C-Tuğla standardının geliştirilmesi sırasında teknik yardımları için Shanghai Tolo Biotech&#39;e teşekkür ediyoruz. Bu çalışma, Çin Bilimler Akademisinin Stratejik Öncelik Araştırma Programından hibelerle desteklenmiştir (Grund No XDB19040200).

1. crRNA&#39;nın hazırlanması <ol><li> CrRNA şablonlarının hazırlanması <ol><li> Tekli oligonükleotidleri ( Tablo 1 ) RNaz içermeyen suda 10 uM&#39;lik bir konsantrasyona kadar yeniden süspanse edin. </li><li> 22.5 uL üst şeritli oligonükleotid ( Tablo 1&#39;de T7-F), 22.5 uL alt-şeritli oligonükleotid ( Tablo 1 ) ve 5 uL 10x tavlama tamponu 0.2 mL PCR tüpüne ilave edin. Toplam hacmin 50 μL olduğundan emin olun. NOT: Altı farklı alt zincirli oligonükleotidler Tablo 1&#39;de gösterilmiştir, bunların her biri ayrı ayrı üst iplikçikli T7-F ile eşleştirilmelidir. Tablo 1&#39;deki küçük harfler, crRNA&#39;nın rehber dizisine transkribe edilecek sekansı temsil etmektedir. 10x Taq PCR tamponu, 10x tavlama tamponunun yerine kullanılabilir. </li><li> PCR tüpünü bir termostatöre yerleştirin. </li><li> Tavlama programını çalıştırın: İlk denatürasyon için 95 ° C&#39;de5 dakika sonra 95-20 ° C arasında bir cooldown, termosiklörde dakikada 1 ° C düşüş. NOT: Adımları derhal adım 1.2.1 için kullanın. </li></ol></li><li> CrRNA&#39;nın transkripsiyonu ve saflaştırılması <ol><li> RNaz içermeyen suya 38 μL, adım 1.1.4&#39;deki şablondan 8 μL, 5x T7 transkripsiyon tamponu 20 uL, NTP karışımından (10 uM) 20 μL, rekombinant RNaz inhibitöründen (RRI) 4 μL ve 10 μM ML T7 RNA polimeraz&#39;dan 1.5 mL mikrosantrifüj tüpüne aktarıldı. Toplam hacmin 100 μL olduğundan emin olun. </li><li> Mikrosantrifüj tüpünü bir gece boyunca (yaklaşık 16 saat boyunca) 37 ° C&#39;lik bir su banyosuna koyun. </li><li> Transkribe RNA&#39;yı arındırmak için bir RNA temizleme ve konsantrasyon kiti kullanın; Üreticinin protokolünü izleyin. </li><li> RNA&#39;ları UV-Vis spektrofotometreleri ile ölçün ve RNA&#39;yı 10 uM&#39;lik bir konsantrasyona kadar sulandırın. Numuneleri derhal kullanın veya -80 ° C&#39;de saklayın. NOT: crRNA dizisiS Tablo 2&#39;de listelenmiştir . </li></ol></li></ol> 2. C-Tuğla Parçalarının Yapımı ( yani, Biyolojik Parçaların C-Tuğla Standart Vektörüne Yerleştirilmesi) NOT: Bu adımın üç alt aşaması vardır. Kısa biyolojik kısımlar ( örn. Promoterler ve sonlandırıcılar) için biyolojik parçaları C-Brick standart vektör 4&#39;e eklemek için doğrudan PCR yöntemini kullanmak en iyisidir. Bütün vektör sekansı ek veride gösterilir ve önek ve son ek sırası Şekil 1&#39;de gösterilmiştir (aşama 2.1, aşağıda). PCR ile kolaylıkla elde edilebilen biyolojik kısımlar için ( örn., Genomik DNA şablonları, plazmidler veya yeni sentezlenmiş DNA dizileri), biyolojik parçaları bir C-Brick standart vektörüne eklemek için kesintisiz montaj yöntemini kullanmak en iyisidir (Aşama 2.2, aşağıda). BioBrick ve BglBrick standartlarından edinilen parçalar için sınırlamaEnzim aracılı sindirim ve T4 DNA ligaz aracılı ligasyon biyolojik parçaları bir C-Brick standart vektörüne yerleştirmek için kullanılabilir (aşama 2.3, aşağıda). <ol><li> Doğrudan PCR amplifikasyonu ile yapı <ol><li> PCR amplifikasyonu için oligonükleotitler dizayn ve sipariş etmek. NOT: Oligonükleotitin 5&#39;-ucu, DNA bölümünün dizisini içerir ve oligonükleotitin 3 &#39;ucu, vektör dizisini ( yani, ileri bandın 3&#39; ucunda &quot;GGATCCACTAGTCTCTAGCTCG&quot; ve &quot;GGATCCTTTCTCCTCTTTCTAG&quot; Ters yörede). Oligonükleotitin 5&#39;-ucunda çıkıntı veya ~ 20 bp çıkıntı tasarlanamaz. Spesifik örnekler daha önceki bir çalışmada bulunabilir 4 . </li><li> 10 uM&#39;lik bir konsantrasyona kadar ultra saf su içindeki tek tek oligonükleotitleri yeniden süspanse edin. </li><li> 0.2 mL&#39;lik bir PCR tüpünde buz üzerinde PCR reaksiyonları oluşturun: 18 μL ultra saf su ekleyin, 25 μL 2x PCR tamponu, adım 2.1.2&#39;den ileri ve geri primerlerden her biri 2.5 uL (10 uM), şablon olarak 0.5 uL C-Brick standart vektörü (50 ng) ve 0.5 uL&#39;lik bir şablon olarak dNTP&#39;lerin (10 uM) Yüksek doğrulukta DNA polimerazın Toplam hacmin 50 μL olduğundan emin olun. </li><li> Tüpü doğrudan bir termosiklleye yerleştirin ve termosiklör programını çalıştırın. Numuneleri derhal kullanın veya dondurun ve -20 ° C&#39;de saklayın. </li><li> Thermocycler programı: 98 ° C&#39;de 3 dakika süreyle bir devir; 98 ° C&#39;de 10 saniye, 55 ° C&#39;de 20 saniye ve 72 ° C&#39;de 2 dakika için otuz döngü; Ve 72 ° C&#39;de 10 dakika boyunca bir döngü. Numuneyi 16 ° C&#39;de tutun. </li><li> Adım 2.1.4&#39;ten 9 μL karışım 1.5 mL mikrosantrifüj tüpüne ilave edilir. </li><li> 1 uL DpnI ekleyin ve 37 ° C&#39;lik bir su banyosunda 1 saat inkübe edin. NOT: Primerler üst üste binen sekanslara sahip değillerse 0.5 μL T4 polinükleotid kinaz (PNK) ve 0.5 μL T4 DNA ligaz ekleyin ve1 saat boyunca 22 ° C su banyosu. Aksi takdirde, primerler ~ 20 nt örtüşen diziyi içeriyorsa, doğrudan DpnI ile işleme tabi tutulan ürünleri E. coli (DH10B) -kompetent hücrelere dönüştürün (basamak 2.4). Doğrusallaştırılmış PCR ürünü konakçıdaki rekombinasyon sistemi ile dairesize hale getirilecektir. </li><li> Numuneleri hemen kullanın veya -20 ° C&#39;de saklayın. </li></ol></li><li> Dikişsiz montaj ile inşaat <ol><li> PCR amplifikasyonu için oligonükleotitler dizayn ve sipariş etmek. NOT: Oligonükleotitin 3&#39;-ucu, DNA bölümünün terminal dizisini içerir ve oligonükleotitin 5&#39;-ucu, doğrusallaştırılmış C-Brick standart vektör dizisinin terminalini içerir ( yani, 5 &#39;için standart olarak kullanılan &quot;CTAGAAAGAGGAGAAAGGATCC&quot; İleriye doğru ipliğin ucunu ve &quot;CGAGCTAGAGACTAGTGGCCT&quot; ters iplikçikinin 5&#39;-ucu için). Spesifik örnekler daha önceki bir çalışmada bulunabilir 4 . </li><li> Bireyi yeniden askıya alUltra saf sularda 10 uM konsantrasyona kadar ual oligonükleotitler. </li><li> 0.2 mL&#39;lik bir PCR tüpünde buz üzerinde PCR reaksiyonlarını ayarlayın: ultra saf su, 25 μL 2x PCR tamponu, 1 μL dNTPs (10 μM), 2.5 μL ileri ve geri primerlerin her biri (10 μM ), Adım 2.2.2, 0.5 uL şablon (20-500 ng) ve 0.5 uL yüksek-sadakat DNA polimeraz&#39;dan hazırlandı. Toplam hacmin 50 μL olduğundan emin olun. </li><li> Tüpü doğrudan termosiklleye yerleştirin ve termosiklör programını çalıştırın. Numuneleri derhal kullanın veya dondurun ve -20 ° C&#39;de saklayın. NOT: Thermocycler programını şu şekilde ayarlayın: 98 ° C&#39;de 3 dakika süreyle bir devir; 98 ° C&#39;de 10 saniye, 55 ° C&#39;de 20 saniye sonra (primerin tavlama sıcaklığına göre) 30 döngü ve 72 ° C&#39;de 1 dakika (biyolojik parçaların uzunluğuna göre) 30 döngü; Ve 72 ° C&#39;de 10 dakika boyunca bir döngü. Numuneyi 16 ° C&#39;de tutun. </li><li> Bir PCR temizleme sistemi kullanarak PCR ürününü arıtınTem kiti; Üreticinin protokolünü izleyin. </li><li> C-Brick standart vektörünü BamHI ile sindirin: 34 μL ultra saf su, 10 μL plazmid (1 μg), 5 μL 10x tampon ve 1 μL BamHI&#39;yi mikrosantrifüj tüpüne ilave edin. Su banyosunda 37 ° C&#39;de 2 saate kadar inkübe edin. </li><li> Bir jel temizleme sistemi kiti kullanarak yukarıdaki ürünü arındırın; Üreticinin protokolünü izleyin. </li><li> Adım 2.2.7&#39;den 2 mcL doğrusallaştırılmış vektör (50 ng), adım 2.2.4&#39;ten 5 uL parça (200 ng), 5x kesintisiz montaj tamponu 2 mcL ve kesintisiz montaj kitinden 1 μL kesintisiz montaj enzimi ekleyin. 1.5 mL&#39;lik mikrosantrifüj tüpüne uygulayın. Toplam hacmin 10 mcL olduğunu kontrol edin. </li><li> Bunu 30 dakika boyunca 37 ° C&#39;lik bir su banyosuna yerleştirin. Numuneleri derhal kullanın veya dondurun ve -20 ° C&#39;de saklayın. </li></ol></li><li> Restriksiyon enzim aracılı sindirim ve T4 DNA ligaz aracılı ligasyon yoluyla yapı. NOT: BioBrick (basamak 2.3.4-2.3.7) ve BglBrick (basamak 2.3.1-2.3.3) standartlarından elde edilen parçalar için kısıtlama enzimi aracılı sindirim ve T4 DNA ligaz aracılı ligasyon, Biyolojik parçaları bir C-Tuğla standart vektörüne dönüştürür. <ol><li> BamHI ve BglII ile BglBrick standart parçalarını sindirin: 34 μL ultra saf su, 10 μl plazmid (2 μg), 5 μL 10x tampon 3, 0.5 μL BamHI ve 0.5 μL BglII&#39;yi mikrosantrifüj tüpüne ilave edin. 37 ° C su banyosunda 2 saat inkübe edin. </li><li> % 1 agaroz jel elektroforezi çalıştırın ve bir jel temizleme sistemi kiti kullanarak fragmanı arındırın. </li><li> Parçayı ve C-Brick standart vektörünü ligate edin: Adım 2.1.12&#39;den doğrusallaştırılmış vektörün (50 ng) 2 mL ve adım 2.3.3&#39;ten 6 uL parça (200 ng) 1.5 mL mikrosantrifüj tüpüne ekleyin. 1 uL 10 x T4 DNA ligaz tamponu ve 1 μL T4 DNA ligaz ekleyin. 22 ° C&#39;de 2 saat inkübe edin. Numuneleri derhal kullanın veya buz özütüE -20 ° C&#39;de saklayın. </li><li> XbaI ve SpeI ile BioBrick standart parçalarını sindirin: 34 μL ultra saf su, 10 μL plazmid (2 μg), 5 μL 10x tampon, 0.5 μL Xbal ve 0.5 μL SpeI mikrosantrifüj tüpüne ekleyin. 37 ° C su banyosunda 2 saat inkübe edin. </li><li> C-Brick standart vektörünü XbaI ve SpeI ile sindirin: 34 μL ultra saf su, 10 μL plazmid (1 μg), 5 μL 10x tampon, 0.5 μL Xbal ve 0.5 μL SpeI mikrosantrifüj tüpüne ekleyin . 37 ° C su banyosunda 2 saat inkübe edin. </li><li> % 1 agaroz jel elektroforezi çalıştırın ve safha 2.3.4 adımından ve adım 2.5.5&#39;deki doğrusallaştırılmış vektörü jel temizleme sistemi kitiyle saflaştırın; Üreticinin protokolünü izleyerek. </li><li> Parçayı ve C-Brick vektörünü ligate edin: Adım 2.3.5&#39;den 2 mcL doğrusallaştırılmış vektör (50 ng) ve adım 2.3.4&#39;ten 6 uL parça (200 ng) 1.5 mL mikrosantrifüj tüpüne ekleyin. ilanD 1 uL 10x T4 DNA ligaz tamponu ve 1 uL T4 DNA ligazı. 22 ° C&#39;de 2 saat inkübe edin. Numuneleri derhal kullanın veya dondurun ve -20 ° C&#39;de saklayın. </li></ol></li><li> E. coli&#39;nin yetkili hücrelerine (DH10B) kimyasal transformasyon için adım 2.1.8, 2.2.9, 2.3.3 veya 2.3.7&#39;den 10 uL ürün ekleyin. </li><li> Birkaç klonu 5 mL sıvı Luria-Bertani (LB) tüpü içine alın ve gece boyunca çalkalayıcıda (220 rpm) 37 ° C&#39;de inkübe edin. </li><li> Bir plazmid hazırlama kiti kullanarak plazmid ayıklayın; Üreticinin protokolünü izleyin. </li><li> Sanger dizilemesi ile doğru klonları tanımlayın 11 . </li></ol> 3. C-Tuğla Montajı ( Şekil 2 ) <ol><li> C-Brick vektörünün Cpf1 ile sindirimi <ol><li> 22.5 uL RNaz içermeyen su, 4 μL 10x Cpf1 tamponu, adım 2.6&#39;dan (1 μg) plazmidden 10 μL, RRI&#39;nin 0.5 μL&#39;si ve 1 μl# 181; L Cpfl&#39;den (5 uM) 1.5 mL&#39;lik bir mikrosantrifüj tüpüne. NOT: Cpf1 ticari olarak satın alınabilir veya önceki bir çalışmada protokolden sonra saflaştırılabilir 4 . </li><li> T1 ve T2 bölgelerine yabancı bir DNA parçası eklemek için, 1 μL crRNA-T2 (10 uM) ilave edin ve 30 dakika boyunca 37 ° C&#39;de bir su banyosunda inkübe edin. Bir dd 1 μL crRNA-T1 (10 uM) ve Cpfl (5 uM) 30 dakika daha. NOT: Alternatif olarak, T3 ve T4 bölgelerine yabancı bir DNA parçası eklemek için 1 μL crRNA-T3 (10 uM) ilave edin ve 30 dakika boyunca 37 ° C&#39;de bir su banyosunda inkübe edin. Başka bir 30 dakika boyunca 1 μL crRNA-T4 (10 uM) ekleyin. </li><li> 1 μL termal duyarlı alkalin fosfataz ekleyin ve tüp 37 ° C su banyosunda 1 saat daha inkübe edin. </li><li> Bir agaroz jel elektroforezi çalıştırın ve bir jel temizleme sistemi kiti kullanarak vektörü arındırın. Numuneleri derhal kullanın veya dondurun ve -20 ° C&#39;de saklayın. </li></ol></li&gt; <li> DNA parçasının Cpfl ile sindirimi <ol><li> RNase içermeyen 21.5 μL su, 4 μL 10x Cpf1 tamponu, adım 2.6&#39;dan (2 μg) plazmid 10 μL, RRI 0.5 μL ve Cpf1&#39;den (5 μM) 2 mL Tl 1.5 mL mikrosantrifüj tüpüne ekleyin. </li><li> T1 ve T2 bölgeleri içine yabancı bir DNA parçası eklemek için, 1 μL crRNA-T1 (10 μM) ve 1 μL crRNA-T3 (10 μM) ekleyin ve 37 ° C&#39;de 2 saat su banyosunda inkübe edin. NOT: Alternatif olarak, 1 μL crRNA-T2 (10 μM) ve 1 μL crRNA-T4 (10 μM) ekleyin ve 37 ° C&#39;de 2 saat su banyosunda inkübe edin. </li><li> Bir agaroz jel elektroforez çalıştırın ve bir jel temizleme sistemi kiti kullanarak parça saflaştırmak. Numuneleri derhal kullanın veya dondurun ve -20 ° C&#39;de saklayın. </li></ol></li><li> C-Tuğla montajı ve ileri doğrulama <ol><li> Yabancı DNA parçasını ve C-Brick vektörünü ligatlayın: 2 μL doğrusal vektörü ekleyin (50 ng) adım 3.1.4&#39;ten ve 6 mcL DNA fragmanı (200 ng) adım 3.2.3&#39;ten 1.5 mL mikrosantrifüj tüpüne aktarılmıştır. 1 μL 10x T4 DNA ligaz tamponu ve 1 μL T4 DNA ligaz ekleyin. 22 ° C&#39;de 2 saat inkübe edin. Numuneleri derhal kullanın veya dondurun ve -20 ° C&#39;de saklayın. </li><li> E. coli (DH10B) -erkentent hücrelere kimyasal transformasyon için 10 μL ligasyon ürünlerini (adım 3.3.1) ekleyin. </li><li> 5 mL&#39;lik bir sıvı LB tüpüne birkaç klon ekleyin ve gece boyunca 220 rpm ve 37 ° C&#39;de çalkalayıcıda inkübe edin. </li><li> Bir plazmid hazırlama kiti kullanarak plazmid ayıklayın; Üreticinin protokolünü izleyin. </li><li> Sanger dizilemesi ile doğru klonları tanımlayın 11 . </li></ol></li><li> C-Tuğla montajının yeni turunu yapın. Adım 3.3.4&#39;teki doğru klonlar, adım 3.1-3.3&#39;teki aynı protokol izlenerek, tekrar tekrar C-Brick montajı için yeni bir C-Tuğla vektörü veya DNA parçası olarak kullanılabilir. NOT: T2 &#39;ve T3&#39;ünItes, T2 ve T3 bölgelerinin yedeği olarak tasarlanmıştır ( Şekil 1a ). Adım 2.3.7&#39;den elde edilen plasmidler için, sadece C-Tuğla standart montajı için T2 &#39;ve T3&#39; kullanılabilir. </li></ol>

<ol>
	<li>Canton, B., Labno, A., Endy, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Refinement+and+standardization+of+synthetic+biological+parts+and+devices.">Refinement and standardization of synthetic biological parts and devices.</a> Nat Biotechnol. 26 (7), 787-793 (2008).</li><li>Shetty, R. P., Endy, D., Knight, T. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+BioBrick+vectors+from+BioBrick+parts.">Engineering BioBrick vectors from BioBrick parts.</a> J Biol Eng. 2, (2008).</li><li>Knight, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Idempotent Vector Design for Standard Assembly of Biobricks. , 1-11 (2003).</li><li>Li, S. Y., Zhao, G. P., Wang, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=C-Brick:+A+New+Standard+for+Assembly+of+Biological+Parts+Using+Cpf1.">C-Brick: A New Standard for Assembly of Biological Parts Using Cpf1.</a> ACS Synth Biol. 5 (12), 1383-1388 (2016).</li><li>Anderson, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=BglBricks:+A+flexible+standard+for+biological+part+assembly.">BglBricks: A flexible standard for biological part assembly.</a> J Biol Eng. 4 (1), (2010).</li><li>Liu, J. K., Chen, W. H., Ren, S. X., Zhao, G. P., Wang, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=iBrick:+a+new+standard+for+iterative+assembly+of+biological+parts+with+homing+endonucleases.">iBrick: a new standard for iterative assembly of biological parts with homing endonucleases.</a> PLoS One. 9 (10), e110852 (2014).</li><li>Hsu, P. D., Lander, E. S., Zhang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+applications+of+CRISPR-Cas9+for+genome+engineering.">Development and applications of CRISPR-Cas9 for genome engineering.</a> Cell. 157 (6), 1262-1278 (2014).</li><li>Wright, A. V., Nunez, J. K., Doudna, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Biology+and+Applications+of+CRISPR+Systems:+Harnessing+Nature's+Toolbox+for+Genome+Engineering.">Biology and Applications of CRISPR Systems: Harnessing Nature's Toolbox for Genome Engineering.</a> Cell. 164 (1-2), 29-44 (2016).</li><li>Jinek, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+programmable+dual-RNA-guided+DNA+endonuclease+in+adaptive+bacterial+immunity.">A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity.</a> Science. 337 (6096), 816-821 (2012).</li><li>Zetsche, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cpf1+is+a+single+RNA-guided+endonuclease+of+a+class+2+CRISPR-Cas+system.">Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system.</a> Cell. 163 (3), 759-771 (2015).</li><li>Sanger, F., Nicklen, S., Coulson, A. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+sequencing+with+chain-terminating+inhibitors.">DNA sequencing with chain-terminating inhibitors.</a> Proc Natl Acad Sci U S A. 74 (12), 5463-5467 (1977).</li><li>Engler, C., Kandzia, R., Marillonnet, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+one+pot,+one+step,+precision+cloning+method.">A one pot, one step, precision cloning method.</a> PLoS One. 3 (11), e3647 (2008).</li><li>Gibson, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+assembly+of+DNA+molecules+up+to+several+hundred+kilobases.">Enzymatic assembly of DNA molecules up to several hundred kilobases.</a> Nat Methods. 6 (5), 343-345 (2009).</li><li>Casini, A., Storch, M., Baldwin, G. S., Ellis, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bricks+and+blueprints:+methods+and+standards+for+DNA+assembly.">Bricks and blueprints: methods and standards for DNA assembly.</a> Nat Rev Mol Cell Biol. 16 (9), 568-576 (2015).</li><li>Cameron, D. E., Bashor, C. J., Collins, J. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+brief+history+of+synthetic+biology.">A brief history of synthetic biology.</a> Nat Rev Microbiol. 12 (5), 381-390 (2014).</li><li>Keasling, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+biology+for+synthetic+chemistry.">Synthetic biology for synthetic chemistry.</a> ACS Chem Biol. 3 (1), 64-76 (2008).</li></ol>

Yazarların açıklayacak bir şeyi yok.

Bu protokol DNA montaj standardı C-Brick için bir prosedürü açıklamaktadır. Bu protokolün en önemli adımı, C-Brick standart vektörünün doğrusallaştırılmasıdır; Vektörün tamamlanmamış bölünmesi başarı oranını ciddi şekilde etkileyebilir. Buna ek olarak, Cpf1 esas olarak &quot;18-23&quot; bölünme paterninde hedef DNA sekanslarını parçalasa da, DNA toplanmasından sonra az sayıda mutasyona neden olabilecek iki baz yakınındaki yanlişlı bölünme 4 de tespit ed...

DNA biyolojik parçalarının standardizasyonu sentetik biyolojinin gelişimi için önemlidir 1 . Bir DNA montaj prosedürünün geliştirilmesi, geçici test tasarımlarının yerini alabilir ve genetik bileşenlerin daha büyük sistemlere montajı sırasında ortaya çıkan beklenmedik sonuçların çoğunu kaldırabilir. BioBrick standardı (BBF RFC 10), önerilen en erken DNA montaj standartlarından biriydi. Önek dizisini (EcoRI ve Xbal kesim bölgeleri içeren) ve son ekleme dizisini (SpeI ve PstI kesme bölgelerini içeren) 2 , 3 kullanır . XbaI ve SpeI&#39;nin birbirine tamamlayıcı uçları olduğu için, XbaI ve SpeI ile kesilen BioBrick DNA parçaları, tekrar tekrar montaj için yeni bir BioBrick üretecek şekilde birleştirilebilir. Bazı kusurlar, BioBrick standardı 4 kullanılarak tanımlanmıştır. Örneğin, 8 bp&#39;lik bir skar üretirFüzyon proteinlerinin inşasına izin vermeyen DNA parçaları arasında. Ayrıca, yukarıda sözü edilen dört 6-bp kısıtlama sahası türü DNA parçalardan çıkarılmalıdır; bu çok rahatsız edicidir. İlk problemi çözmek için BglBrick standardı kuruldu 5 . Gly-Ser üreten ve çoklu proteinlerin veya protein alanlarının kaynaşmasına izin veren 6 bp &quot;GGATCT&quot; skarını oluşturur. IBrick, ikinci problemle başa çıkmak için geliştirildi 6 . Uzun DNA sekanslarını tanıyan homojenleştirme endonükleazları (HE) kullanır. HE tanıma siteleri nadiren doğal DNA dizilerinde mevcut olduğundan, iBrick standardı, DNA dizilerini değiştirmeden iBrick parçalarının doğrudan yapımı için kullanılabilir. Bununla birlikte, iBrick standardı DNA parçaları arasında 21 bp&#39;lik bir skar bırakır ve bu da onun hoşnutsuzluğunun nedeni olabilir. Son yıllarda kümelenmiş düzenli aralıklı kısa palindromik tekrarlar (CRISPR) sistemi hızla gelişti 7 , 8 . CRISPR ile ilişkili (Cas) proteinler arasında, Streptococcus pyogenes&#39;ten Cas9 endonuclease şimdi yaygın olarak kullanılmaktadır . Çoğunlukla künt uçları olan çift sarmal DNA kopmaları (DSB&#39;ler) getirir 9 . 2015&#39;te Zhang ve arkadaşları, Cpf1&#39;i ( Prevotella ve Francisella 1&#39;den CRISPR) ilk kez karakterize etti . Sınıf 2 tip V CRISPR-Cas sistemine aittir ve bir CRISRP RNA (crRNA) rehberli endonükleaz 10&#39;dur . Cas9&#39;un aksine, Cpf1, 4 veya 5 nt 5 &#39;çıkıntı 10 içeren bir DSB&#39;yi sunar. Bu özelliğe dayanarak Cpf1, bir DNA montaj standardı olan C-Brick 4&#39;ü geliştirmek için kullanıldı. Bir C-Tuğla standart vektöründe, ön ek T1 / T2&#39;nin ve bitişik T3 / T4&#39;ün dört Cpf1 hedef bölgesi biyolojik kısımlara kenetlenir; Bu, BioBrick standardına benzer. T2 ve T3 bölmelerinin bölünmesi pTamamlayıcı yapışkan uçları geliştirir, parçaların arasına bir &quot;GGATCC&quot; yara üretirken DNA bölümlerinin yinelemeli montajını gerçekleştirmek mümkündür. Özellikle, C-Brick standardının iki ana avantajı vardır: uzun hedef sekansları tanımak ve kısa izleri bırakmak. C-Brick tarafından üretilen 6 bp&#39;lik &quot;GGATCC&quot; skar, füzyon proteinlerinin oluşturulmasına izin veren Gly-Seriyi kodlar. Ayrıca, C-Brick standardı da kısmen BglBrick ve BioBrick standartlarıyla uyumludur.

<table border="0" cellpadding="0" cellspacing="0" width="828">
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Comercial Oligonucleotide</td>
			<td style="width:160px;">Sangon Biotech</td>
			<td style="width:161px;"></td>
			<td style="width:191px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">10x Taq PCR Buffer</td>
			<td style="width:160px;">Transgen</td>
			<td style="width:161px;">#J40928</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Ultra Pure Distilled Water</td>
			<td style="width:160px;">Invitrogen</td>
			<td style="width:161px;">10977-015</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">5x RNA Transcription Buffer</td>
			<td style="width:160px;">Thermo Scientific</td>
			<td style="width:161px;">K0441</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">T7 RNA polymerase</td>
			<td style="width:160px;">Thermo Scientific</td>
			<td style="width:161px;">#EP0111</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">NTP mixture</td>
			<td style="width:160px;">Sangon</td>
			<td style="width:161px;">#ND0056</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">RRI(Recombinant RNase Inhibitor)</td>
			<td style="width:160px;">Takara</td>
			<td style="width:161px;">2313A</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">RNA Clean &#38; Concentrator-5</td>
			<td style="width:160px;">Zymo Research</td>
			<td style="width:161px;">R1015</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">UV-Vis Spectrometer</td>
			<td style="width:160px;">Thermo Scientific</td>
			<td style="width:161px;">Nano-Drop 2000c</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">2x Phanta Max Buffer</td>
			<td style="width:160px;">Vazyme</td>
			<td style="width:161px;">PB505</td>
			<td>PCR buffer</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">dNTPs</td>
			<td style="width:160px;">Transgen</td>
			<td style="width:161px;">AD101</td>
			<td></td>
		</tr>
		<tr height="40">
			<td height="40" style="height:40px;width:316px;">Phanta Max Super-Fidelity DNA Polymerase</td>
			<td style="width:160px;">Vazyme</td>
			<td style="width:161px;">P505-d1</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Ezmax for One-step Cloning</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">24303-1</td>
			<td>seamless assembly kit</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">5x Buffer for Ezmax One-step Cloning</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">32006</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">BamHI</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#R0136L</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">BamHI-HF</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#R3136L</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">BglII&#160;</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#R0144L</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">XbaI</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#R0145L</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">SpeI</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#R3133L</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">10x Buffer 3</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#B7003S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">10x CutSmart Buffer</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">B7204S</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">10x T4 DNA ligase Buffer</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">32002</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">T4 PNK</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">32206</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">T4 DNA ligase</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">32210</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">DpnI</td>
			<td style="width:160px;">NEB</td>
			<td style="width:161px;">#R01762</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">SV Gel and PCR clean-up system</td>
			<td style="width:160px;">Promega</td>
			<td style="width:161px;">A9282</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Plasmid Mini Kit I</td>
			<td style="width:160px;">Omega</td>
			<td style="width:161px;">D6943-02</td>
			<td>plasmid preparation kit</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">thermosensitive alkaline phosphatase&#160;</td>
			<td style="width:160px;">Thermo Scientific</td>
			<td style="width:161px;">#EF0651</td>
			<td>FastAP</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">10x Cpf1 buffer</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">32008</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Cpf1</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">32105</td>
			<td>FnCpf1</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">thermocycler</td>
			<td style="width:160px;">Applied Biosystems</td>
			<td style="width:161px;">veriti 96 well</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">C-Brick standard vector</td>
			<td style="width:160px;">Tolobio</td>
			<td style="width:161px;">98101</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">E. coli [DH10B]</td>
			<td style="width:160px;">Invitrogen</td>
			<td style="width:161px;">18297010</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Luria-Bertani media (tryptone)</td>
			<td style="width:160px;">Oxoid</td>
			<td style="width:161px;">LP0042</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Luria-Bertani media (yeast extract)</td>
			<td style="width:160px;">Oxoid</td>
			<td style="width:161px;">LP0021</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;width:316px;">Luria-Bertani media (NaCl)</td>
			<td style="width:160px;">Sangon Biotech</td>
			<td style="width:161px;">B126BA0007</td>
			<td></td>
		</tr>
	</tbody>
</table>

protocols for c-brick dna standard assembly using cpf1

CRISPR ile ilişkili protein Cpf1 çift sarmallı DNA&#39;yı CRISPR RNA&#39;nın (crRNA) rehberliğinde parçalayıp yapışkan uçlar üretir. Bu özellikten dolayı Cpf1, C-Brick adı verilen ve uzun tanıma yerleri ve kısa izlerin avantajına sahip bir DNA montaj standardının oluşturulması için kullanılmıştır. Standart bir C-Tuğla vektöründe, dört Cpf1 tanıma bölgesi vardır - ön ek (T1 ve T2 siteleri) ve son ek (T3 ve T4 bölgeleri) - biyolojik DNA parçalarını çevreleyen. T2 ve T3 bölgelerinin bölünmesi tamamlayıcı yapışkan uçlar üretir ve bu da T2 ve T3 bölgeleriyle DNA parçalarının birleştirilmesini sağlar. Bu arada, montajdan sonra parçalar arasında kısa bir &quot;GGATCC&quot; skarı meydana gelir. Yeni oluşturulan plazmid dört kez Cpf1 bölünme yerini bir kez daha içerdiğinden yöntem, DNA parçalarının yinelenen montajını sağlar ve bu da, BioBrick ve BglBrick standartlarına benzer. DNA parçalarını bir araya getirmek için C-Brick standardının kullanımını özetleyen bir prosedürBurada açıklanmaktadır. C-Brick standardı, bilim adamları, lisansüstü öğrenciler ve lisans öğrencileri ve hatta amatörler tarafından yaygın bir şekilde kullanılabilir.

<html> Bu protokol, üç kromoprotein kasetinin (cjBlue (BBa_K592011), red (BBa_K592012) ve amilGFP&#39;nin (BBa_K592010) montajını gösterdi. Birincisi, yukarıda bahsedilen üç genin ve sonlandırıcıların kodlama dizileri ayrı ayrı bir C-Brick standart vektörüne klonlanmıştır. Kısa DNA kısımları, promotör ve terminatör, 5 &#39;terminalindeki kısa DNA kısımlarını içeren primerler kullanılarak PCR amplifikasyonuyla C-Brick vektörüne sokuldu. Bunu self-ligasyon ...

Watch this Scientific Journal Video about Protocols for C-Brick DNA Standard Assembly Using Cpf1 at JoVE.com

Protocols for C-Brick DNA Standard Assembly Using Cpf1

CRISPR ile ilişkili protein Cpf1, özel olarak tasarlanmış bir CRISPR RNA (crRNA) yardımıyla, istenilen noktalarda çift sarmallı DNA&#39;yı parçalayıp yapışkan uçlar üretebilir. Bu karakteristiğe dayanarak, bir DNA montaj standardı (C-Brick) oluşturuldu ve kullanımını ayrıntılandıran bir protokol burada açıklandı.

Cpf1&#39;i Kullanarak C-Brick DNA Standart Montajı İçin Protokoller

CRISPR-associated protein Cpf1 cleaves double-stranded DNA under the guidance of CRISPR RNA (crRNA), generating sticky ends. Because of this ...

protocols-for-c-brick-dna-standard-assembly-using-cpf1

Research

JoVE Journal

Genetics

8.2K Görüntüleme.  Chinese Academy of Sciences.  CRISPR ile ilişkili protein Cpf1, özel olarak tasarlanmış bir CRISPR RNA (crRNA) yardımıyla, istenilen noktalarda çift sarmallı DNA'yı parçalayıp yapışkan uçlar üretebilir. Bu karakteristiğe dayanarak, bir DNA montaj standardı (C-Brick) oluşturuldu ve kullanımını ayrıntılandıran bir protokol burada açıklandı. 

Video: Protocols for C-Brick DNA Standard Assembly Using Cpf1

Methyl-binding DNA capture Sequencing for Patient Tissues

Methylation is one of the essential epigenetic modifications to the DNA, which is responsible for the precise regulation of genes required for stable development and differentiation of different tissue types. Dysregulation of this process is often the hallmark of various diseases like cancer. Here, we outline one of the recent sequencing techniques, Methyl-Binding DNA Capture sequencing (MBDCap-seq), used to quantify methylation in various normal and disease tissues for large patient cohorts. We describe a detailed protocol of this affinity enrichment approach along with a bioinformatics pipeline to achieve optimal quantification. This technique has been used to sequence hundreds of patients across various cancer types as a part of the 1,000 methylome project (Cancer Methylome System).

Here we present a protocol to investigate genome wide DNA methylation in large scale clinical patient screening studies using the Methyl-Binding DNA Capture sequencing (MBDCap-seq or MBD-seq) technology and the subsequent bioinformatics analysis pipeline.

Hasta Dokularda metil-bağlayıcı DNA yakalama Dizi

Methylation is one of the essential epigenetic modifications to the DNA, which is responsible for the precise regulation of genes required for stable ...

Genetik

Determination of the Optimal Chromosomal Location(s) for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In bacteria, the impact of the genetic context on the function of a genetic element can be difficult to assess. Several mechanisms, including topological effects, transcriptional interference from neighboring genes, and/or replication-associated gene dosage, may affect the function of a given genetic element. Here, we describe a method that permits the random integration of a DNA element into the chromosome of Escherichia coli and select the most favorable locations using a simple growth competition experiment. The method takes advantage of a well-described transposon-based system of random insertion, coupled with a selection of the fittest clone(s) by growth advantage, a procedure that is easily adjustable to experimental needs. The nature of the fittest clone(s) can be determined by whole-genome sequencing on a complex multi-clonal population or by easy gene walking for the rapid identification of selected clones. Here, the non-coding DNA region DARS2, which controls the initiation of chromosome replication in E. coli, was used as an example. The function of DARS2 is known to be affected by replication-associated gene dosage; the closer DARS2 gets to the origin of DNA replication, the more active it becomes. DARS2 was randomly inserted into the chromosome of a DARS2-deleted strain. The resultant clones containing individual insertions were pooled and competed against one another for hundreds of generations. Finally, the fittest clones were characterized and found to contain DARS2 inserted in close proximity to the original DARS2 location.

Determination of the Optimal Chromosomal Locations for a DNA Element in Escherichia coli Using a Novel Transposon-mediated Approach

Here, the power of a transposon-mediated random insertion of a non-coding DNA element was used to resolve its optimal chromosomal position.

En iyi kromozom Location(s) belirlenmesi için yeni bir Transposon-aracılı yaklaşımın kullanarak Escherichia coli DNA öğesinde

The optimal chromosomal position(s) of a given DNA element was/were determined by transposon-mediated random insertion followed by fitness selection. In ...

Immunostaining for DNA Modifications: Computational Analysis of Confocal Images

For several decades, 5-methylcytosine (5mC) has been thought to be the only DNA modification with a functional significance in metazoans. The discovery of enzymatic oxidation of 5mC to 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC) as well as detection of N6-methyladenine (6mA) in the DNA of multicellular organisms provided additional degrees of complexity to the epigenetic research. According to a growing body of experimental evidence, these novel DNA modifications may play specific roles in different cellular and developmental processes. Importantly, as some of these marks (e. g. 5hmC, 5fC and 5caC) exhibit tissue- and developmental stage-specific occurrence in vertebrates, immunochemistry represents an important tool allowing assessment of spatial distribution of DNA modifications in different biological contexts. Here the methods for computational analysis of DNA modifications visualized by immunostaining followed by confocal microscopy are described. Specifically, the generation of 2.5 dimension (2.5D) signal intensity plots, signal intensity profiles, quantification of staining intensity in multiple cells and determination of signal colocalization coefficients are shown. Collectively, these techniques may be operational in evaluating the levels and localization of these DNA modifications in the nucleus, contributing to elucidating their biological roles in metazoans.

Newly discovered oxidized forms of 5-methylcytosine (oxi-mCs), 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC) may represent distinct DNA modifications with unique functional roles. Here a semi-quantitative workflow for visualization of oxi-mCs' spatial distribution, signal intensity profiling and colocalization is described.

DNA değişiklikler için Immunostaining: Confocal görüntülerin sayısal analiz

For several decades, 5-methylcytosine (5mC) has been thought to be the only DNA modification with a functional significance in metazoans. The discovery of ...

Profiling DNA Replication Timing Using Zebrafish as an In Vivo Model System

DNA replication timing is an important cellular characteristic, exhibiting significant relationships with chromatin structure, transcription, and DNA mutation rates. Changes in replication timing occur during development and in cancer, but the role replication timing plays in development and disease is not known. Zebrafish were recently established as an in vivo model system to study replication timing. Here is detailed the protocols for using the zebrafish to determine DNA replication timing. After sorting cells from embryos and adult zebrafish, high-resolution genome-wide DNA replication timing patterns can be constructed by determining changes in DNA copy number through analysis of next generation sequencing data. The zebrafish model system allows for evaluation of the replication timing changes that occur in vivo throughout development, and can also be used to assess changes in individual cell types, disease models, or mutant lines. These methods will enable studies investigating the mechanisms and determinants of replication timing establishment and maintenance during development, the role replication timing plays in mutations and tumorigenesis, and the effects of perturbing replication timing on development and disease.

Profiling DNA Replication Timing Using Zebrafish as an In Vivo Model System

Zebrafish were recently used as an in vivo model system to study DNA replication timing during development. Here is detailed the protocols for using zebrafish embryos to profile replication timing. This protocol can be easily adapted to study replication timing in mutants, individual cell types, disease models, and other species.

Zebra balığı bir Vivo içinde Model sistemi olarak kullanarak DNA çoğaltma zamanlaması profil oluşturma

DNA replication timing is an important cellular characteristic, exhibiting significant relationships with chromatin structure, transcription, and DNA ...

Investigation of Protein Recruitment to DNA Lesions Using 405 Nm Laser Micro-irradiation

The DNA Damage Response (DDR) uses a plethora of proteins to detect, signal, and repair DNA lesions. Delineating this response is critical to understand genome maintenance mechanisms. Since recruitment and exchange of proteins at lesions are highly dynamic, their study requires the ability to generate DNA damage in a rapid and spatially-delimited manner. Here, we describe procedures to locally induce DNA damage in human cells using a commonly available laser-scanning confocal microscope equipped with a 405 nm laser line. Accumulation of genome maintenance factors at laser stripes can be assessed by immunofluorescence (IF) or in real-time using proteins tagged with fluorescent reporters. Using phosphorylated histone H2A.X (&#947;-H2A.X) and Replication Protein A (RPA) as markers, the method provides sufficient resolution to discriminate locally-recruited factors from those that spread on adjacent chromatin. We further provide ImageJ-based scripts to efficiently monitor the kinetics of protein relocalization at DNA damage sites. These refinements greatly simplify the study of the DDR dynamics.

Studying DNA damage repair kinetics requires a system to induce lesions at defined sub-nuclear regions. We describe a method to create localized double-stranded breaks using a laser-scanning confocal microscope equipped with a 405 nm laser and provide automated procedures to quantify the dynamics of repair factors at these lesions.

Soruşturma 405 Nm lazer mikro-ile kullanarak DNA lezyonlar için Protein alımı

The DNA Damage Response (DDR) uses a plethora of proteins to detect, signal, and repair DNA lesions. Delineating this response is critical to understand ...

Rare Event Detection Using Error-corrected DNA and RNA Sequencing

Conventional next-generation sequencing techniques (NGS) have allowed for immense genomic characterization for over a decade. Specifically, NGS has been used to analyze the spectrum of clonal mutations in malignancy. Though far more efficient than traditional Sanger methods, NGS struggles with identifying rare clonal and subclonal mutations due to its high error rate of ~0.5&#8211;2.0%. Thus, standard NGS has a limit of detection for mutations that are &#62;0.02 variant allele fraction (VAF). While the clinical significance for mutations this rare in patients without known disease remains unclear, patients treated for leukemia have significantly improved outcomes when residual disease is &#60;0.0001 by flow cytometry. In order to mitigate this artefactual background of NGS, numerous methods have been developed. Here we describe a method for Error-corrected DNA and RNA Sequencing (ECS), which involves tagging individual molecules with both a 16 bp random index for error-correction and an 8 bp patient-specific index for multiplexing. Our method can detect and track clonal mutations at variant allele fractions (VAFs) two orders of magnitude lower than the detection limit of NGS and as rare as 0.0001 VAF.

Next-generation sequencing (NGS) is a powerful tool for genomic characterization that is limited by the high error rate of the platform (~0.5&#8211;2.0%). We describe our methods of error-corrected sequencing that allow us to obviate the NGS error rate and detect mutations at variant allele fractions as rare as 0.0001.

Nadiren de olsa algılama hatası düzeltildi DNA ve RNA sıralama

Conventional next-generation sequencing techniques (NGS) have allowed for immense genomic characterization for over a decade. Specifically, NGS has been ...

Methodology for Accurate Detection of Mitochondrial DNA Methylation

Quantification of DNA methylation can be achieved using bisulfite sequencing, which takes advantage of the property of sodium bisulfite to convert unmethylated cytosine into uracil, in a single-stranded DNA context. Bisulfite sequencing can be targeted (using PCR) or performed on the whole genome and provides absolute quantification of cytosine methylation at the single base-resolution. Given the distinct nature of nuclear- and mitochondrial DNA, notably in the secondary structure, adaptions of bisulfite sequencing methods for investigating cytosine methylation in mtDNA should be made. Secondary and tertiary structure of mtDNA can indeed lead to bisulfite sequencing artifacts leading to false-positives due to incomplete denaturation poor access of bisulfite to single-stranded DNA. Here, we describe a protocol using an enzymatic digestion of DNA with BamHI coupled with bioinformatic analysis pipeline to allow accurate quantification of cytosine methylation levels in mtDNA. In addition, we provide guidelines for designing the bisulfite sequencing primers specific to mtDNA, in order to avoid targeting undesirable NUclear MiTochondrial segments (NUMTs) inserted into the nuclear genome.

Here, we present a protocol to allow accurate quantification of mitochondrial DNA (mtDNA) methylation. In this protocol, we describe an enzymatic digestion of DNA with BamHI coupled with a bioinformatic analysis pipeline which can be used to avoid overestimation of mtDNA methylation levels caused by the secondary structure of mtDNA.

Mitokondrial DNA metilasyonu doğru algılanması için metodoloji

Quantification of DNA methylation can be achieved using bisulfite sequencing, which takes advantage of the property of sodium bisulfite to convert ...

A Customizable Protocol for String Assembly gRNA Cloning (STAgR)

The bacterial CRISPR/Cas9 system has substantially increased methodological options for life scientists. Due to its utilization, genetic and genomic engineering became applicable to a large range of systems. Moreover, many transcriptional and epigenomic engineering approaches are now generally feasible for the first time. One reason for the broad applicability of CRISPR lies in its bipartite nature. Small gRNAs determine the genomic targets of the complex, variants of the protein Cas9, and the local molecular consequences. However, many CRISPR approaches depend on the simultaneous delivery of multiple gRNAs into individual cells. Here, we present a customizable protocol for string assembly gRNA cloning (STAgR), a method that allows the simple, fast and efficient generation of multiplexed gRNA expression vectors in a single cloning step. STAgR is cost-effective, since (in this protocol) the individual targeting sequences are introduced by short overhang primers while the long DNA templates of the gRNA expression cassettes can be re-used multiple times. Moreover, STAgR allows single step incorporation of a large number of gRNAs, as well as combinations of different gRNA variants, vectors and promoters.

A Customizable Protocol for String Assembly gRNA Cloning STAgR

Here, we present string assembly gRNA cloning (STAgR), a method to easily multiplex gRNA vectors for CRISPR/Cas9 approaches. STAgR makes gRNA multiplexing simple, efficient and customizable.

Dize birleştirme gRNA için özelleştirilebilir bir protokol klonlama (STAgR)

The bacterial CRISPR/Cas9 system has substantially increased methodological options for life scientists. Due to its utilization, genetic and genomic ...

Assessing Stem Cell DNA Integrity for Cardiac Cell Therapy

Stem and stem-cell-derived cells have immense potential as a regenerative therapy for various degenerative diseases. DNA is the storehouse of genetic data in all cells, including stem cells, and its integrity is fundamental to its regenerative ability. Stem cells undergo rapid propagation in labs to achieve the necessary numbers for transplantation. Accelerated cell growth leads to the loss of DNA integrity by accumulated metabolites, such as reactive oxygen, carbonyl, and alkylating agents. Transplanting these cells would result in poor engraftment and regeneration of the deteriorating organ. Moreover, transplanting DNA-damaged cells leads to mutations, DNA instability, cellular senescence, and possibly, life-threatening diseases such as cancer. Therefore, there is an immediate need for a quality control method to evaluate the cell's suitability for transplantation. Here, we provide step-by-step protocols for the assessment of the DNA integrity of stem cells prior to cell transplantation.

Here, we provide a detailed description of an experimental setup for an analysis of the assessment of DNA integrity in stem cells prior to cell transplantation.

Kardiyak hücre tedavisi için kök hücre DNA bütünlük değerlendirilmesi

Stem and stem-cell-derived cells have immense potential as a regenerative therapy for various degenerative diseases. DNA is the storehouse of genetic data ...

High-Throughput DNA Plasmid Multiplexing and Transfection Using Acoustic Nanodispensing Technology

Cell transfection, indispensable for many biological studies, requires controlling many parameters for an accurate and successful achievement. Most often performed at low throughput, it is moreover time-consuming and error-prone, even more so when multiplexing several plasmids. We developed an easy, fast, and accurate method to perform cell transfection in a 384-well plate layout using acoustic droplet ejection (ADE) technology. The nanodispenser device used in this study&#160;is based on this technology and allows precise nanovolume delivery at high speed from a source well plate to a destination one. It can dispense and multiplex DNA and transfection reagent according to a predesigned spreadsheet. Here we present an optimal protocol to perform ADE-based high-throughput plasmid transfection which makes it possible to reach an efficiency of up to 90% and a nearly 100% cotransfection in cotransfection experiments. We extend initial work by proposing a user-friendly spreadsheet-based macro, able to manage up to four plasmids/wells from a library containing up to 1,536 different plasmids, and a tablet-based pipetting guide application. The macro designs the necessary template(s) of the source plate(s) and generates the ready-to-use files for the nanodispenser and tablet-based application. The four-steps transfection protocol involves i) a diluent dispense with a classical liquid handler, ii) plasmid distribution and multiplexing, iii) a transfection reagent dispense by the nanodispenser, and iv) cell plating on the prefilled wells. The described software-based control of ADE plasmid multiplexing and transfection allows even nonspecialists in the field to perform a reliable cell transfection in a fast and safe way. This method enables rapid identification of optimal settings for a given cell type and can be transposed to higher-scale and manual approaches. The protocol eases applications, such as human ORFeome protein (set of open reading frames [ORFs] in a genome) expression or CRISPR-Cas9-based gene function validation, in nonpooled screening strategies.

This protocol describes high-throughput plasmid transfection of mammalian cells in a 384-well plate using acoustic droplet ejection technology. The time-consuming, error-prone DNA dispensing and multiplexing, but also the transfection reagent dispensing, are software-driven and performed by a nanodispenser device. The cells are then seeded in these prefilled wells.

Akustik Nanodispensing teknolojisini kullanarak yüksek verim DNA Plasmid multiplexing ve transfeksiyon

Cell transfection, indispensable for many biological studies, requires controlling many parameters for an accurate and successful achievement. Most often ...