer, 20 &#181;L of NTP mixture (10 &#181;M), 4 &#181;L of recombinant RNase inhibitor (RRI), and 10 &#181;L of T7 RNA polymerase to a 1.5 mL microcentrifuge tube. Ensure that the total volume is 100 &#181;L.</li>
		<li>Put the microcentrifuge tube in a 37 &#176;C water bath overnight (for about 16 h).</li>
		<li>Use an RNA cleanup and concentration kit to purify the transcribed RNA; follow the manufacturer&#39;s protocol.</li>
		<li>Quantitate the RNAs with UV-Vis spectrophotometers and dilute the RNA to a concentration of 10 &#181;M. Use the samples immediately or store them at -80 &#176;C. 
		NOTE: The crRNA sequences are listed in Table 2.</li>
	</ol>
	</li>
</ol>
2. Construction of C-Brick Parts ( i.e., the Insertion of Biological Parts into a C-Brick Standard Vector)
NOTE: This step has three sub-steps. For short biological parts (e.g., promoters and terminators), it is best to use the direct PCR method to insert the biological parts into a C-Brick standard vector4. The whole vector sequence is shown in the supplementary data, and the prefix and suffix sequence is shown in Figure 1 (step 2.1, below). For biological parts that can be easily obtained via PCR (e.g., with templates of genomic DNA, plasmids, or de novo synthesized DNA sequences), it is best to use the seamless assembly method to insert the biological parts into a C-Brick standard vector (step 2.2, below). For those parts obtained from BioBrick and BglBrick standards, restriction enzyme-mediated digestion and T4 DNA ligase-mediated ligation can be used to insert the biological parts into a C-Brick standard vector (step 2.3, below).
<ol>
	<li>Construction via direct PCR amplification
	<ol>
		<li>Design and order oligonucleotides for PCR amplification. 
		NOTE: The 5&#39;-end of the oligonucleotide contains the sequence of the DNA part, and 3&#39;-end of the oligonucleotide contains the vector sequence (i.e., &#34;GGATCCACTAGTCTCTAGCTCG&#34; at the 3&#39;-end of the forward strand and &#34;GGATCCTTTCTCCTCTTTCTAG&#34; in the reverse strand). Either no overhang or a ~20-bp overhang can be designed at the 5&#39;-end of the oligonucleotide. Specific examples can be found in a previous study4.</li>
		<li>Re-suspend individual oligonucleotides in ultra-pure water to a concentration of 10 &#181;M.</li>
		<li>Set up PCR reactions on ice in a 0.2 mL PCR tube: add 18 &#181;L of ultra-pure water, 25 &#181;L of 2x PCR buffer, 1 &#181;L of dNTPs (10 &#181;M), 2.5 &#181;L each of the forward and reverse primers (10 &#181;M) from step 2.1.2, 0.5 &#181;L of C-Brick standard vector (50 ng) as a template, and 0.5 &#181;L of high-fidelity DNA polymerase. Ensure that the total volume is 50 &#181;L.</li>
		<li>Place the tube directly into a thermocycler and start the thermocycler program. Use the samples immediately or freeze and store them at -20 &#176;C.</li>
		<li>Thermocycler program: one cycle for 3 min at 98 &#176;C; thirty cycles for 10 s at 98 &#176;C, 20 s at 55 &#176;C, and 2 min at 72 &#176;C; and one cycle for 10 min at 72 &#176;C. Keep the sample at 16 &#176;C.</li>
		<li>Add 9 &#181;L of the mixture from step 2.1.4 to a 1.5 mL microcentrifuge tube.</li>
		<li>Add 1 &#181;L of DpnI and incubate for 1 h in a 37 &#176;C water bath. 
		NOTE:&#12288;If the primers have no overlapping sequences, add 0.5 &#181;L of T4 polynucleotide kinase (PNK) and 0.5 &#181;L of T4 DNA ligase and incubate in a 22 &#176;C water bath for 1 h. Otherwise, if the primers contain a ~20 nt overlapping sequence, directly transform the DpnI-treated products into E. coli (DH10B)-competent cells (step 2.4). The linearized PCR product will be circularized by the recombination system in the host.</li>
		<li>Use the samples immediately or store them at -20 &#176;C.</li>
	</ol>
	</li>
	<li>Construction via seamless assembly
	<ol>
		<li>Design and order oligonucleotides for PCR amplification. 
		NOTE: The 3&#39;-end of the oligonucleotide contains the terminal sequence of the DNA part, and the 5&#39;-end of the oligonucleotide contains the terminal of the linearized C-Brick standard vector sequence (i.e., &#34;CTAGAAAGAGGAGAAAGGATCC&#34; for the 5&#39;-end of the forward strand and &#34;CGAGCTAGAGACTAGTGGATCC&#34; for the 5&#39;-end of the reverse strand). Specific examples can be found in a previous study4.</li>
		<li>Re-suspend the individual oligonucleotides in ultra-pure water to a concentration of 10 &#181;M.</li>
		<li>Set up PCR reactions on ice in a 0.2 mL PCR tube: add 18 &#181;L of ultra-pure water, 25 &#181;L of 2x PCR buffer, 1 &#181;L of dNTPs (10 &#181;M), 2.5 &#181;L each of the forward and reverse primers (10 &#181;M) from step 2.2.2, 0.5 &#181;L of template (20-500 ng), and 0.5 &#181;L of high-fidelity DNA polymerase. Ensure that the total volume is 50 &#181;L.</li>
		<li>Place the tube directly into the thermocycler and run the thermocycler program. Use the samples immediately or freeze and store them at -20 &#176;C. 
		NOTE: Set the thermocycler program to: one cycle for 3 min at 98 &#176;C; 30 cycles for 10 s at 98 &#176;C, 20 s at 55 &#176;C (according to the annealing temperature of the primer), and 1 min (according to the length of the biological parts) at 72 &#176;C; and one cycle for 10 min at 72 &#176;C. Keep the sample at 16 &#176;C.</li>
		<li>Purify the PCR product using a PCR cleanup system kit; follow the manufacturer&#39;s protocol.</li>
		<li>Digest the C-Brick standard vector with BamHI: add 34 &#181;L of ultra-pure water, 10 &#181;L of plasmid (1 &#181;g), 5 &#181;L of 10x buffer, and 1 &#181;L of BamHI to the microcentrifuge tube. Incubate for up to 2 h at 37 &#176;C in a water bath.</li>
		<li>Purify the above product using a gel cleanup system kit; follow the manufacturer&#39;s protocol.</li>
		<li>Add 2 &#181;L of linearized vector (50 ng) from step 2.2.7, 5 &#181;L of fragment (200 ng) from step 2.2.4, 2 &#181;L of 5x seamless assembly buffer, and 1 &#181;L of seamless assembly enzyme from a seamless assembly kit to a 1.5-mL microcentrifuge tube.Ensure that the total volume is 10 &#181;L.</li>
		<li>Place this in a 37 &#176;C water bath for 30 min. Use the samples immediately or freeze and store them at -20 &#176;C.</li>
	</ol>
	</li>
	<li>Construction via restriction enzyme-mediated digestion and T4 DNA ligase-mediated ligation. 
	NOTE: For those parts obtained from the BioBrick (step 2.3.4-2.3.7) and BglBrick (step 2.3.1-2.3.3) standards, restriction enzyme-mediated digestion and T4 DNA ligase-mediated ligation can be used to insert the biological parts into a C-Brick standard vector.
	<ol>
		<li>Digest the BglBrick standard parts with BamHI and BglII: add 34 &#181;L of ultra-pure water, 10 &#181;L of plasmid (2 &#181;g), 5 &#181;L of 10x buffer 3, 0.5 &#181;L of BamHI, and 0.5 &#181;L of BglII to the microcentrifuge tube. Incubate for 2 h in a 37 &#176;C water bath.</li>
		<li>Run a 1% agarose gel electrophoresis and purify the fragment using a gel cleanup system kit.</li>
		<li>Ligate the fragment and the C-Brick standard vector: add 2 &#181;L of linearized vector (50 ng) from step 2.1.12 and 6 &#181;L of fragment (200 ng) from step 2.3.3 to a 1.5 mL microcentrifuge tube. Add 1 &#181;L of 10 x T4 DNA ligase buffer and 1 &#181;L of T4 DNA ligase. Incubate for 2 h at 22 &#176;C. Use the samples immediately or freeze and store them at -20 &#176;C.</li>
		<li>Digest the BioBrick standard parts with XbaI and SpeI: add 34 &#181;L of ultra-pure water, 10 &#181;L of plasmid (2 &#181;g), 5 &#181;L of 10x buffer, 0.5 &#181;L of XbaI, and 0.5 &#181;L of SpeI to the microcentrifuge tube. Incubate for 2 h in a 37 &#176;C water bath.</li>
		<li>Digest the C-Brick standard vector with XbaI and SpeI: add 34 &#181;L of ultra-pure water, 10 &#181;L of plasmid (1 &#181;g), 5 &#181;L of 10x buffer, 0.5 &#181;L of XbaI, and 0.5 &#181;L of SpeI to the microcentrifuge tube. Incubate for 2 h in a 37 &#176;C water bath.</li>
		<li>Run a 1% agarose gel electrophoresis and purify the fragment from step 2.3.4 and the linearized vector from step 2.3.5 with a gel cleanup system kit; following the manufacturer&#39;s protocol.</li>
		<li>Ligate the fragment and the C-Brick vector: add 2 &#181;L of linearized vector (50 ng) from step 2.3.5 and 6 &#181;L of fragment (200 ng) from step 2.3.4 to a 1.5 mL microcentrifuge tube. Add 1 &#181;L of 10x T4 DNA ligase buffer and 1 &#181;L of T4 DNA ligase. Incubate for 2 h at 22 &#176;C. Use the samples immediately or freeze and store them at -20 &#176;C.</li>
	</ol>
	</li>
	<li>Add 10 &#181;L of the products from step 2.1.8, 2.2.9, 2.3.3, or 2.3.7 for chemical transformation into the competent cells of E. coli (DH10B).</li>
	<li>Pick-up several clones to a 5-mL liquid Luria-Bertani (LB) tube and incubate at 37 &#176;C on a shaker (220 rpm) overnight.</li>
	<li>Extract the plasmid using a plasmid preparation kit; follow the manufacturer&#39;s protocol.</li>
	<li>Identify the correct clones by Sanger sequencing11.</li>
</ol>
3. C-Brick Assembly (Figure 2)
<ol>
	<li>Digestion of the C-Brick vector with Cpf1
	<ol>
		<li>Add 22.5 &#181;L of RNase-free water, 4 &#181;L of 10x Cpf1 buffer, 10 &#181;L of the plasmid from step 2.6 (1 &#181;g), 0.5 &#181;L of RRI, and 1 &#181;L of Cpf1 (5 &#181;M) to a 1.5-mL microcentrifuge tube. 
		NOTE: Cpf1 can be purchased commercially or purified following the protocol in a previous study4.</li>
		<li>To insert a foreign DNA fragment into the T1 and T2 sites, add 1 &#181;L of crRNA-T2 (10 &#181;M) and incubate in a water bath at 37 &#176;C for 30 min. Add 1 &#181;L of crRNA-T1 (10 &#181;M) and Cpf1 (5 &#181;M) for another 30 min. 
		NOTE: Alternatively, to insert a foreign DNA fragment into the T3 and T4 sites, add 1 &#181;L of crRNA-T3 (10 &#181;M) and incubate in a water bath at 37 &#176;C for 30 min. Add 1 &#181;L of crRNA-T4 (10 &#181;M) for another 30 min.</li>
		<li>Add 1 &#181;L of thermosensitive alkaline phosphatase and incubate the tube in a 37 &#176;C water bath for another 1 h.</li>
		<li>Run an agarose gel electrophoresis and purify the vector using a gel cleanup system kit. Use the samples immediately or freeze and store them at -20 &#176;C.</li>
	</ol>
	</li>
	<li>Digestion of the DNA fragment with Cpf1
	<ol>
		<li>Add 21.5 &#181;L of RNase-free water, 4 &#181;L of 10x Cpf1 buffer, 10 &#181;L of plasmid from step 2.6 (2 &#181;g), 0.5 &#181;L of RRI, and 2 &#181;L of Cpf1 (5 &#181;M) to a 1.5-mL microcentrifuge tube.</li>
		<li>To insert a foreign DNA fragment into the T1 and T2 sites, add 1 &#181;L of crRNA-T1 (10 &#181;M) and 1 &#181;L of crRNA-T3 (10 &#181;M) and incubate in a water bath at 37 &#176;C for 2 h. 
		NOTE: Alternatively, add 1 &#181;L of crRNA-T2 (10 &#181;M) and 1 &#181;L of crRNA-T4 (10 &#181;M) and incubate in a water bath at 37 &#176;C for 2 h.</li>
		<li>Run an agarose gel electrophoresis and purify the fragment using a gel cleanup system kit. Use the samples immediately or freeze and store them at -20 &#176;C.</li>
	</ol>
	</li>
	<li>C-Brick assembly and further verification
	<ol>
		<li>Ligate the foreign DNA fragment and C-Brick vector: add 2 &#181;L of the linearized vector (50 ng) from step 3.1.4 and 6 &#181;L of the DNA fragment (200 ng) from step 3.2.3 to a 1.5 mL microcentrifuge tube. Add 1 &#181;L of 10x T4 DNA ligase buffer and 1 &#181;L of T4 DNA ligase. Incubate for 2 h at 22 &#176;C. Use the samples immediately or freeze and store them at -20 &#176;C.</li>
		<li>Add 10 &#181;L of the ligation products (step 3.3.1) for chemical transformation into E. coli (DH10B)-competent cells.</li>
		<li>Add several clones to a 5 mL liquid LB tube and incubate overnight on a shaker at 220 rpm and 37 &#176;C.</li>
		<li>Extract the plasmid using a plasmid preparation kit; follow the manufacturer&#39;s protocol.</li>
		<li>Identify correct clones by Sanger sequencing11.</li>
	</ol>
	</li>
	<li>Perform a new round of C-Brick assembly. Correct clones from step 3.3.4 can be used as a new C-Brick vector or DNA part for further iterative C-Brick assembly, following the same protocol from steps 3.1-3.3. 
	NOTE: T2&#39; and T3&#39; sites are designed as the backup of T2 and T3 sites (Figure 1a). For plasmids obtained from step 2.3.7, only T2&#39; and T3&#39; can be used for the C-Brick standard assembly.</li>
</ol>

<ol>
	<li>Canton, B., Labno, A., Endy, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Refinement+and+standardization+of+synthetic+biological+parts+and+devices.">Refinement and standardization of synthetic biological parts and devices.</a> Nat Biotechnol. 26 (7), 787-793 (2008).</li><li>Shetty, R. P., Endy, D., Knight, T. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+BioBrick+vectors+from+BioBrick+parts.">Engineering BioBrick vectors from BioBrick parts.</a> J Biol Eng. 2, (2008).</li><li>Knight, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Idempotent Vector Design for Standard Assembly of Biobricks. , 1-11 (2003).</li><li>Li, S. Y., Zhao, G. P., Wang, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=C-Brick:+A+New+Standard+for+Assembly+of+Biological+Parts+Using+Cpf1.">C-Brick: A New Standard for Assembly of Biological Parts Using Cpf1.</a> ACS Synth Biol. 5 (12), 1383-1388 (2016).</li><li>Anderson, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BglBricks:+A+flexible+standard+for+biological+part+assembly.">BglBricks: A flexible standard for biological part assembly.</a> J Biol Eng. 4 (1), (2010).</li><li>Liu, J. K., Chen, W. H., Ren, S. X., Zhao, G. P., Wang, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=iBrick:+a+new+standard+for+iterative+assembly+of+biological+parts+with+homing+endonucleases.">iBrick: a new standard for iterative assembly of biological parts with homing endonucleases.</a> PLoS One. 9 (10), e110852 (2014).</li><li>Hsu, P. D., Lander, E. S., Zhang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+applications+of+CRISPR-Cas9+for+genome+engineering.">Development and applications of CRISPR-Cas9 for genome engineering.</a> Cell. 157 (6), 1262-1278 (2014).</li><li>Wright, A. V., Nunez, J. K., Doudna, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biology+and+Applications+of+CRISPR+Systems:+Harnessing+Nature's+Toolbox+for+Genome+Engineering.">Biology and Applications of CRISPR Systems: Harnessing Nature's Toolbox for Genome Engineering.</a> Cell. 164 (1-2), 29-44 (2016).</li><li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Zetsche, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cpf1+is+a+single+RNA-guided+endonuclease+of+a+class+2+CRISPR-Cas+system.">Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system.</a> Cell. 163 (3), 759-771 (2015).</li><li>Sanger, F., Nicklen, S., Coulson, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+sequencing+with+chain-terminating+inhibitors.">DNA sequencing with chain-terminating inhibitors.</a> Proc Natl Acad Sci U S A. 74 (12), 5463-5467 (1977).</li><li>Engler, C., Kandzia, R., Marillonnet, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+one+pot,+one+step,+precision+cloning+method.">A one pot, one step, precision cloning method.</a> PLoS One. 3 (11), e3647 (2008).</li><li>Gibson, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+assembly+of+DNA+molecules+up+to+several+hundred+kilobases.">Enzymatic assembly of DNA molecules up to several hundred kilobases.</a> Nat Methods. 6 (5), 343-345 (2009).</li><li>Casini, A., Storch, M., Baldwin, G. S., Ellis, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bricks+and+blueprints:+methods+and+standards+for+DNA+assembly.">Bricks and blueprints: methods and standards for DNA assembly.</a> Nat Rev Mol Cell Biol. 16 (9), 568-576 (2015).</li><li>Cameron, D. E., Bashor, C. J., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+brief+history+of+synthetic+biology.">A brief history of synthetic biology.</a> Nat Rev Microbiol. 12 (5), 381-390 (2014).</li><li>Keasling, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+biology+for+synthetic+chemistry.">Synthetic biology for synthetic chemistry.</a> ACS Chem Biol. 3 (1), 64-76 (2008).</li></ol>

The authors have nothing to disclose.

This protocol describes a procedure for the DNA assembly standard C-Brick. The most important step in this protocol is the linearization of the C-Brick standard vector; incomplete cleavage of the vector could seriously affect the success rate. Additionally, although Cpf1 mainly cleaves target DNA sequences in the &#34;18-23&#34; cleavage pattern, inaccurate cleavage near the two bases was also detected4, which can cause a small number of mutations after DNA assembly. Therefore, Sanger sequencing i...

The standardization of DNA biological parts is important for the development of synthetic biology1. The development of a DNA assembly procedure can replace ad hoc experimental designs and remove many of the unexpected outcomes that arise during the assembly of genetic components into larger systems. The BioBrick standard (BBF RFC 10) was one of the earliest proposed DNA assembly standards. It uses the prefix sequence (containing EcoRI and XbaI cutting sites) and the suffix sequence (containing SpeI and PstI cutting sites)2,3. Because XbaI and SpeI have complementary cohesive ends, BioBrick DNA parts that are cut with XbaI and SpeI can be joined together, generating a new BioBrick for further iterative assembly.
Some defects have been identified with the use of the BioBrick standard4. For example, it produces an 8-bp scar between the DNA parts, which does not allow for the construction of in-fusion proteins. Besides, the four abovementioned types of 6-bp restriction sites must be removed from the DNA parts, which is very inconvenient. The BglBrick standard was established to solve the first problem5. It creates a 6-bp &#34;GGATCT&#34; scar, producing Gly-Ser and allowing for the fusion of multiple proteins or protein domains. iBrick was developed to deal with the second problem6. It uses homing endonucleases (HEs) that recognize long DNA sequences. As the HE recognition sites rarely exist in natural DNA sequences, the iBrick standard can be used for the direct construction of iBrick parts without modifying their DNA sequences. However, the iBrick standard leaves a 21 bp scar between the DNA parts, which might be the reason for its unpopularity.
In recent years, the clustered regularly interspaced short palindromic repeats (CRISPR) system has developed rapidly7,8. Among the CRISPR-associated (Cas) proteins, Cas9 endonuclease from Streptococcus pyogenes is now widely used. It mostly introduces double-stranded DNA breaks (DSBs) with blunt ends9.
In 2015, Zhang and coworkers characterized Cpf1 (CRISPR from Prevotella and Francisella 1) for the first time. It belongs to the class 2 type V CRISPR-Cas system and is a CRISRP RNA (crRNA)-guided endonuclease10. Unlike Cas9, Cpf1 introduces a DSB with a 4 or 5 nt 5&#39; overhang10. Based on this characteristic, Cpf1 was used to develop a DNA assembly standard, C-Brick4. On a C-Brick standard vector, four Cpf1 target sites of prefixed T1/T2 and suffixed T3/T4 flank the biological parts; this is similar to the BioBrick standard. As the cleavage of T2 and T3 sites produces complementary sticky ends, it is possible to perform the iterative assembly of DNA parts while generating a &#34;GGATCC&#34; scar between the parts. Notably, the C-Brick standard has two main advantages: recognizing long target sequences and leaving short scars. The 6 bp &#34;GGATCC&#34; scar generated by C-Brick encodes Gly-Ser, which allows for the construction of fusion proteins. Moreover, the C-Brick standard is also partially compatible with the BglBrick and BioBrick standards.

<table><tbody><tr><td>Comercial Oligonucleotide</td><td>Sangon Biotech</td><td></td><td></td></tr><tr><td>10x Taq PCR Buffer</td><td>Transgen</td><td>#J40928</td><td></td></tr><tr><td>Ultra Pure Distilled Water</td><td>Invitrogen</td><td>10977-015</td><td></td></tr><tr><td>5x RNA Transcription Buffer</td><td>Thermo Scientific</td><td>K0441</td><td></td></tr><tr><td>T7 RNA polymerase</td><td>Thermo Scientific</td><td>#EP0111</td><td></td></tr><tr><td>NTP mixture</td><td>Sangon</td><td>#ND0056</td><td></td></tr><tr><td>RRI (Recombinant RNase Inhibitor)</td><td>Takara</td><td>2313A</td><td></td></tr><tr><td>RNA Clean &amp;amp; Concentrator-5</td><td>Zymo Research</td><td>R1015</td><td></td></tr><tr><td>UV-Vis Spectrometer</td><td>Thermo Scientific</td><td>Nano-Drop 2000c</td><td></td></tr><tr><td>2x Phanta Max Buffer</td><td>Vazyme</td><td>PB505</td><td>PCR buffer</td></tr><tr><td>dNTPs</td><td>Transgen</td><td>AD101</td><td></td></tr><tr><td>Phanta Max Super-Fidelity DNA Polymerase</td><td>Vazyme</td><td>P505-d1</td><td></td></tr><tr><td>Ezmax for One-step Cloning</td><td>Tolobio</td><td>24303-1</td><td>seamless assembly kit</td></tr><tr><td>5x Buffer for Ezmax One-step Cloning</td><td>Tolobio</td><td>32006</td><td></td></tr><tr><td>BamHI</td><td>NEB</td><td>#R0136L</td><td></td></tr><tr><td>BamHI-HF</td><td>NEB</td><td>#R3136L</td><td></td></tr><tr><td>BglII&amp;nbsp;</td><td>NEB</td><td>#R0144L</td><td></td></tr><tr><td>XbaI</td><td>NEB</td><td>#R0145L</td><td></td></tr><tr><td>SpeI</td><td>NEB</td><td>#R3133L</td><td></td></tr><tr><td>10x Buffer 3</td><td>NEB</td><td>#B7003S</td><td></td></tr><tr><td>10x CutSmart Buffer</td><td>NEB</td><td>B7204S</td><td></td></tr><tr><td>10x T4 DNA ligase Buffer</td><td>Tolobio</td><td>32002</td><td></td></tr><tr><td>T4 PNK</td><td>Tolobio</td><td>32206</td><td></td></tr><tr><td>T4 DNA ligase</td><td>Tolobio</td><td>32210</td><td></td></tr><tr><td>DpnI</td><td>NEB</td><td>#R01762</td><td></td></tr><tr><td>SV Gel and PCR clean-up system</td><td>Promega</td><td>A9282</td><td></td></tr><tr><td>Plasmid Mini Kit I</td><td>Omega</td><td>D6943-02</td><td>plasmid preparation kit</td></tr><tr><td>thermosensitive alkaline phosphatase&amp;nbsp;</td><td>Thermo Scientific</td><td>#EF0651</td><td>FastAP</td></tr><tr><td>10x Cpf1 buffer</td><td>Tolobio</td><td>32008</td><td></td></tr><tr><td>Cpf1</td><td>Tolobio</td><td>32105</td><td>FnCpf1</td></tr><tr><td>thermocycler</td><td>Applied Biosystems</td><td>veriti 96 well</td><td></td></tr><tr><td>C-Brick standard vector</td><td>Tolobio</td><td>98101</td><td></td></tr><tr><td>E. coli [DH10B]</td><td>Invitrogen</td><td>18297010</td><td></td></tr><tr><td>Luria-Bertani media (tryptone)</td><td>Oxoid</td><td>LP0042</td><td></td></tr><tr><td>Luria-Bertani media (yeast extract)</td><td>Oxoid</td><td>LP0021</td><td></td></tr><tr><td>Luria-Bertani media (NaCl)</td><td>Sangon Biotech</td><td>B126BA0007</td><td></td></tr></tbody></table>

protocols for c-brick dna standard assembly using cpf1

CRISPR-associated protein Cpf1 cleaves double-stranded DNA under the guidance of CRISPR RNA (crRNA), generating sticky ends. Because of this characteristic, Cpf1 has been used for the establishment of a DNA assembly standard called C-Brick, which has the advantage of long recognition sites and short scars. On a standard C-Brick vector, there are four Cpf1 recognition sites &#8211; the prefix (T1 and T2 sites) and the suffix (T3 and T4 sites) &#8211; flanking biological DNA parts. The cleavage of T2 and T3 sites produces complementary sticky ends, which allow for the assembly of DNA parts with T2 and T3 sites. Meanwhile, a short &#34;GGATCC&#34; scar is generated between parts after assembly. As the newly formed plasmid once again contains the four Cpf1 cleavage sites, the method allows for the iterative assembly of DNA parts, which is similar to those of BioBrick and BglBrick standards. A procedure outlining the use of the C-Brick standard to assemble DNA parts is described here. The C-Brick standard can be widely used by scientists, graduate and undergraduate students, and even amateurs.

This protocol demonstrated the assembly of three chromoprotein cassettes (cjBlue (BBa_K592011), eforRed (BBa_K592012), and amilGFP (BBa_K592010)). First, the coding sequences of the three abovementioned genes and terminators were individually cloned into a C-Brick standard vector. Short DNA parts, promoter and terminator, were introduced into the C-Brick vector through PCR amplification using primers containing the short DNA parts on the 5&#39; terminal. This was followed by the self-liga...

Watch this Scientific Journal Video about Protocols for C-Brick DNA Standard Assembly Using Cpf1 at JoVE.com

Protocols for C-Brick DNA Standard Assembly Using Cpf1

CRISPR-associated protein Cpf1 can be guided by a specially designed CRISPR RNA (crRNA) to cleave double-stranded DNA at desired sites, generating sticky ends. Based on this characteristic, a DNA assembly standard (C-Brick) was established, and a protocol detailing its use is described here.

CRISPR-associated protein Cpf1 cleaves double-stranded DNA under the guidance of CRISPR RNA (crRNA), generating sticky ends. Because of this ...

protocols-for-c-brick-dna-standard-assembly-using-cpf1

Research

JoVE Journal

Genetics

8.2K Views.  Chinese Academy of Sciences.  CRISPR-geassocieerd eiwit Cpf1 kan geleid worden door een speciaal ontworpen CRISPR RNA (crRNA) om dubbelstrengs DNA op gewenste plaatsen te kloppen, waardoor kleverige einden worden geproduceerd. Op basis van dit kenmerk werd een DNA-assemblage standaard (C-Brick) opgericht, en hier wordt een protocol beschreven waarin het gebruik ervan wordt beschreven. 

Video: Protocols for C-Brick DNA Standard Assembly Using Cpf1

A Toolkit to Enable Hydrocarbon Conversion in Aqueous Environments

This work puts forward a toolkit that enables the conversion of alkanes by Escherichia coli and presents a proof of principle of its applicability. The toolkit consists of multiple standard interchangeable parts (BioBricks)9 addressing the conversion of alkanes, regulation of gene expression and survival in toxic hydrocarbon-rich environments.
A three-step pathway for alkane degradation was implemented in E. coli to enable the conversion of medium- and long-chain alkanes to their respective alkanols, alkanals and ultimately alkanoic-acids. The latter were metabolized via the native &beta;-oxidation pathway. To facilitate the oxidation of medium-chain alkanes (C5-C13) and cycloalkanes (C5-C8), four genes (alkB2, rubA3, rubA4and rubB) of the alkane hydroxylase system from Gordonia sp. TF68,21 were transformed into E. coli. For the conversion of long-chain alkanes (C15-C36), theladA gene from Geobacillus thermodenitrificans was implemented. For the required further steps of the degradation process, ADH and ALDH (originating from G. thermodenitrificans) were introduced10,11. The activity was measured by resting cell assays. For each oxidative step, enzyme activity was observed.
To optimize the process efficiency, the expression was only induced under low glucose conditions: a substrate-regulated promoter, pCaiF, was used. pCaiF is present in E. coli K12 and regulates the expression of the genes involved in the degradation of non-glucose carbon sources.
The last part of the toolkit - targeting survival - was implemented using solvent tolerance genes, PhPFD&alpha; and &beta;, both from Pyrococcus horikoshii OT3. Organic solvents can induce cell stress and decreased survivability by negatively affecting protein folding. As chaperones, PhPFD&alpha; and &beta; improve the protein folding process e.g. under the presence of alkanes. The expression of these genes led to an improved hydrocarbon tolerance shown by an increased growth rate (up to 50%) in the presences of 10% n-hexane in the culture medium were observed.
Summarizing, the results indicate that the toolkit enables E. coli to convert and tolerate hydrocarbons in aqueous environments. As such, it represents an initial step towards a sustainable solution for oil-remediation using a synthetic biology approach.

A sustainable auto regulating bacterial system for the remediation of oil pollutions was designed using standard interchangeable DNA parts (BioBricks). An engineered E. coli strain was used to degrade alkanes via &beta;-oxidation in toxic aqueous environments. The respective enzymes from different species showed alkane degradation activity. Additionally, an increased tolerance to n-hexane was achieved by introducing genes from alkane-tolerant bacteria.

This work puts forward a toolkit that enables the conversion of alkanes by Escherichia coli and presents a proof of principle of its applicability. The ...

Bioengineering

A Customizable Protocol for String Assembly gRNA Cloning (STAgR)

The bacterial CRISPR/Cas9 system has substantially increased methodological options for life scientists. Due to its utilization, genetic and genomic engineering became applicable to a large range of systems. Moreover, many transcriptional and epigenomic engineering approaches are now generally feasible for the first time. One reason for the broad applicability of CRISPR lies in its bipartite nature. Small gRNAs determine the genomic targets of the complex, variants of the protein Cas9, and the local molecular consequences. However, many CRISPR approaches depend on the simultaneous delivery of multiple gRNAs into individual cells. Here, we present a customizable protocol for string assembly gRNA cloning (STAgR), a method that allows the simple, fast and efficient generation of multiplexed gRNA expression vectors in a single cloning step. STAgR is cost-effective, since (in this protocol) the individual targeting sequences are introduced by short overhang primers while the long DNA templates of the gRNA expression cassettes can be re-used multiple times. Moreover, STAgR allows single step incorporation of a large number of gRNAs, as well as combinations of different gRNA variants, vectors and promoters.

A Customizable Protocol for String Assembly gRNA Cloning STAgR

Here, we present string assembly gRNA cloning (STAgR), a method to easily multiplex gRNA vectors for CRISPR/Cas9 approaches. STAgR makes gRNA multiplexing simple, efficient and customizable.

The bacterial CRISPR/Cas9 system has substantially increased methodological options for life scientists. Due to its utilization, genetic and genomic ...

Capturing Chromosome Conformation Across Length Scales

Chromosome conformation capture (3C) is used to detect three-dimensional chromatin interactions. Typically, chemical crosslinking with formaldehyde (FA) is used to fix chromatin interactions. Then, chromatin digestion with a restriction enzyme and subsequent religation of fragment ends converts three-dimensional (3D) proximity into unique ligation products. Finally, after reversal of crosslinks, protein removal, and DNA isolation, DNA is sheared and prepared for high-throughput sequencing. The frequency of proximity ligation of pairs of loci is a measure of the frequency of their colocalization in three-dimensional space in a cell population.
A sequenced Hi-C library provides genome-wide information on interaction frequencies between all pairs of loci. The resolution and precision of Hi-C relies on efficient crosslinking that maintains chromatin contacts and frequent and uniform fragmentation of the chromatin. This paper describes an improved in situ Hi-C protocol, Hi-C 3.0, that increases the efficiency of crosslinking by combining two crosslinkers (formaldehyde [FA] and disuccinimidyl glutarate [DSG]), followed by finer digestion using two restriction enzymes (DpnII and DdeI). Hi-C 3.0 is a single protocol for the accurate quantification of genome folding features at smaller scales such as loops and topologically associating domains (TADs), as well as features at larger nucleus-wide scales such as compartments.

Hi-C 3.0 is an improved Hi-C protocol that combines formaldehyde and disuccinimidyl glutarate crosslinkers with a cocktail of DpnII and DdeI restriction enzymes to increase the signal-to-noise ratio and the resolution of chromatin interaction detection.

Chromosome conformation capture (3C) is used to detect three-dimensional chromatin interactions. Typically, chemical crosslinking with formaldehyde (FA) ...

Stable DNA Motifs, 1D and 2D Nanostructures Constructed from Small Circular DNA Molecules

This article presents a detailed protocol for synthesis of small circular DNA molecules, annealing of circular DNA motifs, and construction of 1D and 2D DNA nanostructures. Over decades, the rapid development of DNA nanotechnology is attributed to the use of linear DNAs as the source materials. For example, the DAO (double crossover, antiparallel, odd half-turns) tile is well-known as a building block for construction of 2D DNA lattices; the core structure of DAO is made from two linear single-stranded (ss) oligonucleotides, like two ropes making a right hand granny&#160;knot. Herein, a new type of DNA tiles called cDAO (coupled DAO) are built using a small circular ss-DNA of c64nt or c84nt (circular 64 or 84 nucleotides) as the scaffold strand and several linear ss-DNAs as the staple strands. Perfect 1D and 2D nanostructures are assembled from cDAO tiles: infinite nanowires, nanospirals, nanotubes, nanoribbons; and finite nano-rectangles. Detailed protocols are described: 1) preparation by T4 ligase and purification by denaturing PAGE (polyacrylamide gel electrophoresis) of small circular oligonucleotides, 2) annealing of stable circular tiles, followed by native PAGE analysis, 3) assembling of infinite 1D nanowires, nanorings, nanospirals, infinite 2D lattices of nanotubes and nanoribbons, and finite 2D nano-rectangles, followed by AFM (Atomic Force Microscopy) imaging. The method is simple, robust, and affordable for most labs.

This article presents a detailed protocol for T4 ligation and denaturing PAGE purification of small circular DNA molecules, annealing and native PAGE analysis of circular tiles, assembling and AFM imaging of 1D and 2D DNA nanostructures, as well as agarose gel electrophoresis and centrifugation purification of finite DNA nanostructures.

This article presents a detailed protocol for synthesis of small circular DNA molecules, annealing of circular DNA motifs, and construction of 1D and 2D ...

Chemistry

Chromosome Conformation Capture (3C) for Undergraduate Research and Teaching

Getting an A with the 3Cs: Chromosome Conformation Capture for Undergraduates

Chromosome conformation capture (3C) is a powerful tool that has spawned a family of similar techniques (e.g., Hi-C, 4C, and 5C, referred to here as 3C techniques) that provide detailed information of the three-dimensional organization of chromatin. The 3C techniques have been used in a wide range of studies, from monitoring the changes in chromatin organization in cancer cells to identifying enhancer contacts made with gene promoters. While many of the studies using these techniques are asking big genome-wide questions with intricate sample types (i.e., single-cell analysis), what is often lost is that the 3C techniques are grounded in basic molecular biology methods that are applicable to a broad range of studies. By addressing tightly focused questions of chromatin organization, this cutting-edge technique can be used to enhance the undergraduate research and teaching lab experience. This paper presents a 3C protocol and provides adaptations and points of emphasis for implementation at primarily undergraduate institutions in undergraduate research and teaching experiences.

Author Spotlight: Getting an A with the 3Cs: Chromosome Conformation Capture for Undergraduates  

Here, we present an adaption of the chromosome conformation capture (3C) technique in detail with an emphasis on undergraduate involvement and learning.

Chromosome conformation capture (3C) is a powerful tool that has spawned a family of similar techniques (e.g., Hi-C, 4C, and 5C, referred to here as 3C ...

Design and Synthesis of a Reconfigurable DNA Accordion Rack

DNA nanostructure-based mechanical systems or DNA nanomachines, which produce complex nanoscale motion in 2D and 3D in the nanometer to &#229;ngstr&#246;m resolution, show great potential in various fields of nanotechnology such as the molecular reactors, drug delivery, and nanoplasmonic systems. The reconfigurable DNA accordion rack, which can collectively manipulate a 2D or 3D nanoscale network of elements, in multiple stages in response to the DNA inputs, is described. The platform has potential to increase the number of elements that DNA nanomachines can control from a few elements to a network scale with multiple stages of reconfiguration.
In this protocol, we describe the entire experimental process of the reconfigurable DNA accordion rack of 6 by 6 meshes. The protocol includes a design rule and simulation procedure of the structures and a wet-lab experiment for synthesis and reconfiguration. In addition, analysis of the structure using TEM (transmission electron microscopy) and FRET (fluorescence resonance energy transfer) is included in the protocol. The novel design and simulation methods covered in this protocol will assist researchers to use the DNA accordion rack for further applications.

We describe the detailed protocol for design, simulation, wet-lab experiments, and analysis for a reconfigurable DNA accordion rack of 6 by 6 meshes.

DNA nanostructure-based mechanical systems or DNA nanomachines, which produce complex nanoscale motion in 2D and 3D in the nanometer to &#229;ngstr&#246;m ...

Rapid Assembly of Multi-Gene Constructs using Modular Golden Gate Cloning

The Golden Gate cloning method enables the rapid assembly of multiple genes in any user-defined arrangement. It utilizes type IIS restriction enzymes that cut outside of their recognition sites and create a short overhang. This modular cloning (MoClo) system uses a hierarchical workflow in which different DNA parts, such as promoters, coding sequences (CDS), and terminators, are first cloned into an entry vector. Multiple entry vectors then assemble into transcription units. Several transcription units then connect into a multi-gene plasmid. The Golden Gate cloning strategy is of tremendous advantage because it allows scar-less, directional, and modular assembly in a one-pot reaction. The hierarchical workflow typically enables the facile cloning of a large variety of multi-gene constructs with no need for sequencing beyond entry vectors. The use of fluorescent protein dropouts enables easy visual screening. This work provides a detailed, step-by-step protocol for assembling multi-gene plasmids using the yeast modular cloning (MoClo) kit. We show optimal and suboptimal results of multi-gene plasmid assembly and provide a guide for screening for colonies. This cloning strategy is highly applicable for yeast metabolic engineering and other situations in which multi-gene plasmid cloning is required.

The goal of this protocol is to provide a detailed, step-by-step guide for assembling multi-gene constructs using the modular cloning system based on Golden Gate cloning. It also gives recommendations on critical steps to ensure optimal assembly based on our experiences.

The Golden Gate cloning method enables the rapid assembly of multiple genes in any user-defined arrangement. It utilizes type IIS restriction enzymes that ...

Recombineering Homologous Recombination Constructs in Drosophila

The continued development of techniques for fast, large-scale manipulation of endogenous gene loci will broaden the use of Drosophila melanogaster as a genetic model organism for human-disease related research. Recent years have seen technical advancements like homologous recombination and recombineering. However, generating unequivocal null mutations or tagging endogenous proteins remains a substantial effort for most genes. Here, we describe and demonstrate techniques for using recombineering-based cloning methods to generate vectors that can be used to target and manipulate endogenous loci in vivo. Specifically, we have established a combination of three technologies: (1) BAC transgenesis/recombineering, (2) ends-out homologous recombination and (3) Gateway technology to provide a robust, efficient and flexible method for manipulating endogenous genomic loci. In this protocol, we provide step-by-step details about how to (1) design individual vectors, (2) how to clone large fragments of genomic DNA into the homologous recombination vector using gap repair, and (3) how to replace or tag genes of interest within these vectors using a second round of recombineering. Finally, we will also provide a protocol for how to mobilize these cassettes in vivo to generate a knockout, or a tagged gene via knock-in. These methods can easily be adopted for multiple targets in parallel and provide a means for manipulating the Drosophila genome in a timely and efficient manner.

Recombineering Homologous Recombination Constructs in Drosophila

Homologous recombination techniques greatly advance Drosophila genetics by enabling the creation of molecularly precise mutations. The recent adoption of recombineering allows one to manipulate large pieces of DNA and transform them into Drosophila6. The methods presented here combine these techniques to rapidly generate large homologous recombination vectors.

The continued development of techniques for fast, large-scale manipulation of endogenous gene loci will broaden the use of Drosophila melanogaster as a ...

Biology

Generation of Plasmid Vectors Expressing FLAG-tagged Proteins Under the Regulation of Human Elongation Factor-1&#945; Promoter Using Gibson Assembly

Gibson assembly (GA) cloning offers a rapid, reliable, and flexible alternative to conventional DNA cloning methods. We used GA to create customized plasmids for expression of exogenous genes in mouse embryonic stem cells (mESCs). Expression of exogenous genes under the control of the SV40 or human cytomegalovirus promoters diminishes quickly after transfection into mESCs. A remedy for this diminished expression is to use the human elongation factor-1 alpha (hEF1&#945;) promoter to drive gene expression. Plasmid vectors containing hEF1&#945; are not as widely available as SV40- or CMV-containing plasmids, especially those also containing N-terminal 3xFLAG-tags. The protocol described here is a rapid method to create plasmids expressing FLAG-tagged CstF-64 and CstF-64 mutant under the expressional regulation of the hEF1&#945; promoter. GA uses a blend of DNA exonuclease, DNA polymerase and DNA ligase to make cloning of overlapping ends of DNA fragments possible. Based on the template DNAs we had available, we designed our constructs to be assembled into a single sequence. Our design used four DNA fragments: pcDNA 3.1 vector backbone, hEF1&#945; promoter part 1, hEF1&#945; promoter part 2 (which contained 3xFLAG-tag purchased as a double-stranded synthetic DNA fragment), and either CstF-64 or specific CstF-64 mutant. The sequences of these fragments were uploaded to a primer generation tool to design appropriate PCR primers for generating the DNA fragments. After PCR, DNA fragments were mixed with the vector containing the selective marker and the GA cloning reaction was assembled. Plasmids from individual transformed bacterial colonies were isolated. Initial screen of the plasmids was done by restriction digestion, followed by sequencing. In conclusion, GA allowed us to create customized plasmids for gene expression in 5 days, including construct screens and verification.

Synthesis of custom plasmids is labor and time consuming. This protocol describes the use of Gibson assembly cloning to reduce the work and duration of custom DNA cloning procedure. The protocol described also produces reliable tagged protein constructs for mammalian expression at similar cost to the traditional cut-and-paste DNA cloning.

Gibson assembly (GA) cloning offers a rapid, reliable, and flexible alternative to conventional DNA cloning methods. We used GA to create customized ...

Generation of Marked and Markerless Mutants in Model Cyanobacterial Species

Cyanobacteria are ecologically important organisms and potential platforms for production of biofuels and useful industrial products. Genetic manipulation of cyanobacteria, especially model organisms such as Synechocystis sp. PCC6803 and Synechococcus sp. PCC7002, is a key tool for both basic and applied research. Generation of unmarked mutants, whereby chromosomal alterations are introduced into a strain via insertion of an antibiotic resistance cassette (a manipulatable fragment of DNA containing one or more genes), followed by subsequent removal of this cassette using a negative selectable marker, is a particularly powerful technique. Unmarked mutants can be repeatedly genetically manipulated, allowing as many alterations to be introduced into a strain as desired. In addition, the absence of genes encoding antibiotic resistance proteins in the mutated strain is desirable, as it avoids the possibility of 'escape' of antibiotic resistant organisms into the environment. However, detailed methods for repeated rounds of genetic manipulation of cyanobacteria are not well described in the scientific literature. Here we provide a comprehensive description of this technique, which we have successfully used to generate mutants with multiple deletions, single point mutations within a gene of interest and insertion of novel gene cassettes.

Introducing multiple genomic alterations into cyanobacteria is an essential tool in the development of strains for industrial and basic research purposes. We describe a system for generating unmarked mutants in the model cyanobacterial species Synechocystis sp. PCC6803 and marked mutants in Synechococcus sp. PCC7002.

Cyanobacteria are ecologically important organisms and potential platforms for production of biofuels and useful industrial products. Genetic manipulation ...

Protocols for C-Brick DNA Standard Assembly Using Cpf1

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video