Ringraziamo Shanghai Tolo Biotech per la loro assistenza tecnica durante lo sviluppo del C-Brick standard. Questo lavoro è stato sostenuto da sovvenzioni del Programma di Ricerca di Priorità Strategica dell&#39;Accademia Cinese delle Scienze (Grant No. XDB19040200).

1. Preparazione di crRNA <ol><li> Preparazione di modelli di crRNA <ol><li> Riassemblare singoli oligonucleotidi ( Tabella 1 ) in acqua libera da RNasi a una concentrazione di 10 μM. </li><li> Aggiungere 22,5 μL di oligonucleotide di prima riga (T7-F nella tabella 1 ), 22,5 μL oligonucleotide a filo di fondo ( Tabella 1 ) e 5 μl di tampone di ricottura 10 volte a un tubo PCR da 0,2 ml. Assicurarsi che il volume totale sia di 50 μL. NOTA: Sei differenti oligonucleotidi di fondo sono riportati nella Tabella 1 , ognuno dei quali deve essere accoppiato singolarmente con il top-strand T7-F. Le lettere minuscole della Tabella 1 rappresentano la sequenza da trascrivere nella sequenza di guida di crRNA. Può essere utilizzato 10x Taq PCR buffer invece del buffer di ricottura 10x. </li><li> Posizionare il tubo PCR in un termociclatore. </li><li> Eseguire il programma di ricottura: denaturazione iniziale a 95 ° C per5 min e poi un cooldown da 95-20 ° C, con una diminuzione di 1 ° C per min sul termociclatore. NOTA: Utilizzare immediatamente i campioni per la fase 1.2.1. </li></ol></li><li> Trascrizione e purificazione di crRNA <ol><li> Aggiungere 38 μl di acqua priva di RNasi, 8 μl di template dalla fase 1.1.4, 20 μl di 5x T7 tolleratore di transcrizione, 20 μL di miscela NTP (10 μM), 4 μL di inibitore RNasi ricombinante (RRI) e 10 ΜL di T7 RNA polimerasi in un tubo da 1,5 ml di microcentrifuga. Assicurarsi che il volume totale sia di 100 μL. </li><li> Mettere il tubo di microcentrifuga in un bagno d&#39;acqua di 37 ° C per una notte (per circa 16 ore). </li><li> Utilizzare un kit di pulizia e concentrazione di RNA per purificare l&#39;RNA trascritto; Seguire il protocollo del produttore. </li><li> Quantitate gli RNA con spettrofotometri UV-Vis e diluire l&#39;RNA a una concentrazione di 10 μM. Usare immediatamente i campioni o conservarli a -80 ° C. NOTA: la sequenza crRNAS sono elencati nella tabella 2 . </li></ol></li></ol> 2. Costruzione di parti in C-Brick ( cioè l&#39;inserimento di parti biologiche in un vettore standard C-Brick) NOTA: Questo passaggio ha tre sottoprogrammi. Per le parti biologiche corte ( ad esempio, promotori e terminatori), è meglio utilizzare il metodo diretto di PCR per inserire le parti biologiche in un vettore standard C-Brick4. L&#39;intera sequenza vettoriale è mostrata nei dati supplementari e la sequenza di prefisso e suffisso è mostrata in Figura 1 (punto 2.1, di seguito). Per le parti biologiche che possono essere facilmente ottenute tramite PCR ( ad es. Con modelli di DNA genomico, plasmidi o sequenze DNA sintetizzate), è consigliabile utilizzare il metodo di assemblaggio senza soluzione di continuità per inserire le parti biologiche in un vettore standard C-Brick (Punto 2.2, di seguito). Per quelle parti ottenute da standard BioBrick e BglBrick, restrizioneLa digestione mediata da enzimi e la legatura ligasi mediata con T4 DNA può essere utilizzata per inserire le parti biologiche in un vettore standard di C-Brick (fase 2.3). <ol><li> Costruzione tramite amplificazione diretta PCR <ol><li> Progettare e ordinare oligonucleotidi per amplificazione PCR. NOTA: La 5&#39;estremità dell&#39;oligonucleotide contiene la sequenza della parte del DNA e la 3&#39;-estremità dell&#39;oligonucleotide contiene la sequenza vettoriale ( cioè &quot;GGATCCACTAGTCTCTAGCTCG&quot; alla estremità 3&#39;&#39;stringa avanzata e &#39;GGATCCTTTCTCCTCTTTCTAG&#39; Nel filo inverso). Non si può progettare alcuna sovrapposizione o un sbalzo di 20 bp alla 5 &#39;dell&#39;oligonucleotide. Esempi specifici possono essere trovati in uno studio precedente 4 . </li><li> Riassemblare singoli oligonucleotidi in acqua ultra-pura a una concentrazione di 10 μM. </li><li> Impostare reazioni PCR sul ghiaccio in un tubo PCR da 0,2 ml: aggiungere 18 μl di acqua ultra-pura, 25 μL di 2x PCR buffer, 1 μL di dNTPs (10 μM), 2,5 μL di ciascuno dei primer in avanti e invertire (10 μM) dalla fase 2.1.2, 0,5 μL di vettore standard C-Brick (50 ng) come template e 0,5 μL Di DNA polimerasi ad alta fedeltà. Assicurarsi che il volume totale sia di 50 μL. </li><li> Posizionare il tubo direttamente in un termociclatore e avviare il programma del termociclatore. Usare immediatamente i campioni o congelare e conservarli a -20 ° C. </li><li> Programma termociclatore: un ciclo per 3 min a 98 ° C; Trenta cicli per 10 s a 98 ° C, 20 s a 55 ° C e 2 min a 72 ° C; E un ciclo per 10 min a 72 ° C. Tenere il campione a 16 ° C. </li><li> Aggiungere 9 μL di miscela dal punto 2.1.4 a un tubo di microcentrifuga da 1,5 ml. </li><li> Aggiungere 1 μl di DpnI e incubare per 1 h in un bagno d&#39;acqua di 37 ° C. NOTA: Se i primer non hanno sequenze sovrapposte, aggiungere 0,5 μL di polinucleotide chinasi T4 (PNK) e 0,5 μL di ligasi del DNA di T4 e incubare inUn bagno d&#39;acqua di 22 ° C per 1 h. Altrimenti, se i primer contengono una sequenza di sovrapposizione di ~ 20 nt, trasformano direttamente i prodotti trattati con DpnI in cellule E. coli (DH10B) -competenti (fase 2.4). Il prodotto PCR linearizzato sarà circolarizzato dal sistema di ricombinazione nell&#39;host. </li><li> Usare immediatamente i campioni o conservarli a -20 ° C. </li></ol></li><li> Costruzione tramite montaggio senza soluzione di continuità <ol><li> Progettare e ordinare oligonucleotidi per amplificazione PCR. NOTA: La 3&#39;estremità dell&#39;oligonucleotide contiene la sequenza terminale della parte del DNA e la 5&#39;estremità dell&#39;oligonucleotide contiene il terminale della sequenza lineare di vettori standard C-Brick ( cioè &quot;CTAGAAAGAGGAGAAAGGATCC&quot; per il 5 &#39; -end del filo in avanti e &quot;CGAGCTAGAGACTAGTGGATCC&quot; per la 5&#39;-estremità del filo inverso). Esempi specifici possono essere trovati in uno studio precedente 4 . </li><li> Riposizionare l&#39;individuoOligonucleotidi in acqua ultra-pura ad una concentrazione di 10 μM. </li><li> Impostare reazioni PCR sul ghiaccio in un tubo PCR da 0,2 ml: aggiungere 18 μl di acqua ultra-pura, 25 μL di tampone 2x PCR, 1 μL di dNTPs (10 μM), 2,5 μl ciascuno dei primer avanti e indietro (10 μM ) Dalla fase 2.2.2, 0,5 μL di template (20-500 ng) e 0,5 μL di DNA-polimerasi ad alta fedeltà. Assicurarsi che il volume totale sia di 50 μL. </li><li> Posizionare il tubo direttamente nel termociclatore e eseguire il programma termociclatore. Usare immediatamente i campioni o congelare e conservarli a -20 ° C. NOTA: Impostare il programma termociclatore su: un ciclo per 3 min a 98 ° C; 30 cicli per 10 s a 98 ° C, 20 s a 55 ° C (secondo la temperatura di additivo del primer) e 1 min (a seconda della lunghezza delle parti biologiche) a 72 ° C; E un ciclo per 10 min a 72 ° C. Tenere il campione a 16 ° C. </li><li> Purificare il prodotto PCR utilizzando un sistema di pulizia PCRKit kit; Seguire il protocollo del produttore. </li><li> Digestare il vettore standard C-Brick con BamHI: aggiungere 34 μL di acqua ultra-pura, 10 μl di plasmide (1 μg), 5 μl di tampone da 10 volte e 1 μL di BamHI nel tubo di microcentrifuga. Incubare fino a 2 ore a 37 ° C in un bagno d&#39;acqua. </li><li> Purificare il prodotto sopra usando un kit di sistema di pulizia del gel; Seguire il protocollo del produttore. </li><li> Aggiungere 2 μL di vettore linearizzato (50 ng) dal punto 2.2.7, 5 μL di frammento (200 ng) dalla fase 2.2.4, 2 μl di tampone di assemblaggio senza saldatura da 5x e 1 μl di enzima di assemblaggio senza soluzione di continuità da un kit di montaggio senza soluzione di continuità A un tubo da 1,5 ml di microcentrifuga. Assicurarsi che il volume totale sia di 10 μL. </li><li> Mettere questo in un bagno d&#39;acqua di 37 ° C per 30 minuti. Usare immediatamente i campioni o congelare e conservarli a -20 ° C. </li></ol></li><li> Costruzione tramite la digestione mediata da restrizione enzimatica e legatura ligasi mediata da T4 DNA. NOTA: Per le parti ottenute dai criteri BioBrick (passo 2.3.4-2.3.7) e BglBrick (passo 2.3.1-2.3.3), la digestione con enzimi-restrizione e la legatura ligasi mediata con T4 DNA può essere utilizzata per inserire Parti biologiche in un vettore standard C-Brick. <ol><li> Digestare le parti standard di BglBrick con BamHI e BglII: aggiungere 34 μL di acqua ultra-pura, 10 μl di plasmide (2 μg), 5 μl di tampone 10x, 0,5 μL di BamHI e 0,5 μL di BglII nel tubo di microcentrifuga. Incubare per 2 ore in un bagno d&#39;acqua di 37 ° C. </li><li> Eseguire un&#39;elettroforesi con gel agarosico del 1% e purificare il frammento utilizzando un kit di sistema di pulizia del gel. </li><li> Legare il frammento e il vettore standard C-Brick: aggiungere il volume da 2 μL di vettore linearizzato (50 ng) dalla fase 2.1.12 e 6 μl di frammento (200 ng) dal punto 2.3.3 in un tubo di microcentrifuga da 1,5 ml. Aggiungere 1 μl di 10 x T4 DNA ligase buffer e 1 μl di T4 DNA ligasi. Incubare per 2 ore a 22 ° C. Usare immediatamente i campioni o congelareE conservarli a -20 ° C. </li><li> Digestare le parti standard di BioBrick con XbaI e SpeI: aggiungere 34 μL di acqua ultra pura, 10 μl di plasmide (2 μg), 5 μl di tampone 10 volte, 0,5 μL di XbaI e 0,5 μl di SpeI nel tubo di microcentrifuga. Incubare per 2 ore in un bagno d&#39;acqua di 37 ° C. </li><li> Digestare il vettore standard C-Brick con XbaI e SpeI: aggiungere 34 μL di acqua ultra-pura, 10 μL di plasmide (1 μg), 5 μl di tampone 10 volte, 0,5 μL di XbaI e 0,5 μL di SpeI al tubo di microcentrifuga . Incubare per 2 ore in un bagno d&#39;acqua di 37 ° C. </li><li> Eseguire un&#39;elettroforesi del gel agarosico del 1% e purificare il frammento dalla fase 2.3.4 e il vettore linearizzato dal punto 2.3.5 con un kit di sistema di pulizia del gel; Seguendo il protocollo del produttore. </li><li> Legare il frammento e il vettore Crick Brick: aggiungere 2 μL di vettore linearizzato (50 ng) dal punto 2.3.5 e 6 μL di frammento (200 ng) dalla fase 2.3.4 in un tubo di microcentrifuga da 1,5 ml. Anno DominiD 1 μl di 10 volte T4 DNA ligase buffer e 1 μl di T4 DNA ligasi. Incubare per 2 ore a 22 ° C. Usare immediatamente i campioni o congelare e conservarli a -20 ° C. </li></ol></li><li> Aggiungere 10 μL dei prodotti della fase 2.1.8, 2.2.9, 2.3.3 o 2.3.7 per la trasformazione chimica nelle cellule competenti di E. coli (DH10B). </li><li> Raccogliere diversi cloni in un tubo di liquido Luria-Bertani (LB) da 5 ml e incubare a 37 ° C su un agitatore (220 rpm) durante la notte. </li><li> Estrarre il plasmide usando un kit di preparazione del plasmide; Seguire il protocollo del produttore. </li><li> Identificare i cloni corretti da sequenziamento di Sanger 11 . </li></ol> 3. C-Brick Assembly ( Figura 2 ) <ol><li> Digestione del vettore C-Brick con Cpf1 <ol><li> Aggiungere 22,5 μL di acqua priva di RNasi, 4 μl di tampone Cpfl 10 volte, 10 μL del plasmide della fase 2.6 (1 μg), 0,5 μL di RRI e 1 &amp;# 181; L di Cpf1 (5 μM) in un tubo di microcentrifuga da 1,5 ml. NOTA: Cpf1 può essere acquistato in commercio o purificato seguendo il protocollo in uno studio precedente 4 . </li><li> Per inserire un frammento di DNA straniero nei siti T1 e T2, aggiungere 1 μL di crRNA-T2 (10 μM) e incubare in un bagno d&#39;acqua a 37 ° C per 30 min. A dd 1 μL di crRNA-T1 (10 μM) e Cpf1 (5 μM) per altri 30 min. NOTA: In alternativa, per inserire un frammento di DNA straniero nei siti T3 e T4, aggiungere 1 μL di crRNA-T3 (10 μM) e incubare in un bagno d&#39;acqua a 37 ° C per 30 min. Aggiungere 1 μL di crRNA-T4 (10 μM) per altri 30 min. </li><li> Aggiungere 1 μl di fosfatasi alcalina termosensiva e incubare il tubo in un bagno d&#39;acqua di 37 ° C per altri 1 h. </li><li> Eseguire un&#39;elettroforesi con gel agarosio e purificare il vettore utilizzando un kit di sistema di pulizia del gel. Usare immediatamente i campioni o congelare e conservarli a -20 ° C. </li></ol></li&gt; <li> Digestione del frammento di DNA con Cpf1 <ol><li> Aggiungere 21 μl di acqua senza RNasi, 4 μl di 10 volte Cpf1 tampone, 10 μl di plasmide dalla fase 2.6 (2 μg), 0,5 μL di RRI e 2 μl di Cpf1 (5 μM) in un tubo di microcentrifuga da 1,5 ml. </li><li> Per inserire un frammento di DNA straniero nei siti T1 e T2, aggiungere 1 μL di crRNA-T1 (10 μM) e 1 μL di crRNA-T3 (10 μM) e incubare in un bagno d&#39;acqua a 37 ° C per 2 ore. NOTA: In alternativa, aggiungere 1 μL di crRNA-T2 (10 μM) e 1 μL di crRNA-T4 (10 μM) e incubare in un bagno d&#39;acqua a 37 ° C per 2 ore. </li><li> Eseguire un&#39;elettroforesi con gel agarosio e purificare il frammento utilizzando un kit di sistema di pulizia del gel. Usare immediatamente i campioni o congelare e conservarli a -20 ° C. </li></ol></li><li> Assemblaggio di C-mattone e ulteriore verifica <ol><li> Ligate il frammento di DNA straniero e il vettore di C-Brick: aggiungere 2 μL del vettore linearizzato (50 ng) dalla fase 3.1.4 e 6 μL del frammento DNA (200 ng) dalla fase 3.2.3 a un tubo di microcentrifuga da 1,5 ml. Aggiungere 1 μl di 10 volte T4 DNA ligase buffer e 1 μl di T4 DNA ligasi. Incubare per 2 ore a 22 ° C. Usare immediatamente i campioni o congelare e conservarli a -20 ° C. </li><li> Aggiungere 10 μL dei prodotti di legatura (fase 3.3.1) per la trasformazione chimica in E. coli (DH10B) -competente cellule. </li><li> Aggiungere un certo numero di cloni a un tubo liquido da 5 ml di LB e incubare per una notte su un agitatore a 220 giri / min e 37 ° C. </li><li> Estrarre il plasmide usando un kit di preparazione del plasmide; Seguire il protocollo del produttore. </li><li> Identificare i cloni corretti da sequenziamento di Sanger 11 . </li></ol></li><li> Eseguire un nuovo ciclo di C-Brick assembly. I cloni corretti dal punto 3.3.4 possono essere utilizzati come un nuovo vettore C-Brick o parte del DNA per ulteriori successivi iterative C-Brick, seguendo lo stesso protocollo dai passaggi 3.1-3.3. NOTA: T2 &#39;e T3&#39; sSono progettati come il backup dei siti T2 e T3 ( Figura 1a ). Per i plasmidi ottenuti dalla fase 2.3.7, solo il T2 &#39;e il T3&#39; possono essere utilizzati per l&#39;assemblaggio standard C-Brick. </li></ol>

<ol>
	<li>Canton, B., Labno, A., Endy, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Refinement+and+standardization+of+synthetic+biological+parts+and+devices.">Refinement and standardization of synthetic biological parts and devices.</a> Nat Biotechnol. 26 (7), 787-793 (2008).</li><li>Shetty, R. P., Endy, D., Knight, T. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+BioBrick+vectors+from+BioBrick+parts.">Engineering BioBrick vectors from BioBrick parts.</a> J Biol Eng. 2, (2008).</li><li>Knight, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Idempotent Vector Design for Standard Assembly of Biobricks. , 1-11 (2003).</li><li>Li, S. Y., Zhao, G. P., Wang, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=C-Brick:+A+New+Standard+for+Assembly+of+Biological+Parts+Using+Cpf1.">C-Brick: A New Standard for Assembly of Biological Parts Using Cpf1.</a> ACS Synth Biol. 5 (12), 1383-1388 (2016).</li><li>Anderson, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BglBricks:+A+flexible+standard+for+biological+part+assembly.">BglBricks: A flexible standard for biological part assembly.</a> J Biol Eng. 4 (1), (2010).</li><li>Liu, J. K., Chen, W. H., Ren, S. X., Zhao, G. P., Wang, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=iBrick:+a+new+standard+for+iterative+assembly+of+biological+parts+with+homing+endonucleases.">iBrick: a new standard for iterative assembly of biological parts with homing endonucleases.</a> PLoS One. 9 (10), e110852 (2014).</li><li>Hsu, P. D., Lander, E. S., Zhang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+applications+of+CRISPR-Cas9+for+genome+engineering.">Development and applications of CRISPR-Cas9 for genome engineering.</a> Cell. 157 (6), 1262-1278 (2014).</li><li>Wright, A. V., Nunez, J. K., Doudna, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biology+and+Applications+of+CRISPR+Systems:+Harnessing+Nature's+Toolbox+for+Genome+Engineering.">Biology and Applications of CRISPR Systems: Harnessing Nature's Toolbox for Genome Engineering.</a> Cell. 164 (1-2), 29-44 (2016).</li><li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Zetsche, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cpf1+is+a+single+RNA-guided+endonuclease+of+a+class+2+CRISPR-Cas+system.">Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system.</a> Cell. 163 (3), 759-771 (2015).</li><li>Sanger, F., Nicklen, S., Coulson, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+sequencing+with+chain-terminating+inhibitors.">DNA sequencing with chain-terminating inhibitors.</a> Proc Natl Acad Sci U S A. 74 (12), 5463-5467 (1977).</li><li>Engler, C., Kandzia, R., Marillonnet, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+one+pot,+one+step,+precision+cloning+method.">A one pot, one step, precision cloning method.</a> PLoS One. 3 (11), e3647 (2008).</li><li>Gibson, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+assembly+of+DNA+molecules+up+to+several+hundred+kilobases.">Enzymatic assembly of DNA molecules up to several hundred kilobases.</a> Nat Methods. 6 (5), 343-345 (2009).</li><li>Casini, A., Storch, M., Baldwin, G. S., Ellis, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bricks+and+blueprints:+methods+and+standards+for+DNA+assembly.">Bricks and blueprints: methods and standards for DNA assembly.</a> Nat Rev Mol Cell Biol. 16 (9), 568-576 (2015).</li><li>Cameron, D. E., Bashor, C. J., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+brief+history+of+synthetic+biology.">A brief history of synthetic biology.</a> Nat Rev Microbiol. 12 (5), 381-390 (2014).</li><li>Keasling, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+biology+for+synthetic+chemistry.">Synthetic biology for synthetic chemistry.</a> ACS Chem Biol. 3 (1), 64-76 (2008).</li></ol>

Gli autori non hanno niente da rivelare.

Questo protocollo descrive una procedura per lo standard di assemblaggio del DNA C-Brick. Il passo più importante in questo protocollo è la linearizzazione del vettore standard C-Brick; La scissione incompleta del vettore potrebbe influenzare seriamente il tasso di successo. Inoltre, sebbene Cpf1 praticamente abbia sequenze di DNA bersaglio nel pattern di scissione &quot;18-23&quot;, è stata rilevata anche una scissione inesatta vicino alle due basi 4 , che possono causare un piccolo numero di...

La standardizzazione delle parti biologiche del DNA è importante per lo sviluppo della biologia sintetica 1 . Lo sviluppo di una procedura di assemblaggio del DNA può sostituire disegni sperimentali ad hoc e rimuovere molti dei risultati imprevisti che si verificano durante l&#39;assemblaggio di componenti genetici in sistemi più grandi. Lo standard BioBrick (BBF RFC 10) è stato uno dei più antichi standard di assemblaggio del DNA proposto. Utilizza la sequenza di prefisso (contenente i siti di taglio EcoRI e XbaI) e la sequenza di suffisso (contenente siti di taglio SpeI e PstI) 2 , 3 . Poiché XbaI e SpeI hanno finiti complementari coesivi, le parti del DNA di BioBrick che vengono tagliate con XbaI e SpeI possono essere unite insieme, generando un nuovo BioBrick per un ulteriore assemblaggio iterativo. Alcuni difetti sono stati identificati con l&#39;uso dello standard BioBrick 4 . Ad esempio, produce una cicatrice da 8 bpTra le parti del DNA, che non consentono la costruzione di proteine ​​in fusione. Inoltre, i quattro tipi di restrizione a 6 bp di cui sopra devono essere rimossi dalle parti del DNA, che è molto scomodo. Lo standard BglBrick è stato creato per risolvere il primo problema 5 . Crea una cicatrice a 6 bp &quot;GGATCT&quot;, che produce Gly-Ser e consente la fusione di più proteine ​​o domini proteici. IBrick è stato sviluppato per affrontare il secondo problema 6 . Utilizza endonucleasi di homing (HEs) che riconoscono lunghe sequenze di DNA. Poiché i siti di riconoscimento HE raramente esistono nelle sequenze di DNA naturali, lo standard iBrick può essere utilizzato per la costruzione diretta di parti iBrick senza modificarne le sequenze di DNA. Tuttavia, lo standard iBrick lascia una cicatrice di 21 bp tra le parti del DNA, che potrebbe essere il motivo della sua impopolarità. Negli ultimi anni, i cluster regolarmente hanno interspato brevi ripetizioni palindromiche (CRISPR) ha sviluppato rapidamente 7 , 8 . Tra le proteine ​​associate a CRISPR (Cas), l&#39;endonucleasi Cas9 di Streptococcus pyogenes è ora ampiamente utilizzata. Esso presenta per lo più due interruzioni di DNA a doppio filamento (DSB) con estremità lisce 9 . Nel 2015, Zhang e colleghi hanno caratterizzato per la prima volta Cpf1 (CRISPR da Prevotella e Francisella 1). Appartiene al sistema CRISPR-Cas di classe 2 di tipo V ed è un CRISRP RNA (crRNA) -guardato endonucleasi 10 . A differenza di Cas9, Cpf1 introduce un DSB con 4 o 5 nt 5 &#39;overhang 10 . Sulla base di questa caratteristica, Cpf1 è stato utilizzato per sviluppare uno standard di assemblaggio del DNA, C-Brick 4 . Su un vettore standard C-Brick, quattro siti target Cpf1 di prefissati T1 / T2 e suffixed T3 / T4 fianco le parti biologiche; Questo è simile allo standard BioBrick. Come la scissione dei siti T2 e T3 pGenera estremità appiccicose complementari, è possibile eseguire l&#39;assemblaggio iterativo delle parti del DNA, generando una cicatrice &quot;GGATCC&quot; tra le parti. In particolare, lo standard C-Brick ha due vantaggi principali: riconoscere lunghe sequenze di bersagli e lasciare brevi cicatrici. La cicatrice a 6 bp &quot;GGATCC&quot; generata da C-Brick codifica Gly-Ser, che consente la costruzione di proteine ​​di fusione. Inoltre, lo standard C-Brick è parzialmente compatibile con gli standard BglBrick e BioBrick.

<table border="0" cellpadding="0" cellspacing="0" width="828">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Comercial Oligonucleotide</td>
			<td style="width:160px;">Sangon Biotech</td>
			<td style="width:161px;"></td>
			<td style="width:191px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">10x Taq PCR Buffer</td>
			<td style="width:160px;">Transgen</td>
			<td style="width:161px;">#J40928</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Ultra Pure Distilled Water</td>
			<td style="width:160px;">Invitrogen</td>
			<td style="width:161px;">10977-015</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">5x RNA Transcription Buffer</td>
			<td style="width:160px;">Thermo Scientific</td>
			<td style="width:161px;">K0441</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">T7 RNA polymerase</td>
			<td style="width:160px;">Thermo Scientific</td>
			<td style="width:161px;">#EP0111</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">NTP mixture</td>
			<td style="width:160px;">Sangon</td>
			<td style="width:161px;">#ND0056</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">RRI(Recombinant RNase Inhibitor)</td>
			<td style="width:160px;">Takara</td>
			<td style="width:161px;">2313A</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">RNA Clean &#38; Concentrator-5</td>
			<td style="width:160px;">Zymo Research</td>
			<td style="width:161px;">R1015</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">UV-Vis Spectrometer</td>
			<td style="width:160px;">Thermo Scientific</td>
			<td style="width:161px;">Nano-Drop 2000c</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">2x Phanta Max Buffer</td>
			<td style="width:160px;">Vazyme</td>
			<td style="width:161px;">PB505</td>
			<td>PCR buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">dNTPs</td>
			<td style="width:160px;">Transgen</td>
			<td style="width:161px;">AD101</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:316px;">Phanta Max Super-Fidelity DNA Polymerase</td>
			<td style="width:160px;">Vazyme</td>
			<td style="width:161px;">P505-d1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Ezmax for One-step Cloning</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">24303-1</td>
			<td>seamless assembly kit</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">5x Buffer for Ezmax One-step Cloning</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">32006</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">BamHI</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#R0136L</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">BamHI-HF</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#R3136L</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">BglII&#160;</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#R0144L</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">XbaI</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#R0145L</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">SpeI</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#R3133L</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">10x Buffer 3</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#B7003S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">10x CutSmart Buffer</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">B7204S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">10x T4 DNA ligase Buffer</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">32002</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">T4 PNK</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">32206</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">T4 DNA ligase</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">32210</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">DpnI</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#R01762</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">SV Gel and PCR clean-up system</td>
			<td style="width:160px;">Promega</td>
			<td style="width:161px;">A9282</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Plasmid Mini Kit I</td>
			<td style="width:160px;">Omega</td>
			<td style="width:161px;">D6943-02</td>
			<td>plasmid preparation kit</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">thermosensitive alkaline phosphatase&#160;</td>
			<td style="width:160px;">Thermo Scientific</td>
			<td style="width:161px;">#EF0651</td>
			<td>FastAP</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">10x Cpf1 buffer</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">32008</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Cpf1</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">32105</td>
			<td>FnCpf1</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">thermocycler</td>
			<td style="width:160px;">Applied Biosystems</td>
			<td style="width:161px;">veriti 96 well</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">C-Brick standard vector</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">98101</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">E. coli [DH10B]</td>
			<td style="width:160px;">Invitrogen</td>
			<td style="width:161px;">18297010</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Luria-Bertani media (tryptone)</td>
			<td style="width:160px;">Oxoid</td>
			<td style="width:161px;">LP0042</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Luria-Bertani media (yeast extract)</td>
			<td style="width:160px;">Oxoid</td>
			<td style="width:161px;">LP0021</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Luria-Bertani media (NaCl)</td>
			<td style="width:160px;">Sangon Biotech</td>
			<td style="width:161px;">B126BA0007</td>
			<td></td>
		</tr>
	</tbody>
</table>

protocols for c-brick dna standard assembly using cpf1

La proteina Cpf1 associata a CRISPR fila il DNA a doppio filamento sotto la guida di CRISPR RNA (crRNA), generando estremità appiccicose. A causa di questa caratteristica, Cpf1 è stato utilizzato per la creazione di un sistema di assemblaggio del DNA chiamato C-Brick, che ha il vantaggio di lunghi siti di riconoscimento e brevi cicatrici. Su un vettore standard C-Brick, ci sono quattro siti di riconoscimento Cpf1 - il prefisso (siti T1 e T2) e il suffisso (siti T3 e T4) - parti del DNA biologico flanking. La scissione dei siti T2 e T3 produce estremità appiccicose complementari, che consentono l&#39;assemblaggio di parti del DNA con i siti T2 e T3. Nel frattempo, una breve cicatrice &quot;GGATCC&quot; viene generata tra le parti dopo l&#39;assemblaggio. Poichè il plasmide appena costituito contiene ancora i quattro siti di scissione di Cpf1, il metodo consente l&#39;assemblaggio iterativo di parti del DNA, che è simile a quello di standard BioBrick e BglBrick. Una procedura che descrive l&#39;utilizzo dello standard C-Brick per assemblare parti del DNAÈ descritto qui. Lo standard C-Brick può essere ampiamente usato da scienziati, laureati e studenti universitari, e anche dilettanti.

<html> Questo protocollo ha dimostrato l&#39;assemblaggio di tre cassette di cromoproteine ​​(cjBlue (BBa_K592011), eforRed (BBa_K592012) e amilGFP (BBa_K592010)). In primo luogo, le sequenze di codificazione dei tre geni e terminatori sopra menzionati sono stati clonati individualmente in un vettore standard C-Brick. Brevi parti del DNA, promotore e terminatore, sono state introdotte nel vettore C-Brick mediante amplificazione PCR utilizzando primer contenenti le parti corte del DNA ...

Watch this Scientific Journal Video about Protocols for C-Brick DNA Standard Assembly Using Cpf1 at JoVE.com

Protocols for C-Brick DNA Standard Assembly Using Cpf1

La proteina Cpf1 associata a CRISPR può essere guidata da un CRISPR RNA (crRNA) appositamente progettato per separare il DNA a doppio filamento nei siti desiderati, generando estremità appiccicose. Sulla base di questa caratteristica, è stato stabilito un standard di assemblaggio del DNA (C-Brick) e qui viene descritto un protocollo che descrive il suo utilizzo.

Protocolli per l&#39;assemblaggio standard di DNA C-Brick utilizzando Cpf1

CRISPR-associated protein Cpf1 cleaves double-stranded DNA under the guidance of CRISPR RNA (crRNA), generating sticky ends. Because of this ...

protocols-for-c-brick-dna-standard-assembly-using-cpf1

Research

JoVE Journal

Genetics

8.2K Views.  Chinese Academy of Sciences.  La proteina Cpf1 associata a CRISPR può essere guidata da un CRISPR RNA (crRNA) appositamente progettato per separare il DNA a doppio filamento nei siti desiderati, generando estremità appiccicose. Sulla base di questa caratteristica, è stato stabilito un standard di assemblaggio del DNA (C-Brick) e qui viene descritto un protocollo che descrive il suo utilizzo. 

Video: Protocols for C-Brick DNA Standard Assembly Using Cpf1

Methyl-binding DNA capture Sequencing for Patient Tissues

Methylation is one of the essential epigenetic modifications to the DNA, which is responsible for the precise regulation of genes required for stable development and differentiation of different tissue types. Dysregulation of this process is often the hallmark of various diseases like cancer. Here, we outline one of the recent sequencing techniques, Methyl-Binding DNA Capture sequencing (MBDCap-seq), used to quantify methylation in various normal and disease tissues for large patient cohorts. We describe a detailed protocol of this affinity enrichment approach along with a bioinformatics pipeline to achieve optimal quantification. This technique has been used to sequence hundreds of patients across various cancer types as a part of the 1,000 methylome project (Cancer Methylome System).

Here we present a protocol to investigate genome wide DNA methylation in large scale clinical patient screening studies using the Methyl-Binding DNA Capture sequencing (MBDCap-seq or MBD-seq) technology and the subsequent bioinformatics analysis pipeline.

Metil-binding cattura sequenziamento del DNA per tessuti del paziente

Methylation is one of the essential epigenetic modifications to the DNA, which is responsible for the precise regulation of genes required for stable ...

Ricerca

Genetica

Determination of the Optimal Chromosomal Location(s) for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In bacteria, the impact of the genetic context on the function of a genetic element can be difficult to assess. Several mechanisms, including topological effects, transcriptional interference from neighboring genes, and/or replication-associated gene dosage, may affect the function of a given genetic element. Here, we describe a method that permits the random integration of a DNA element into the chromosome of Escherichia coli and select the most favorable locations using a simple growth competition experiment. The method takes advantage of a well-described transposon-based system of random insertion, coupled with a selection of the fittest clone(s) by growth advantage, a procedure that is easily adjustable to experimental needs. The nature of the fittest clone(s) can be determined by whole-genome sequencing on a complex multi-clonal population or by easy gene walking for the rapid identification of selected clones. Here, the non-coding DNA region DARS2, which controls the initiation of chromosome replication in E. coli, was used as an example. The function of DARS2 is known to be affected by replication-associated gene dosage; the closer DARS2 gets to the origin of DNA replication, the more active it becomes. DARS2 was randomly inserted into the chromosome of a DARS2-deleted strain. The resultant clones containing individual insertions were pooled and competed against one another for hundreds of generations. Finally, the fittest clones were characterized and found to contain DARS2 inserted in close proximity to the original DARS2 location.

Determination of the Optimal Chromosomal Locations for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

Here, the power of a transposon-mediated random insertion of a non-coding DNA element was used to resolve its optimal chromosomal position.

Determinazione dei percorsi cromosomici ottimali per un elemento di DNA in Escherichia coli usando un approccio novello Transposon-mediata

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In ...

Immunostaining for DNA Modifications: Computational Analysis of Confocal Images

For several decades, 5-methylcytosine (5mC) has been thought to be the only DNA modification with a functional significance in metazoans. The discovery of enzymatic oxidation of 5mC to 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC) as well as detection of N6-methyladenine (6mA) in the DNA of multicellular organisms provided additional degrees of complexity to the epigenetic research. According to a growing body of experimental evidence, these novel DNA modifications may play specific roles in different cellular and developmental processes. Importantly, as some of these marks (e. g. 5hmC, 5fC and 5caC) exhibit tissue- and developmental stage-specific occurrence in vertebrates, immunochemistry represents an important tool allowing assessment of spatial distribution of DNA modifications in different biological contexts. Here the methods for computational analysis of DNA modifications visualized by immunostaining followed by confocal microscopy are described. Specifically, the generation of 2.5 dimension (2.5D) signal intensity plots, signal intensity profiles, quantification of staining intensity in multiple cells and determination of signal colocalization coefficients are shown. Collectively, these techniques may be operational in evaluating the levels and localization of these DNA modifications in the nucleus, contributing to elucidating their biological roles in metazoans.

Newly discovered oxidized forms of 5-methylcytosine (oxi-mCs), 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC) may represent distinct DNA modifications with unique functional roles. Here a semi-quantitative workflow for visualization of oxi-mCs' spatial distribution, signal intensity profiling and colocalization is described.

Immunostaining per modificazioni del DNA: analisi computazionale delle immagini Confocal

For several decades, 5-methylcytosine (5mC) has been thought to be the only DNA modification with a functional significance in metazoans. The discovery of ...

Profiling DNA Replication Timing Using Zebrafish as an In Vivo Model System

DNA replication timing is an important cellular characteristic, exhibiting significant relationships with chromatin structure, transcription, and DNA mutation rates. Changes in replication timing occur during development and in cancer, but the role replication timing plays in development and disease is not known. Zebrafish were recently established as an in vivo model system to study replication timing. Here is detailed the protocols for using the zebrafish to determine DNA replication timing. After sorting cells from embryos and adult zebrafish, high-resolution genome-wide DNA replication timing patterns can be constructed by determining changes in DNA copy number through analysis of next generation sequencing data. The zebrafish model system allows for evaluation of the replication timing changes that occur in vivo throughout development, and can also be used to assess changes in individual cell types, disease models, or mutant lines. These methods will enable studies investigating the mechanisms and determinants of replication timing establishment and maintenance during development, the role replication timing plays in mutations and tumorigenesis, and the effects of perturbing replication timing on development and disease.

Profiling DNA Replication Timing Using Zebrafish as an In Vivo Model System

Zebrafish were recently used as an in vivo model system to study DNA replication timing during development. Here is detailed the protocols for using zebrafish embryos to profile replication timing. This protocol can be easily adapted to study replication timing in mutants, individual cell types, disease models, and other species.

Tempo di replicazione del DNA utilizzando Zebrafish come un sistema di modello In Vivo di profilatura

DNA replication timing is an important cellular characteristic, exhibiting significant relationships with chromatin structure, transcription, and DNA ...

Investigation of Protein Recruitment to DNA Lesions Using 405 Nm Laser Micro-irradiation

The DNA Damage Response (DDR) uses a plethora of proteins to detect, signal, and repair DNA lesions. Delineating this response is critical to understand genome maintenance mechanisms. Since recruitment and exchange of proteins at lesions are highly dynamic, their study requires the ability to generate DNA damage in a rapid and spatially-delimited manner. Here, we describe procedures to locally induce DNA damage in human cells using a commonly available laser-scanning confocal microscope equipped with a 405 nm laser line. Accumulation of genome maintenance factors at laser stripes can be assessed by immunofluorescence (IF) or in real-time using proteins tagged with fluorescent reporters. Using phosphorylated histone H2A.X (&#947;-H2A.X) and Replication Protein A (RPA) as markers, the method provides sufficient resolution to discriminate locally-recruited factors from those that spread on adjacent chromatin. We further provide ImageJ-based scripts to efficiently monitor the kinetics of protein relocalization at DNA damage sites. These refinements greatly simplify the study of the DDR dynamics.

Studying DNA damage repair kinetics requires a system to induce lesions at defined sub-nuclear regions. We describe a method to create localized double-stranded breaks using a laser-scanning confocal microscope equipped with a 405 nm laser and provide automated procedures to quantify the dynamics of repair factors at these lesions.

Indagine di assunzione di proteine per lesioni del DNA utilizzando 405 Nm Laser Micro-irradiazione

The DNA Damage Response (DDR) uses a plethora of proteins to detect, signal, and repair DNA lesions. Delineating this response is critical to understand ...

Rare Event Detection Using Error-corrected DNA and RNA Sequencing

Conventional next-generation sequencing techniques (NGS) have allowed for immense genomic characterization for over a decade. Specifically, NGS has been used to analyze the spectrum of clonal mutations in malignancy. Though far more efficient than traditional Sanger methods, NGS struggles with identifying rare clonal and subclonal mutations due to its high error rate of ~0.5&#8211;2.0%. Thus, standard NGS has a limit of detection for mutations that are &#62;0.02 variant allele fraction (VAF). While the clinical significance for mutations this rare in patients without known disease remains unclear, patients treated for leukemia have significantly improved outcomes when residual disease is &#60;0.0001 by flow cytometry. In order to mitigate this artefactual background of NGS, numerous methods have been developed. Here we describe a method for Error-corrected DNA and RNA Sequencing (ECS), which involves tagging individual molecules with both a 16 bp random index for error-correction and an 8 bp patient-specific index for multiplexing. Our method can detect and track clonal mutations at variant allele fractions (VAFs) two orders of magnitude lower than the detection limit of NGS and as rare as 0.0001 VAF.

Next-generation sequencing (NGS) is a powerful tool for genomic characterization that is limited by the high error rate of the platform (~0.5&#8211;2.0%). We describe our methods of error-corrected sequencing that allow us to obviate the NGS error rate and detect mutations at variant allele fractions as rare as 0.0001.

Rilevamento di eventi rari utilizzando la sequenza di RNA e DNA di correzione d'errore

Conventional next-generation sequencing techniques (NGS) have allowed for immense genomic characterization for over a decade. Specifically, NGS has been ...

Methodology for Accurate Detection of Mitochondrial DNA Methylation

Quantification of DNA methylation can be achieved using bisulfite sequencing, which takes advantage of the property of sodium bisulfite to convert unmethylated cytosine into uracil, in a single-stranded DNA context. Bisulfite sequencing can be targeted (using PCR) or performed on the whole genome and provides absolute quantification of cytosine methylation at the single base-resolution. Given the distinct nature of nuclear- and mitochondrial DNA, notably in the secondary structure, adaptions of bisulfite sequencing methods for investigating cytosine methylation in mtDNA should be made. Secondary and tertiary structure of mtDNA can indeed lead to bisulfite sequencing artifacts leading to false-positives due to incomplete denaturation poor access of bisulfite to single-stranded DNA. Here, we describe a protocol using an enzymatic digestion of DNA with BamHI coupled with bioinformatic analysis pipeline to allow accurate quantification of cytosine methylation levels in mtDNA. In addition, we provide guidelines for designing the bisulfite sequencing primers specific to mtDNA, in order to avoid targeting undesirable NUclear MiTochondrial segments (NUMTs) inserted into the nuclear genome.

Here, we present a protocol to allow accurate quantification of mitochondrial DNA (mtDNA) methylation. In this protocol, we describe an enzymatic digestion of DNA with BamHI coupled with a bioinformatic analysis pipeline which can be used to avoid overestimation of mtDNA methylation levels caused by the secondary structure of mtDNA.

Metodologia per la rilevazione accurata di metilazione del DNA mitocondriale

Quantification of DNA methylation can be achieved using bisulfite sequencing, which takes advantage of the property of sodium bisulfite to convert ...

A Customizable Protocol for String Assembly gRNA Cloning (STAgR)

The bacterial CRISPR/Cas9 system has substantially increased methodological options for life scientists. Due to its utilization, genetic and genomic engineering became applicable to a large range of systems. Moreover, many transcriptional and epigenomic engineering approaches are now generally feasible for the first time. One reason for the broad applicability of CRISPR lies in its bipartite nature. Small gRNAs determine the genomic targets of the complex, variants of the protein Cas9, and the local molecular consequences. However, many CRISPR approaches depend on the simultaneous delivery of multiple gRNAs into individual cells. Here, we present a customizable protocol for string assembly gRNA cloning (STAgR), a method that allows the simple, fast and efficient generation of multiplexed gRNA expression vectors in a single cloning step. STAgR is cost-effective, since (in this protocol) the individual targeting sequences are introduced by short overhang primers while the long DNA templates of the gRNA expression cassettes can be re-used multiple times. Moreover, STAgR allows single step incorporation of a large number of gRNAs, as well as combinations of different gRNA variants, vectors and promoters.

A Customizable Protocol for String Assembly gRNA Cloning STAgR

Here, we present string assembly gRNA cloning (STAgR), a method to easily multiplex gRNA vectors for CRISPR/Cas9 approaches. STAgR makes gRNA multiplexing simple, efficient and customizable.

Un protocollo personalizzabile per String Assembly gRNA clonazione (STAgR)

The bacterial CRISPR/Cas9 system has substantially increased methodological options for life scientists. Due to its utilization, genetic and genomic ...

Assessing Stem Cell DNA Integrity for Cardiac Cell Therapy

Stem and stem-cell-derived cells have immense potential as a regenerative therapy for various degenerative diseases. DNA is the storehouse of genetic data in all cells, including stem cells, and its integrity is fundamental to its regenerative ability. Stem cells undergo rapid propagation in labs to achieve the necessary numbers for transplantation. Accelerated cell growth leads to the loss of DNA integrity by accumulated metabolites, such as reactive oxygen, carbonyl, and alkylating agents. Transplanting these cells would result in poor engraftment and regeneration of the deteriorating organ. Moreover, transplanting DNA-damaged cells leads to mutations, DNA instability, cellular senescence, and possibly, life-threatening diseases such as cancer. Therefore, there is an immediate need for a quality control method to evaluate the cell's suitability for transplantation. Here, we provide step-by-step protocols for the assessment of the DNA integrity of stem cells prior to cell transplantation.

Here, we provide a detailed description of an experimental setup for an analysis of the assessment of DNA integrity in stem cells prior to cell transplantation.

Valutazione dell'integrità del DNA di cellule staminali per la terapia cellulare cardiaca

Stem and stem-cell-derived cells have immense potential as a regenerative therapy for various degenerative diseases. DNA is the storehouse of genetic data ...

High-Throughput DNA Plasmid Multiplexing and Transfection Using Acoustic Nanodispensing Technology

Cell transfection, indispensable for many biological studies, requires controlling many parameters for an accurate and successful achievement. Most often performed at low throughput, it is moreover time-consuming and error-prone, even more so when multiplexing several plasmids. We developed an easy, fast, and accurate method to perform cell transfection in a 384-well plate layout using acoustic droplet ejection (ADE) technology. The nanodispenser device used in this study&#160;is based on this technology and allows precise nanovolume delivery at high speed from a source well plate to a destination one. It can dispense and multiplex DNA and transfection reagent according to a predesigned spreadsheet. Here we present an optimal protocol to perform ADE-based high-throughput plasmid transfection which makes it possible to reach an efficiency of up to 90% and a nearly 100% cotransfection in cotransfection experiments. We extend initial work by proposing a user-friendly spreadsheet-based macro, able to manage up to four plasmids/wells from a library containing up to 1,536 different plasmids, and a tablet-based pipetting guide application. The macro designs the necessary template(s) of the source plate(s) and generates the ready-to-use files for the nanodispenser and tablet-based application. The four-steps transfection protocol involves i) a diluent dispense with a classical liquid handler, ii) plasmid distribution and multiplexing, iii) a transfection reagent dispense by the nanodispenser, and iv) cell plating on the prefilled wells. The described software-based control of ADE plasmid multiplexing and transfection allows even nonspecialists in the field to perform a reliable cell transfection in a fast and safe way. This method enables rapid identification of optimal settings for a given cell type and can be transposed to higher-scale and manual approaches. The protocol eases applications, such as human ORFeome protein (set of open reading frames [ORFs] in a genome) expression or CRISPR-Cas9-based gene function validation, in nonpooled screening strategies.

This protocol describes high-throughput plasmid transfection of mammalian cells in a 384-well plate using acoustic droplet ejection technology. The time-consuming, error-prone DNA dispensing and multiplexing, but also the transfection reagent dispensing, are software-driven and performed by a nanodispenser device. The cells are then seeded in these prefilled wells.

Plasmid di DNA ad alto throughput e trasfezione utilizzando la tecnologia di nanoedispensing acustico

Cell transfection, indispensable for many biological studies, requires controlling many parameters for an accurate and successful achievement. Most often ...