우리는 C-Brick 표준 개발 과정에서 기술 지원을 해주신 Shanghai Tolo Biotech에게 감사드립니다. 이 연구는 중국 과학 아카데미의 전략적 우선 순위 연구 프로그램 (Grant No. XDB19040200)의 교부금으로 지원되었다.

1. crRNA의 제조 <ol><li> crRNA 주형의 제조 <ol><li> RNase가없는 물에서 10 μM의 농도로 개별 올리고 뉴클레오티드 ( 표 1 )를 재현 탁하십시오. </li><li> 상단 스트랜드 올리고 뉴클레오티드 ( 표 1의 T7-F) 22.5 μL, 하단 스트랜드 올리고 뉴클레오티드 22.5 μL ( 표 1 ) 및 10 mL 어닐링 완충액 5 μL를 0.2 mL PCR 튜브에 첨가한다. 총 부피가 50 μL인지 확인하십시오. 참고 : 6 개의 서로 다른 하단 가닥 올리고 뉴클레오타이드가 표 1 에 나와 있으며, 각각은 상단 가닥 T7-F와 개별적으로 쌍을 이루어야합니다. 표 1의 소문자는 crRNA의 가이드 시퀀스로 전사 될 서열을 나타낸다. 10x Taq PCR 버퍼는 10x 어닐링 버퍼 대신 사용될 수 있습니다. </li><li> Thermocycler에 PCR 튜브를 놓습니다. </li><li> 어닐링 프로그램을 실행하십시오 : 95 ° C에서의 초기 변성5 분 후 95 ~ 20 ° C의 재사용 대기 시간, 온도 조절기에서 1 분당 1 ° C 감소. 참고 : 1.2.1 단계의 샘플을 즉시 사용하십시오. </li></ol></li><li> crRNA의 전사 및 정제 <ol><li> RNase가없는 물 38 μL, 단계 1.1.4의 템플리트 8 μL, 5x T7 전사 버퍼 20 μL, NTP 혼합물 (10 μM) 20 μL, 재조합 RNase 억제제 (RRI) 4 μL 및 10 1.5 ML microcentrifuge 튜브에 T7 RNA 중합 효소 μL. 총 부피가 100 μL인지 확인하십시오. </li><li> 미세 원심 분리 튜브를 밤새 37 ° C의 수 욕조에 두십시오 (약 16 시간 동안). </li><li> 전사 된 RNA를 정화하기 위해 RNA 정화 및 농축 키트를 사용하십시오. 제조업체의 프로토콜을 따르십시오. </li><li> UV-Vis 분광 광도계로 RNA를 정량하고 RNA를 10 μM의 농도로 희석하십시오. 즉시 샘플을 사용하거나 -80 ° C에 보관하십시오. 참고 : crRNA 시퀀스표 2 에 열거되어있다. </li></ol></li></ol> 2. C-Brick 부품의 제작 (C-Brick 표준 벡터에 생물학적 부품 삽입) 참고 :이 단계에는 세 가지 하위 단계가 있습니다. 짧은 생물학적 부분 ( 예 : 프로모터 및 터미네이터)의 경우 C-Brick 표준 벡터에 생물학적 부분을 삽입하기 위해 직접 PCR 방법을 사용하는 것이 가장 좋습니다 4 . 전체 벡터 시퀀스는 보충 데이터에 표시되며 접두사 및 접미사 시퀀스는 그림 1 (아래 2.1 단계)에 나와 있습니다. PCR을 통해 쉽게 얻을 수있는 생물학적 부분 ( 예 : 게놈 DNA, 플라스미드 또는 새롭게 합성 된 DNA 서열 템플릿)을 사용하면 C-Brick 표준 벡터에 생물학적 부분을 삽입하기 위해 끊김없는 조립 방법을 사용하는 것이 가장 좋습니다 (아래의 2.2 단계). BioBrick 및 BglBrick 표준에서 얻은 부품의 경우 제한효소 매개 소화 및 T4 DNA 리가 아제 매개 연결을 사용하여 생물학적 부분을 C- 브릭 표준 벡터 (아래의 단계 2.3)에 삽입 할 수 있습니다. <ol><li> 직접 PCR 증폭을 통한 구축 <ol><li> PCR 증폭을위한 올리고 뉴클레오타이드를 설계하고 주문하십시오. 참고 : 올리고 뉴클레오타이드의 5 &#39;말단은 DNA 부분의 서열을 포함하고, 올리고 뉴클레오타이드의 3&#39;말단은 벡터 서열 ( 즉, 정방향 가닥의 3 &#39;말단에 &quot;GGATCCACTAGTCTCTAGCTCG&quot;및 &quot;GGATCCTTTCTCCTCTTTCTAG&quot; 역 가닥에서). 올리고 뉴클레오타이드의 5&#39;- 말단에 오버행이 없거나 ~ 20-bp 오버행을 설계 할 수 있습니다. 구체적인 예는 이전의 연구 4 에서 찾을 수 있습니다. </li><li> 초순수에서 개별 올리고 뉴클레오타이드를 10 μM의 농도로 재현 탁하십시오. </li><li> 0.2 ML PCR 튜브 얼음에 PCR 반응을 설정합니다 : 초 순수한 물 18 μL, 2x P의 25 μL를 추가CR 완충액, dNTPs (10 μM) 1 μL, 단계 2.1.2에서 정방향 및 역방향 프라이머 (10 μM) 각각 2.5 μL, 주형으로 C- 브릭 표준 벡터 (50 ng) 0.5 μL, 고 충실도 DNA 중합 효소 총 부피가 50 μL인지 확인하십시오. </li><li> 튜브를 thermocycler에 직접 놓고 thermocycler 프로그램을 시작하십시오. 즉시 샘플을 사용하거나 동결하고 -20 ° C에서 보관하십시오. </li><li> Thermocycler 프로그램 : 98 ° C에서 3 분 동안 1 사이클; 98 ℃에서 10 초, 55 ℃에서 20 초, 72 ℃에서 2 분; 72 ℃에서 10 분 동안 1 사이클. 샘플을 16 ° C에 유지하십시오. </li><li> 단계 2.1.4에서 얻은 혼합물 9 μL를 1.5 mL 미세 원심 분리 튜브에 넣으십시오. </li><li> 1 μL의 DpnI를 첨가하고 37 ° C 수 욕조에서 1 시간 동안 배양하십시오. 참고 : 프라이머에 중첩 시퀀스가없는 경우 0.5 μL의 T4 폴리 뉴클레오타이드 키나아제 (PNK)와 0.5 μL의 T4 DNA 리가 제를 첨가하고1 시간 동안 22 ° C 수 욕조. 그렇지 않은 경우, 프라이머가 ~ 20nt 중첩 서열을 포함하고 있다면, DpnI 처리 제품을 대장균 (DH10B)에 적합한 세포로 직접 형질 전환 시킨다 (단계 2.4). 선형화 된 PCR 산물은 숙주 내에서 재조합 시스템에 의해 고리 화 될 것이다. </li><li> 즉시 샘플을 사용하거나 -20 ° C에 보관하십시오. </li></ol></li><li> 원활한 조립을 통한 시공 <ol><li> PCR 증폭을위한 올리고 뉴클레오타이드를 설계하고 주문하십시오. 참고 : 올리고 뉴클레오티드의 3 &#39;말단은 DNA 부분의 말단 서열을 포함하고, 올리고 뉴클레오타이드의 5&#39;- 말단은 선형화 된 C- 브릭 표준 벡터 서열의 말단을 함유한다 ( 즉, 5&#39;말단에 대해 &quot;CTAGAAAGAGGAGAAAGGATCC&quot; 역전 사슬의 5&#39;- 말단에 대한 &quot;CGAGCTAGAGACTAGTGGATCC&quot;). 구체적인 예는 이전의 연구 4 에서 찾을 수 있습니다. </li><li> 개인을 다시 일시 중지하십시오.10 μM의 농도로 초순수 중의 올리고 뉴클레오타이드를 제거합니다. </li><li> 0.2 ML PCR 튜브에서 얼음에 PCR 반응을 설정합니다 : 순전히 물 18 μL, 2 배 PCR 버퍼 25 μL, dNTPs (10 μM) 1 μL, 순방향 및 역방향 프라이머 각각 10 μM ), 0.5 μL의 template (20-500 ng) 및 0.5 μL의 high-fidelity DNA 중합 효소를 넣었다. 총 부피가 50 μL인지 확인하십시오. </li><li> 튜브를 thermocycler에 직접 놓고 thermocycler 프로그램을 실행하십시오. 즉시 샘플을 사용하거나 동결하고 -20 ° C에서 보관하십시오. 참고 : thermocycler 프로그램을 다음과 같이 설정하십시오 : 98 ° C에서 3 분 동안 한 번; 98 ℃에서 10 초, 55 ℃에서 20 초 (프라이머의 어닐링 온도에 따라), 1 분 (생물학적 부분의 길이에 따라) 72 ℃에서 30 사이클; 72 ℃에서 10 분 동안 1 사이클. 샘플을 16 ° C에 유지하십시오. </li><li> PCR 클린업 시스템을 사용하여 PCR 생성물을 정제하십시오.시험 키트; 제조업체의 프로토콜을 따르십시오. </li><li> BamHI로 C-Brick 표준 벡터를 분해하십시오 : 초순수 34 μL, 플라스미드 (1 μg) 10 μL, 10x 버퍼 5 μL 및 BamHI 1 μL를 미세 원심 분리 튜브에 첨가하십시오. 수 욕조에서 37 ° C에서 2 시간 동안 품어 낸다. </li><li> 위의 제품을 젤 클린업 시스템 키트를 사용하여 정제하십시오. 제조업체의 프로토콜을 따르십시오. </li><li> 2.2.7 단계의 선형화 된 벡터 (50 ng), 2.2.4 단계의 단편 (200 ng) 5 μL, 5 x 이음새없는 조립 버퍼 2 μL 및 이음새없는 조립 키트의 이음새없는 조립 효소 1 μL를 첨가하십시오 1.5 mL의 마이크로 원심 분리 관으로 옮깁니다. 총 부피는 10 μL입니다. </li><li> 30 분 동안 37 ° C 수조에 넣으십시오. 즉시 샘플을 사용하거나 동결하고 -20 ° C에서 보관하십시오. </li></ol></li><li> 제한 효소 - 매개 소화 및 T4 DNA 리가 제제 - 중재 결합을 통한 구축. 노트: BioBrick (단계 2.3.4-2.3.7) 및 BglBrick (단계 2.3.1-2.3.3) 표준에서 얻은 부품의 경우 제한 효소 매개 소화 및 T4 DNA 리가 아제 매개 연결을 사용하여 생물학적 인 부분을 C-Brick 표준 벡터로 변환합니다. <ol><li> BglHI과 BglII로 BglBrick 표준 부품을 소화합니다 : 초순수 34 μL, 플라스미드 (2 μg) 10 μL, 10x 버퍼 3 5 μL, BamHI 0.5 μL 및 BglII 0.5 μL를 미세 원심 분리 튜브에 첨가하십시오. 37 ° C 수 욕조에서 2 시간 동안 품어 낸다. </li><li> 1 % 아가로 오스 겔 전기 영동을 실행하고 겔 클린업 ​​시스템 키트를 사용하여 단편을 정제하십시오. </li><li> 단편과 C-Brick 표준 벡터를 합치십시오 : 단계 2.1.12의 선형화 된 벡터 (50 ng) 2 개와 단계 2.3.3의 단편 (200 ng) 6 μL를 1.5 mL 미세 원심 분리 튜브에 첨가하십시오. 10 X T4 DNA ligase 버퍼 1 μL와 T4 DNA ligase 1 μL를 첨가한다. 22 ° C에서 2 시간 동안 품어 낸다. 샘플을 즉시 사용하거나 정지하십시오.-20 ° C에서 보관하십시오. </li><li> XbaI 및 SpeI로 BioBrick 표준 부품을 소화합니다 : 34μL의 초순수, 10 μL의 플라스미드 (2 μg), 5 μL의 10 배 완충액, 0.5 μL의 XbaI 및 0.5 μL의 SpeI를 미세 원심 분리 튜브에 첨가하십시오. 37 ° C 수 욕조에서 2 시간 동안 품어 낸다. </li><li> XbaI 및 SpeI로 C-Brick 표준 벡터를 분해하십시오 : 초순수 34 μL, 플라스미드 (1 μg) 10 μL, 10 배 완충액 5 μL, XbaI 0.5 μL 및 SpeI 0.5 μL를 마이크로 원심 분리 관에 첨가하십시오 . 37 ° C 수 욕조에서 2 시간 동안 품어 낸다. </li><li> 1 % 아가 로즈 겔 전기 영동을 실행하고 겔 클린업 ​​시스템 키트로 2.3.4 단계의 단편과 2.3.5 단계의 선형화 된 벡터를 정제하십시오. 제조자의 프로토콜에 따라. </li><li> 단편과 C-Brick 벡터를 준비하십시오 : 단계 2.3.5의 선형화 된 벡터 (50 ng) 2 개와 단계 2.3.4의 단편 (200 ng) 6 μL를 1.5 mL 미세 원심 분리 튜브에 넣으십시오. 광고d 10 μL T4 DNA 리가 제 완충액 1 μL와 T4 DNA 리가 제 1 μL. 22 ° C에서 2 시간 동안 품어 낸다. 즉시 샘플을 사용하거나 동결하고 -20 ° C에서 보관하십시오. </li></ol></li><li> 단계 2.1.8, 2.2.9, 2.3.3 또는 2.3.7의 생성물 10 μL를 대장균 (DH10B)의 적격 세포로 화학적으로 변형시키기 위해 첨가한다. </li><li> 여러 클론을 5mL 액체 Luria-Bertani (LB) 튜브에 넣고 37 ℃에서 밤새 쉐이커 (220rpm)로 밤새 인큐베이터합니다. </li><li> 플라스미드 준비 키트를 사용하여 플라스미드를 추출합니다. 제조업체의 프로토콜을 따르십시오. </li><li> Sanger sequencing 11 에 의해 정확한 클론을 확인하십시오. </li></ol> 3. C- 브릭 어셈블리 ( 그림 2 ) <ol><li> C- 벽돌 벡터의 Cpf1 분해 <ol><li> RNase가없는 물 22.5 μL, 10x Cpf1 완충액 4 μL, 단계 2.6 (1 μg)의 플라스미드 10 μL, RRI 0.5 μL 및 1 &amp;# 181; Cpf1 (5 μM)을 1.5 mL 미세 원심 분리 튜브에 넣으십시오. 참고 : Cpf1은 상업적으로 구입하거나 이전 연구 4 의 프로토콜에 따라 정제 할 수 있습니다. </li><li> T1 및 T2 사이트에 외래 DNA 단편을 삽입하려면 1 μL의 crRNA-T2 (10 μM)를 첨가하고 37 ° C의 수조에서 30 분 동안 품을 때까지 기다리십시오. 추가 30 분 동안 1 μL의 crRNA-T1 (10 μM) 및 Cpf1 (5 μM)을 첨가 하였다. 참고 : 또는 T3 및 T4 부위에 외래 DNA 단편을 삽입하려면 1 μL의 crRNA-T3 (10 μM)를 첨가하고 37 ° C의 수조에서 30 분 동안 배양하십시오. 추가 30 분 동안 1 μL의 crRNA-T4 (10 μM)를 첨가한다. </li><li> 감수성 알칼리성 인산 가수 분해 효소 1 μL를 첨가하고 37 ℃에서 1 시간 동안 배양한다. </li><li> 아가 로스 겔 전기 영동을 실행하고 젤 클린업 시스템 키트를 사용하여 벡터를 정제하십시오. 즉시 샘플을 사용하거나 동결하고 -20 ° C에서 보관하십시오. </li></ol></li&gt; <li> Cpf1을 이용한 DNA 단편의 절단 <ol><li> RNase가없는 물 21.5 μL, 10x Cpf1 버퍼 4 μL, 단계 2.6 (2 μg), RRI 0.5 μL 및 Cpf1 (5 μM) 2 μL의 플라스미드 10 μL를 1.5 mL 미세 원심 분리 튜브에 넣으십시오. </li><li> T1 및 T2 사이트에 외인성 DNA 단편을 삽입하려면 crRNA-T1 (10 μM) 1 μL와 crRNA-T3 (10 μM) 1 μL를 넣고 37 ° C의 수조에서 2 시간 동안 품어줍니다. 참고 : 또는, crRNA-T2 (10 μM) 1 μL와 crRNA-T4 (10 μM) 1 μL를 넣고 37 ° C에서 2 시간 동안 수 욕조에서 품을 수 있습니다. </li><li> 아가 로스 겔 전기 영동을 실행하고 젤 클린업 시스템 키트를 사용하여 조각을 정화하십시오. 즉시 샘플을 사용하거나 동결하고 -20 ° C에서 보관하십시오. </li></ol></li><li> C-Brick 조립 및 추가 검증 <ol><li> 외래 DNA 단편과 C-Brick 벡터를 라이 게이션하십시오 : 2 μL의 선형화 된 벡터를 첨가하십시오50ng) 및 단계 3.2.3의 DNA 단편 (200ng) 6μL를 1.5mL 미세 원심 분리 튜브에 첨가 하였다. 10x T4 DNA ligase 버퍼 1 μL와 T4 DNA ligase 1 μL를 첨가한다. 22 ° C에서 2 시간 동안 품어 낸다. 즉시 샘플을 사용하거나 동결하고 -20 ° C에서 보관하십시오. </li><li> 대장균 (DH10B) - 유능한 세포로 화학 변형을위한 연결 제품 (단계 3.3.1) 10 μL를 추가합니다. </li><li> 5 ML 액체 LB 튜브에 여러 클론을 추가하고 220 RPM 및 37 ° C에서 쉐이커에서 밤새 품어. </li><li> 플라스미드 준비 키트를 사용하여 플라스미드를 추출합니다. 제조업체의 프로토콜을 따르십시오. </li><li> Sanger sequencing으로 정확한 클론을 확인하십시오. 11 . </li></ol></li><li> 새로운 C-Brick 어셈블리 라운드를 수행하십시오. 3.3.4 단계의 올바른 클론은 3.1-3.3 단계와 동일한 프로토콜에 따라 반복 C-Brick 어셈블리를위한 새로운 C-Brick 벡터 또는 DNA 파트로 사용할 수 있습니다. 참고 : T2 &#39;및 T3&#39;ites는 T2 및 T3 사이트 ( 그림 1a )의 백업으로 설계되었습니다. 2.3.7 단계에서 얻은 플라스미드의 경우, C-Brick 표준 어셈블리에는 T2 &#39;및 T3&#39;만 사용할 수 있습니다. </li></ol>

<ol>
	<li>Canton, B., Labno, A., Endy, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Refinement+and+standardization+of+synthetic+biological+parts+and+devices.">Refinement and standardization of synthetic biological parts and devices.</a> Nat Biotechnol. 26 (7), 787-793 (2008).</li><li>Shetty, R. P., Endy, D., Knight, T. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+BioBrick+vectors+from+BioBrick+parts.">Engineering BioBrick vectors from BioBrick parts.</a> J Biol Eng. 2, (2008).</li><li>Knight, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Idempotent Vector Design for Standard Assembly of Biobricks. , 1-11 (2003).</li><li>Li, S. Y., Zhao, G. P., Wang, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=C-Brick:+A+New+Standard+for+Assembly+of+Biological+Parts+Using+Cpf1.">C-Brick: A New Standard for Assembly of Biological Parts Using Cpf1.</a> ACS Synth Biol. 5 (12), 1383-1388 (2016).</li><li>Anderson, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BglBricks:+A+flexible+standard+for+biological+part+assembly.">BglBricks: A flexible standard for biological part assembly.</a> J Biol Eng. 4 (1), (2010).</li><li>Liu, J. K., Chen, W. H., Ren, S. X., Zhao, G. P., Wang, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=iBrick:+a+new+standard+for+iterative+assembly+of+biological+parts+with+homing+endonucleases.">iBrick: a new standard for iterative assembly of biological parts with homing endonucleases.</a> PLoS One. 9 (10), e110852 (2014).</li><li>Hsu, P. D., Lander, E. S., Zhang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+applications+of+CRISPR-Cas9+for+genome+engineering.">Development and applications of CRISPR-Cas9 for genome engineering.</a> Cell. 157 (6), 1262-1278 (2014).</li><li>Wright, A. V., Nunez, J. K., Doudna, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biology+and+Applications+of+CRISPR+Systems:+Harnessing+Nature's+Toolbox+for+Genome+Engineering.">Biology and Applications of CRISPR Systems: Harnessing Nature's Toolbox for Genome Engineering.</a> Cell. 164 (1-2), 29-44 (2016).</li><li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Zetsche, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cpf1+is+a+single+RNA-guided+endonuclease+of+a+class+2+CRISPR-Cas+system.">Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system.</a> Cell. 163 (3), 759-771 (2015).</li><li>Sanger, F., Nicklen, S., Coulson, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+sequencing+with+chain-terminating+inhibitors.">DNA sequencing with chain-terminating inhibitors.</a> Proc Natl Acad Sci U S A. 74 (12), 5463-5467 (1977).</li><li>Engler, C., Kandzia, R., Marillonnet, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+one+pot,+one+step,+precision+cloning+method.">A one pot, one step, precision cloning method.</a> PLoS One. 3 (11), e3647 (2008).</li><li>Gibson, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+assembly+of+DNA+molecules+up+to+several+hundred+kilobases.">Enzymatic assembly of DNA molecules up to several hundred kilobases.</a> Nat Methods. 6 (5), 343-345 (2009).</li><li>Casini, A., Storch, M., Baldwin, G. S., Ellis, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bricks+and+blueprints:+methods+and+standards+for+DNA+assembly.">Bricks and blueprints: methods and standards for DNA assembly.</a> Nat Rev Mol Cell Biol. 16 (9), 568-576 (2015).</li><li>Cameron, D. E., Bashor, C. J., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+brief+history+of+synthetic+biology.">A brief history of synthetic biology.</a> Nat Rev Microbiol. 12 (5), 381-390 (2014).</li><li>Keasling, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+biology+for+synthetic+chemistry.">Synthetic biology for synthetic chemistry.</a> ACS Chem Biol. 3 (1), 64-76 (2008).</li></ol>

저자는 공개 할 것이 없습니다.

이 프로토콜은 DNA 어셈블리 표준 C-Brick을위한 절차를 설명합니다. 이 프로토콜에서 가장 중요한 단계는 C-Brick 표준 벡터의 선형화입니다. 벡터가 불완전하게 절단되면 성공률에 심각한 영향을 줄 수 있습니다. 또한, Cpf1은 주로 &quot;18-23&quot;분열 패턴의 표적 DNA 서열을 절단하지만, 두 개의 염기 근처에서 부정확 한 절단이 또한 검출되었는데, 이는 DNA 조립 후 작은 수의 돌연변이를 일으킬 수있다...

DNA 생물학적 부분의 표준화는 합성 생물학 1 의 개발에 중요합니다. DNA 조립 절차의 개발은 임시 실험 설계를 대체 할 수 있고 유전체 구성 요소를 대형 시스템으로 조립하는 동안 발생하는 예기치 않은 결과를 제거 할 수 있습니다. BioBrick 표준 (BBF RFC 10)은 가장 초기에 제안 된 DNA 어셈블리 표준 중 하나였습니다. 접두어 시퀀스 (EcoRI 및 XbaI 절단 사이트 포함)와 접미사 시퀀스 (SpeI 및 PstI 절단 사이트 포함) 2 , 3을 사용 합니다. XbaI와 SpeI는 상호 보완적인 응집력을 지니고 있기 때문에 XbaI와 SpeI로 절단 된 BioBrick DNA 부품을 결합하여 추가 반복 조립을위한 새로운 BioBrick을 생성 할 수 있습니다. 일부 결함은 BioBrick 표준을 사용하여 확인되었습니다. 예를 들어, 8-bp 흉터를 생성합니다.융합 단백질을 만들 수없는 DNA 부분들 사이. 게다가 위에서 언급 한 네 종류의 6-bp 제한 효소 부위는 DNA 부분에서 제거해야하므로 매우 불편합니다. BglBrick 표준은 첫 번째 문제를 해결하기 위해 수립되었습니다. 5 . 이것은 6-bp의 &quot;GGATCT&quot;흉터를 만들어 Gly-Ser를 만들고 여러 단백질 또는 단백질 도메인의 융합을 허용합니다. iBrick은 두 번째 문제점 6 을 처리하기 위해 개발되었습니다. 그것은 긴 DNA 염기 서열을 인식하는 homing endonucleases (HE)를 사용합니다. HE 인식 사이트가 천연 DNA 서열에는 거의 존재하지 않기 때문에, iBrick 표준은 DNA 서열을 수정하지 않고 iBrick 부품의 직접 건설에 사용될 수 있습니다. 그러나 iBrick 표준은 DNA 부분 사이에 21bp의 흉터를 남겨 둡니다. 이는 인기가없는 이유 일 수 있습니다. 최근 몇 년 동안, 클러스터 된 정기적으로 interresaced 짧은 palindromic 반복 (CRISPR) 시스템이 급속히 발전했다. CRISPR- 관련 (Cas) 단백질 중에서, Streptococcus pyogenes 로부터의 Cas9 엔도 뉴 클레아 제가 현재 널리 사용되고있다. 주로 둔기가있는 이중 가닥 DNA 브레이크 (DSB)를 도입합니다. 2015 년 Zhang과 동료들은 처음으로 Cpf1 ( Prevotella 와 Francisella의 CRISPR)을 특징으로했습니다. 그것은 클래스 2 유형 V CRISPR-Cas 시스템에 속하며 CRISRP RNA (crRNA) 유도 된 endonuclease 10 입니다. Cas9와는 달리, Cpf1은 4 또는 5 nt의 5 &#39;오버행을 갖는 DSB를 도입한다. 이 특성을 바탕으로 Cpf1은 DNA 어셈블리 표준 인 C-Brick 4 를 개발하는 데 사용되었습니다. C-Brick 표준 벡터에서, 접두어가 붙은 T1 / T2와 접미사가 붙은 T3 / T4의 4 개의 Cpf1 표적 부위는 생물학적 부분에 인접 해 있습니다. 이는 BioBrick 표준과 유사합니다. T2 및 T3 부위의 절단으로서상보적인 끈적 끈적한 말단이 생기면 DNA 부분의 반복적 인 조립을 수행하는 동시에 부품들 사이에 &quot;GGATCC&quot;흉터를 생성 할 수 있습니다. 특히, C-Brick 표준에는 긴 대상 시퀀스 인식과 짧은 흉터 남기기라는 두 가지 주요 이점이 있습니다. C-Brick이 만든 6 bp &quot;GGATCC&quot;흉터는 Gly-Ser를 암호화하며 융합 단백질을 만들 수 있습니다. 또한 C-Brick 표준은 BglBrick 및 BioBrick 표준과 부분적으로 호환됩니다.

<table border="0" cellpadding="0" cellspacing="0" width="828">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Comercial Oligonucleotide</td>
			<td style="width:160px;">Sangon Biotech</td>
			<td style="width:161px;"></td>
			<td style="width:191px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">10x Taq PCR Buffer</td>
			<td style="width:160px;">Transgen</td>
			<td style="width:161px;">#J40928</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Ultra Pure Distilled Water</td>
			<td style="width:160px;">Invitrogen</td>
			<td style="width:161px;">10977-015</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">5x RNA Transcription Buffer</td>
			<td style="width:160px;">Thermo Scientific</td>
			<td style="width:161px;">K0441</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">T7 RNA polymerase</td>
			<td style="width:160px;">Thermo Scientific</td>
			<td style="width:161px;">#EP0111</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">NTP mixture</td>
			<td style="width:160px;">Sangon</td>
			<td style="width:161px;">#ND0056</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">RRI(Recombinant RNase Inhibitor)</td>
			<td style="width:160px;">Takara</td>
			<td style="width:161px;">2313A</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">RNA Clean &#38; Concentrator-5</td>
			<td style="width:160px;">Zymo Research</td>
			<td style="width:161px;">R1015</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">UV-Vis Spectrometer</td>
			<td style="width:160px;">Thermo Scientific</td>
			<td style="width:161px;">Nano-Drop 2000c</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">2x Phanta Max Buffer</td>
			<td style="width:160px;">Vazyme</td>
			<td style="width:161px;">PB505</td>
			<td>PCR buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">dNTPs</td>
			<td style="width:160px;">Transgen</td>
			<td style="width:161px;">AD101</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:316px;">Phanta Max Super-Fidelity DNA Polymerase</td>
			<td style="width:160px;">Vazyme</td>
			<td style="width:161px;">P505-d1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Ezmax for One-step Cloning</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">24303-1</td>
			<td>seamless assembly kit</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">5x Buffer for Ezmax One-step Cloning</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">32006</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">BamHI</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#R0136L</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">BamHI-HF</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#R3136L</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">BglII&#160;</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#R0144L</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">XbaI</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#R0145L</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">SpeI</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#R3133L</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">10x Buffer 3</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#B7003S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">10x CutSmart Buffer</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">B7204S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">10x T4 DNA ligase Buffer</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">32002</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">T4 PNK</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">32206</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">T4 DNA ligase</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">32210</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">DpnI</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#R01762</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">SV Gel and PCR clean-up system</td>
			<td style="width:160px;">Promega</td>
			<td style="width:161px;">A9282</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Plasmid Mini Kit I</td>
			<td style="width:160px;">Omega</td>
			<td style="width:161px;">D6943-02</td>
			<td>plasmid preparation kit</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">thermosensitive alkaline phosphatase&#160;</td>
			<td style="width:160px;">Thermo Scientific</td>
			<td style="width:161px;">#EF0651</td>
			<td>FastAP</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">10x Cpf1 buffer</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">32008</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Cpf1</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">32105</td>
			<td>FnCpf1</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">thermocycler</td>
			<td style="width:160px;">Applied Biosystems</td>
			<td style="width:161px;">veriti 96 well</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">C-Brick standard vector</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">98101</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">E. coli [DH10B]</td>
			<td style="width:160px;">Invitrogen</td>
			<td style="width:161px;">18297010</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Luria-Bertani media (tryptone)</td>
			<td style="width:160px;">Oxoid</td>
			<td style="width:161px;">LP0042</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Luria-Bertani media (yeast extract)</td>
			<td style="width:160px;">Oxoid</td>
			<td style="width:161px;">LP0021</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Luria-Bertani media (NaCl)</td>
			<td style="width:160px;">Sangon Biotech</td>
			<td style="width:161px;">B126BA0007</td>
			<td></td>
		</tr>
	</tbody>
</table>

protocols for c-brick dna standard assembly using cpf1

CRISPR 관련 단백질 Cpf1은 CRISPR RNA (crRNA)의지도하에 이중 가닥 DNA를 절단하여 끈적 거리는 말단을 생성합니다. 이러한 특성 때문에 Cpf1은 C- 브릭 (C-Brick)이라는 DNA 어셈블리 표준의 확립에 사용되어 오랜 인식 사이트와 짧은 흉터의 장점을 가지고 있습니다. 표준 C-Brick 벡터에는 접두어 (T1 및 T2 사이트)와 접미어 (T3 및 T4 사이트) - 생물학적 DNA 부분이 인접한 4 개의 Cpf1 인식 사이트가 있습니다. T2 및 T3 부위의 절단은 상보적인 끈적한 말단을 생성하여 T2 및 T3 부위를 갖는 DNA 부분의 조립을 허용한다. 한편 조립 후 부품 사이에는 짧은 &quot;GGATCC&quot;흉터가 생깁니다. 새로 형성된 플라스미드가 다시 4 개의 Cpf1 절단 부위를 포함하기 때문에이 방법은 BioBrick 및 BglBrick 표준과 유사한 DNA 부분의 반복적 조립을 가능하게합니다. C-Brick 표준을 사용하여 DNA 부품을 조립하는 절차여기에 설명되어 있습니다. C-Brick 표준은 과학자, 대학원생, 학부생, 심지어 아마추어들까지 광범위하게 사용할 수 있습니다.

<html> 이 프로토콜은 세 가지 색소 카세트 (cjBlue (BBa_K592011), eforRed (BBa_K592012) 및 amilGFP (BBa_K592010))의 조립을 시연했습니다. 먼저, 상기 3 가지 유전자 및 터미네이터의 코딩 서열을 개별적으로 C- 브릭 표준 벡터에 클로닝 하였다. 5 &#39;말단에 짧은 DNA 부분을 포함하는 프라이머를 사용하여 PCR 증폭을 통해 짧은 DNA 부분, 프로모터 및 터미네이터를 C-Brick 벡터에 도입 하였다. 이...

Watch this Scientific Journal Video about Protocols for C-Brick DNA Standard Assembly Using Cpf1 at JoVE.com

Protocols for C-Brick DNA Standard Assembly Using Cpf1

CRISPR 관련 단백질 Cpf1은 원하는 위치에서 이중 가닥 DNA를 절단하여 끈적 거리는 말단을 생성하도록 특별히 고안된 CRISPR RNA (crRNA)에 의해 유도 될 수 있습니다. 이 특성을 바탕으로 DNA 어셈블리 표준 (C-Brick)이 수립되었으며 여기에 그 사용법을 자세히 설명하는 프로토콜이 설명되어 있습니다.

Cpf1을 이용한 C-Brick DNA 표준 어셈블리 프로토콜

CRISPR-associated protein Cpf1 cleaves double-stranded DNA under the guidance of CRISPR RNA (crRNA), generating sticky ends. Because of this ...

protocols-for-c-brick-dna-standard-assembly-using-cpf1

Research

JoVE Journal

Genetics

8.2K 조회수.  Chinese Academy of Sciences.  CRISPR 관련 단백질 Cpf1은 원하는 위치에서 이중 가닥 DNA를 절단하여 끈적 거리는 말단을 생성하도록 특별히 고안된 CRISPR RNA (crRNA)에 의해 유도 될 수 있습니다. 이 특성을 바탕으로 DNA 어셈블리 표준 (C-Brick)이 수립되었으며 여기에 그 사용법을 자세히 설명하는 프로토콜이 설명되어 있습니다. 

비디오: Protocols for C-Brick DNA Standard Assembly Using Cpf1

Methyl-binding DNA capture Sequencing for Patient Tissues

Methylation is one of the essential epigenetic modifications to the DNA, which is responsible for the precise regulation of genes required for stable development and differentiation of different tissue types. Dysregulation of this process is often the hallmark of various diseases like cancer. Here, we outline one of the recent sequencing techniques, Methyl-Binding DNA Capture sequencing (MBDCap-seq), used to quantify methylation in various normal and disease tissues for large patient cohorts. We describe a detailed protocol of this affinity enrichment approach along with a bioinformatics pipeline to achieve optimal quantification. This technique has been used to sequence hundreds of patients across various cancer types as a part of the 1,000 methylome project (Cancer Methylome System).

Here we present a protocol to investigate genome wide DNA methylation in large scale clinical patient screening studies using the Methyl-Binding DNA Capture sequencing (MBDCap-seq or MBD-seq) technology and the subsequent bioinformatics analysis pipeline.

환자 조직에 대한 메틸 결합 DNA 캡처 시퀀싱

Methylation is one of the essential epigenetic modifications to the DNA, which is responsible for the precise regulation of genes required for stable ...

연구

유전학

Determination of the Optimal Chromosomal Location(s) for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In bacteria, the impact of the genetic context on the function of a genetic element can be difficult to assess. Several mechanisms, including topological effects, transcriptional interference from neighboring genes, and/or replication-associated gene dosage, may affect the function of a given genetic element. Here, we describe a method that permits the random integration of a DNA element into the chromosome of Escherichia coli and select the most favorable locations using a simple growth competition experiment. The method takes advantage of a well-described transposon-based system of random insertion, coupled with a selection of the fittest clone(s) by growth advantage, a procedure that is easily adjustable to experimental needs. The nature of the fittest clone(s) can be determined by whole-genome sequencing on a complex multi-clonal population or by easy gene walking for the rapid identification of selected clones. Here, the non-coding DNA region DARS2, which controls the initiation of chromosome replication in E. coli, was used as an example. The function of DARS2 is known to be affected by replication-associated gene dosage; the closer DARS2 gets to the origin of DNA replication, the more active it becomes. DARS2 was randomly inserted into the chromosome of a DARS2-deleted strain. The resultant clones containing individual insertions were pooled and competed against one another for hundreds of generations. Finally, the fittest clones were characterized and found to contain DARS2 inserted in close proximity to the original DARS2 location.

Determination of the Optimal Chromosomal Locations for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

Here, the power of a transposon-mediated random insertion of a non-coding DNA element was used to resolve its optimal chromosomal position.

소설 Transposon 중재 방식을 사용 하 여 대장균 의 DNA 요소에 대 한 최적의 염색체 위치 결정

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In ...

Immunostaining for DNA Modifications: Computational Analysis of Confocal Images

For several decades, 5-methylcytosine (5mC) has been thought to be the only DNA modification with a functional significance in metazoans. The discovery of enzymatic oxidation of 5mC to 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC) as well as detection of N6-methyladenine (6mA) in the DNA of multicellular organisms provided additional degrees of complexity to the epigenetic research. According to a growing body of experimental evidence, these novel DNA modifications may play specific roles in different cellular and developmental processes. Importantly, as some of these marks (e. g. 5hmC, 5fC and 5caC) exhibit tissue- and developmental stage-specific occurrence in vertebrates, immunochemistry represents an important tool allowing assessment of spatial distribution of DNA modifications in different biological contexts. Here the methods for computational analysis of DNA modifications visualized by immunostaining followed by confocal microscopy are described. Specifically, the generation of 2.5 dimension (2.5D) signal intensity plots, signal intensity profiles, quantification of staining intensity in multiple cells and determination of signal colocalization coefficients are shown. Collectively, these techniques may be operational in evaluating the levels and localization of these DNA modifications in the nucleus, contributing to elucidating their biological roles in metazoans.

Newly discovered oxidized forms of 5-methylcytosine (oxi-mCs), 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC) may represent distinct DNA modifications with unique functional roles. Here a semi-quantitative workflow for visualization of oxi-mCs' spatial distribution, signal intensity profiling and colocalization is described.

DNA 수정에 대 한 Immunostaining: 공초점 이미지의 계산 분석

For several decades, 5-methylcytosine (5mC) has been thought to be the only DNA modification with a functional significance in metazoans. The discovery of ...

Profiling DNA Replication Timing Using Zebrafish as an In Vivo Model System

DNA replication timing is an important cellular characteristic, exhibiting significant relationships with chromatin structure, transcription, and DNA mutation rates. Changes in replication timing occur during development and in cancer, but the role replication timing plays in development and disease is not known. Zebrafish were recently established as an in vivo model system to study replication timing. Here is detailed the protocols for using the zebrafish to determine DNA replication timing. After sorting cells from embryos and adult zebrafish, high-resolution genome-wide DNA replication timing patterns can be constructed by determining changes in DNA copy number through analysis of next generation sequencing data. The zebrafish model system allows for evaluation of the replication timing changes that occur in vivo throughout development, and can also be used to assess changes in individual cell types, disease models, or mutant lines. These methods will enable studies investigating the mechanisms and determinants of replication timing establishment and maintenance during development, the role replication timing plays in mutations and tumorigenesis, and the effects of perturbing replication timing on development and disease.

Profiling DNA Replication Timing Using Zebrafish as an In Vivo Model System

Zebrafish were recently used as an in vivo model system to study DNA replication timing during development. Here is detailed the protocols for using zebrafish embryos to profile replication timing. This protocol can be easily adapted to study replication timing in mutants, individual cell types, disease models, and other species.

DNA 복제 타이밍 Zebrafish Vivo에서 모델 시스템으로 사용 하 여 프로 파일링

DNA replication timing is an important cellular characteristic, exhibiting significant relationships with chromatin structure, transcription, and DNA ...

Investigation of Protein Recruitment to DNA Lesions Using 405 Nm Laser Micro-irradiation

The DNA Damage Response (DDR) uses a plethora of proteins to detect, signal, and repair DNA lesions. Delineating this response is critical to understand genome maintenance mechanisms. Since recruitment and exchange of proteins at lesions are highly dynamic, their study requires the ability to generate DNA damage in a rapid and spatially-delimited manner. Here, we describe procedures to locally induce DNA damage in human cells using a commonly available laser-scanning confocal microscope equipped with a 405 nm laser line. Accumulation of genome maintenance factors at laser stripes can be assessed by immunofluorescence (IF) or in real-time using proteins tagged with fluorescent reporters. Using phosphorylated histone H2A.X (&#947;-H2A.X) and Replication Protein A (RPA) as markers, the method provides sufficient resolution to discriminate locally-recruited factors from those that spread on adjacent chromatin. We further provide ImageJ-based scripts to efficiently monitor the kinetics of protein relocalization at DNA damage sites. These refinements greatly simplify the study of the DDR dynamics.

Studying DNA damage repair kinetics requires a system to induce lesions at defined sub-nuclear regions. We describe a method to create localized double-stranded breaks using a laser-scanning confocal microscope equipped with a 405 nm laser and provide automated procedures to quantify the dynamics of repair factors at these lesions.

단백질 DNA 장애 405 Nm 레이저 마이크로 방사선 조사를 사용 하 여 채용의 조사

The DNA Damage Response (DDR) uses a plethora of proteins to detect, signal, and repair DNA lesions. Delineating this response is critical to understand ...

Rare Event Detection Using Error-corrected DNA and RNA Sequencing

Conventional next-generation sequencing techniques (NGS) have allowed for immense genomic characterization for over a decade. Specifically, NGS has been used to analyze the spectrum of clonal mutations in malignancy. Though far more efficient than traditional Sanger methods, NGS struggles with identifying rare clonal and subclonal mutations due to its high error rate of ~0.5&#8211;2.0%. Thus, standard NGS has a limit of detection for mutations that are &#62;0.02 variant allele fraction (VAF). While the clinical significance for mutations this rare in patients without known disease remains unclear, patients treated for leukemia have significantly improved outcomes when residual disease is &#60;0.0001 by flow cytometry. In order to mitigate this artefactual background of NGS, numerous methods have been developed. Here we describe a method for Error-corrected DNA and RNA Sequencing (ECS), which involves tagging individual molecules with both a 16 bp random index for error-correction and an 8 bp patient-specific index for multiplexing. Our method can detect and track clonal mutations at variant allele fractions (VAFs) two orders of magnitude lower than the detection limit of NGS and as rare as 0.0001 VAF.

Next-generation sequencing (NGS) is a powerful tool for genomic characterization that is limited by the high error rate of the platform (~0.5&#8211;2.0%). We describe our methods of error-corrected sequencing that allow us to obviate the NGS error rate and detect mutations at variant allele fractions as rare as 0.0001.

드문 이벤트 감지 오류 수정 DNA와 RNA 시퀀싱을 사용 하 여

Conventional next-generation sequencing techniques (NGS) have allowed for immense genomic characterization for over a decade. Specifically, NGS has been ...

Methodology for Accurate Detection of Mitochondrial DNA Methylation

Quantification of DNA methylation can be achieved using bisulfite sequencing, which takes advantage of the property of sodium bisulfite to convert unmethylated cytosine into uracil, in a single-stranded DNA context. Bisulfite sequencing can be targeted (using PCR) or performed on the whole genome and provides absolute quantification of cytosine methylation at the single base-resolution. Given the distinct nature of nuclear- and mitochondrial DNA, notably in the secondary structure, adaptions of bisulfite sequencing methods for investigating cytosine methylation in mtDNA should be made. Secondary and tertiary structure of mtDNA can indeed lead to bisulfite sequencing artifacts leading to false-positives due to incomplete denaturation poor access of bisulfite to single-stranded DNA. Here, we describe a protocol using an enzymatic digestion of DNA with BamHI coupled with bioinformatic analysis pipeline to allow accurate quantification of cytosine methylation levels in mtDNA. In addition, we provide guidelines for designing the bisulfite sequencing primers specific to mtDNA, in order to avoid targeting undesirable NUclear MiTochondrial segments (NUMTs) inserted into the nuclear genome.

Here, we present a protocol to allow accurate quantification of mitochondrial DNA (mtDNA) methylation. In this protocol, we describe an enzymatic digestion of DNA with BamHI coupled with a bioinformatic analysis pipeline which can be used to avoid overestimation of mtDNA methylation levels caused by the secondary structure of mtDNA.

미토 콘 드리 아 DNA 메 틸 화의 정확한 탐지를 위한 방법론

Quantification of DNA methylation can be achieved using bisulfite sequencing, which takes advantage of the property of sodium bisulfite to convert ...

A Customizable Protocol for String Assembly gRNA Cloning (STAgR)

The bacterial CRISPR/Cas9 system has substantially increased methodological options for life scientists. Due to its utilization, genetic and genomic engineering became applicable to a large range of systems. Moreover, many transcriptional and epigenomic engineering approaches are now generally feasible for the first time. One reason for the broad applicability of CRISPR lies in its bipartite nature. Small gRNAs determine the genomic targets of the complex, variants of the protein Cas9, and the local molecular consequences. However, many CRISPR approaches depend on the simultaneous delivery of multiple gRNAs into individual cells. Here, we present a customizable protocol for string assembly gRNA cloning (STAgR), a method that allows the simple, fast and efficient generation of multiplexed gRNA expression vectors in a single cloning step. STAgR is cost-effective, since (in this protocol) the individual targeting sequences are introduced by short overhang primers while the long DNA templates of the gRNA expression cassettes can be re-used multiple times. Moreover, STAgR allows single step incorporation of a large number of gRNAs, as well as combinations of different gRNA variants, vectors and promoters.

A Customizable Protocol for String Assembly gRNA Cloning STAgR

Here, we present string assembly gRNA cloning (STAgR), a method to easily multiplex gRNA vectors for CRISPR/Cas9 approaches. STAgR makes gRNA multiplexing simple, efficient and customizable.

사용자 정의 프로토콜 문자열 어셈블리 gRNA에 대 한 복제 (STAgR)

The bacterial CRISPR/Cas9 system has substantially increased methodological options for life scientists. Due to its utilization, genetic and genomic ...

Assessing Stem Cell DNA Integrity for Cardiac Cell Therapy

Stem and stem-cell-derived cells have immense potential as a regenerative therapy for various degenerative diseases. DNA is the storehouse of genetic data in all cells, including stem cells, and its integrity is fundamental to its regenerative ability. Stem cells undergo rapid propagation in labs to achieve the necessary numbers for transplantation. Accelerated cell growth leads to the loss of DNA integrity by accumulated metabolites, such as reactive oxygen, carbonyl, and alkylating agents. Transplanting these cells would result in poor engraftment and regeneration of the deteriorating organ. Moreover, transplanting DNA-damaged cells leads to mutations, DNA instability, cellular senescence, and possibly, life-threatening diseases such as cancer. Therefore, there is an immediate need for a quality control method to evaluate the cell's suitability for transplantation. Here, we provide step-by-step protocols for the assessment of the DNA integrity of stem cells prior to cell transplantation.

Here, we provide a detailed description of an experimental setup for an analysis of the assessment of DNA integrity in stem cells prior to cell transplantation.

심장 세포 치료를 위한 줄기 세포 DNA 무결성을 평가

Stem and stem-cell-derived cells have immense potential as a regenerative therapy for various degenerative diseases. DNA is the storehouse of genetic data ...

High-Throughput DNA Plasmid Multiplexing and Transfection Using Acoustic Nanodispensing Technology

Cell transfection, indispensable for many biological studies, requires controlling many parameters for an accurate and successful achievement. Most often performed at low throughput, it is moreover time-consuming and error-prone, even more so when multiplexing several plasmids. We developed an easy, fast, and accurate method to perform cell transfection in a 384-well plate layout using acoustic droplet ejection (ADE) technology. The nanodispenser device used in this study&#160;is based on this technology and allows precise nanovolume delivery at high speed from a source well plate to a destination one. It can dispense and multiplex DNA and transfection reagent according to a predesigned spreadsheet. Here we present an optimal protocol to perform ADE-based high-throughput plasmid transfection which makes it possible to reach an efficiency of up to 90% and a nearly 100% cotransfection in cotransfection experiments. We extend initial work by proposing a user-friendly spreadsheet-based macro, able to manage up to four plasmids/wells from a library containing up to 1,536 different plasmids, and a tablet-based pipetting guide application. The macro designs the necessary template(s) of the source plate(s) and generates the ready-to-use files for the nanodispenser and tablet-based application. The four-steps transfection protocol involves i) a diluent dispense with a classical liquid handler, ii) plasmid distribution and multiplexing, iii) a transfection reagent dispense by the nanodispenser, and iv) cell plating on the prefilled wells. The described software-based control of ADE plasmid multiplexing and transfection allows even nonspecialists in the field to perform a reliable cell transfection in a fast and safe way. This method enables rapid identification of optimal settings for a given cell type and can be transposed to higher-scale and manual approaches. The protocol eases applications, such as human ORFeome protein (set of open reading frames [ORFs] in a genome) expression or CRISPR-Cas9-based gene function validation, in nonpooled screening strategies.

This protocol describes high-throughput plasmid transfection of mammalian cells in a 384-well plate using acoustic droplet ejection technology. The time-consuming, error-prone DNA dispensing and multiplexing, but also the transfection reagent dispensing, are software-driven and performed by a nanodispenser device. The cells are then seeded in these prefilled wells.

음향 나노 디스펜싱 기술을 사용한 고처리량 DNA 플라스미드 멀티플렉싱 및 트랜스펙션

Cell transfection, indispensable for many biological studies, requires controlling many parameters for an accurate and successful achievement. Most often ...