Name: preparation and gene modification of nonhuman primate hematopoietic stem and progenitor cells
Uploaded: 2019-02-15T14:00:00.000+00:00
Duration: 11 min 16 s
Description: Watch this Scientific Journal Video about Preparation and Gene Modification of Nonhuman Primate Hematopoietic Stem and Progenitor Cells at JoVE.com

The authors thank Helen Crawford for preparing this manuscript, Jim Woolace for graphic design, and Veronica Nelson and Devikha Chandrasekaran for participating in the development of the protocol. The development of this protocol was supported by grants from the NIH National Institute of Allergy and Infectious Diseases (R01 AI135953 and AI138329 to H.P.K.) and the National Heart, Lung, and Blood Institute (R01 HL136135, HL116217, P01 HL122173, and U19 HL129902 to H.P.K.), as well as NIH P51 OD010425 and, in part through the NIH/NCI Cancer Center, Support Grant P30 CA015704. H.P.K. is a Markey Molecular Medicine Investigator and received support as the inaugural recipient of the Jos&#233; Carreras/E. Donnall Thomas Endowed Chair for Cancer Research and the Fred Hutch Endowed Chair for Cell and Gene Therapy.

The authors have nothing to disclose.

LV vector engineering is the best-characterized method to gene-modify cell types such as CD34+ HSPCs, for subsequent transplantation in vivo. The protocol described here is designed to maximize the number of gene-modified HSPCs that persist long-term in vivo, and provide clinical benefits to patients with various malignant, infectious, and genetic diseases. Although gene-editing strategies have emerged over the last decade, LV-modified cells are the best studied in vitro, in animal models, and in patients<sup ...

Stem cell gene therapy is a powerful means to address a wide range of human pathologies. HSPC gene therapy is a particularly attractive approach, due to i) the relative ease of collecting these cells from patients, ii) the wealth of knowledge that is available regarding cell surface phenotypes and ex vivo culture parameters, and, as the field expands, because iii) it presents scientists with an ever-increasing toolbox of gene modification strategies tailored to various diseases of interest. We are actively investigating HSPC gene therapy approaches from multiple angles, including the basic science of HSPC biology, the engraftment of gene-modified HSPCs in preclinical in vivo models, and the application to relevant patient populations. We and others have characterized the cell surface phenotype of functionally distinct HSPC subsets1,2,3, the mobilization and conditioning regimens that maximize HSPC yield and engraftment while minimizing toxicity4,5, and the gene modification and gene-editing strategies that have been tailored to a wide range of malignant, genetic, and infectious diseases6,7,8,9,10. The function and engraftment of gene-modified HSPCs can be evaluated in a number of small- and large-animal models, including mice, dogs, and NHPs. In particular, NHP models are advantageous because many reagents, for example, antibodies specific for HSPC cell surface proteins like CD34 and CD90, can be used interchangeably in human and NHP cells. Furthermore, in contrast to mice, large animals such as NHPs allow a closer approximation of the scale of gene modification necessary for clinical efficacy. Finally, NHPs are the gold standard for the modeling of human pathologies such as HIV-1 infection11 and are an emerging model system for candidate anticancer and anti-HIV immunotherapies12,13.
The purpose of this protocol is to outline methods for purifying, genetically modifying, and preparing NHP HSPC infusion products. Although outside the scope of this protocol, we have previously shown that these products engraft in autologous NHP hosts, give rise to all hematopoietic lineages, and provide therapeutic efficacy in a broad range of disease models1. We have also characterized the clonality of engrafting HSPCs and built a platform to track the kinetics, trafficking, and phenotype of individual HSPCs and their progeny, following autologous transplantation1,14. The methods presented here have been developed with the following goals: i) to isolate highly pure HSPCs and long-term engrafting HSC subsets, ii) to maintain primitive HSCs during ex vivo culture, and iii) to efficiently gene-modify either bulk HSPCs or long-term engrafting HSC subsets. We employ magnetic-assisted cell-sorting (MACS), as well as fluorescence-activated cell sorting (FACS), to isolate phenotypically/functionally distinct HSPC populations, consistent with the methods of many groups2,15,16. The maintenance of primitive HSCs in culture (i.e., minimizing the differentiation of these cells into committed progenitors that give rise to fully differentiated lymphoid and myeloid subsets) is an essential facet of the protocol described here. Although we have previously characterized approaches to expand HSPCs while retaining a primitive phenotype17,18, here, we describe a protocol that focuses on maintaining HSCs via a minimal (48 h) and defined ex vivo culture.
The efficient modification of HSPCs and HSC subsets is a central goal of this protocol. Among several approaches we have reported, two are by far the most investigated in clinical trials: LV-mediated gene modification and nuclease-mediated gene editing1,6,19.&#160;Gene-editing strategies use one of a number of nuclease platforms to specifically modify a targeted gene of interest, for example, C-C chemokine receptor type 5 (CCR5) for the treatment of HIV infection7,19 or Bcl11A for the treatment of hemoglobinopathies6. Here, we focus on LV-mediated gene modification, in which transgenic cargoes integrate semirandomly into the genome1,8,20. A key advantage of LV approaches is the ability to deliver large amounts of genetic material (up to 8 or 9 kilobases). Although gene-editing strategies are being developed to target a transgene of interest to integrate only at a specified locus by homologous donor recombination (HDR), these methods require further development in vitro and in small animal models. In contrast, LV vectors have been used extensively in NHPs and in patients21,22. Importantly, the protocol described here, which uses primed BM as a starting HSPC source, can be easily and broadly adapted, for example, to isolate PBSCs. As described above, we take advantage of the high degree of genetic similarity between NHPs and humans to use reagents that are applicable to both species. Finally, this approach has been adapted to modify other hematopoietic subsets, namely T cells12,23,24; the advent of efficacious T-cell immunotherapy approaches has relied heavily on the same LV platform utilized in this protocol. These methods are appropriate for any researcher interested in either HSPC biology or LV-mediated gene modification. For example, the HSPC purification protocol presented here could be used to characterize novel HSC-enriched subsets, as described previously1,15,25. Likewise, the LV transduction methods presented here could similarly be applied and further developed for numerous other cell types and experimental questions, both in in vitro and in vivo models.
In summary, we present methods to isolate and genetically modify NHP HSPCs. These methods can be easily adapted for other species and other sources of HSPCs. This thoroughly vetted protocol shows great promise in the modeling of efficacious therapies for numerous human diseases.

<table><tbody><tr><td>Stemspam SFEM II (&quot;HSPC&quot;) Media</td><td>StemCell</td><td>09655</td><td></td></tr><tr><td>Hank&#039;s Balanced Salt Solution</td><td>Gibco</td><td>14175095</td><td></td></tr><tr><td>Phosphate-Buffered Saline</td><td>Gibco</td><td>14190-144</td><td></td></tr><tr><td>Penicillin/Streptomycin</td><td>Gibco</td><td>15140-122</td><td></td></tr><tr><td>Dimethyl Sulfoxide</td><td>Sigma Aldrich</td><td>D2650-100</td><td></td></tr><tr><td>100% Ethanol</td><td>Decon labs</td><td>M18027161M</td><td></td></tr><tr><td>Cyclosporine</td><td>Sigma</td><td>30024-25MG</td><td></td></tr><tr><td>500 mM EDTA</td><td>Invitrogen</td><td>15575-038</td><td></td></tr><tr><td>Heat-Inactivated Fetal Bovine Serum</td><td>Sigma Aldrich</td><td>PS-0500-A</td><td></td></tr><tr><td>CH-296/ RetroNectin (2.5 mL, 1 &amp;micro;g/&amp;micro;L)</td><td>TaKaRA</td><td>T100B</td><td></td></tr><tr><td>Bovine Serum Albumin</td><td>Sigma</td><td>A7906-100g</td><td></td></tr><tr><td>HEPES</td><td>Sigma</td><td>H9897</td><td></td></tr><tr><td>Rat anti-mouse IgM magnetic beads</td><td>Miltenyi Biotec</td><td>130-047-301</td><td></td></tr><tr><td>Recombinant HumanStem Cell Factor (SCF)</td><td>Peprotech</td><td>300-07</td><td></td></tr><tr><td>Recombinant Human Thrombopoietin (TPO)</td><td>Peprotech</td><td>300-18</td><td></td></tr><tr><td>Recombinant Human FMS-like tyrosine kinase 3 (FLT-3)</td><td>Peprotech</td><td>300-19</td><td></td></tr><tr><td>Protamine sulfate</td><td>Sigma</td><td>P-4505</td><td></td></tr><tr><td>14 mL Polypropylene Round-Bottom Tube</td><td>Corning</td><td>352059</td><td></td></tr><tr><td>Colony Gel 1402</td><td>ReachBio</td><td>1402</td><td></td></tr><tr><td>QuadroMACS Separators</td><td>Miltenyi Biotec</td><td>130-090-976</td><td></td></tr><tr><td>MACS L25 Columns</td><td>Miltenyi biotec</td><td>130-042-401</td><td></td></tr><tr><td>10 mM PGE2</td><td>Cayman Chemical</td><td>14753-5mg</td><td></td></tr><tr><td>TC-treated T-75 flasks</td><td>Bioexpress</td><td>T-3001-2</td><td></td></tr><tr><td>Non-TC-treated T-75 flasks</td><td>Thermo-Fisher</td><td>13680-57</td><td></td></tr><tr><td>20 mL syringes</td><td>BD Biosciences</td><td>302830</td><td></td></tr><tr><td>16.5 G needles</td><td>BD Precision</td><td>305198</td><td></td></tr><tr><td>Syringe Tip Cap</td><td>BD Biosciences</td><td>305819</td><td></td></tr><tr><td>QuickExtract DNA Solution</td><td>Epicentre</td><td>QE09050</td><td></td></tr><tr><td>8-tube strip cap PCR Tubes</td><td>USA scientific</td><td>1402-2708</td><td></td></tr><tr><td>96-well Thermocycler</td><td>Thermo-Fisher</td><td>4375786</td><td></td></tr><tr><td>Pre-Separation filters</td><td>Miltenyi Biotec</td><td>130-041-407</td><td></td></tr><tr><td>Strainer, Cell; BD Falcon; Sterile; Nylon mesh; Mesh size: 70um; Color: white; 50/CS</td><td>fisher scientific</td><td>352350</td><td></td></tr><tr><td>Ultracomp ebeads</td><td>eBioscience</td><td>01-2222-42</td><td></td></tr><tr><td>MACSmix Tube Rotator</td><td>Miltenyi</td><td>130-090-753</td><td></td></tr><tr><td>3 mL Luer-Lock Syringes</td><td>Thermo-Fisher</td><td>14823435</td><td></td></tr><tr><td>35 mm x 10 mm cell culture dish</td><td>Corning</td><td>430165</td><td></td></tr><tr><td>60 mm x 15 mm cell culture dish</td><td>Corning</td><td>430196</td><td></td></tr><tr><td>150 mm x 25 mm cell culture dish</td><td>Corning</td><td>430599</td><td></td></tr><tr><td>Non TC treated flasks</td><td>Falcon</td><td>353133</td><td></td></tr><tr><td>Qiagen DNA extraction</td><td>Qiagen</td><td>51104</td><td></td></tr><tr><td>PE Anti-Human CD90 (Thy1) Clone:5E10</td><td>Biolegend</td><td>328110</td><td></td></tr><tr><td>PE-CF594 Mouse Anti-Human CD34 Clone:563</td><td>BD horizon</td><td>562449</td><td></td></tr><tr><td>APC-H7 Mouse Anti-Human CD45RA Clone: 5H9</td><td>BD Pharmingen</td><td>561212</td><td></td></tr><tr><td>V450 Mouse Anti-NHP CD45 Clone:d058-1283</td><td>BD Biosciences</td><td>561291</td><td></td></tr><tr><td>Autologous Serum</td><td>Collected from autologous host and cryopreserved prior to mobilization and collection of CD34+ HSPCs</td><td>N/A</td><td>Beard, B. C. et al. Efficient and stable MGMT-mediated selection of long-term repopulating stem cells in nonhuman primates. Journal of Clinical Investigation. 120 (7), 2345-2354, (2010).</td></tr><tr><td>Virus-Conditioned Media (VCM)</td><td>Kiem Lab, FHCRC Co-operative Center for Excellence in Hematology (CCEH)</td><td>N/A</td><td>Beard, B. C. et al. Efficient and stable MGMT-mediated selection of long-term repopulating stem cells in nonhuman primates. Journal of Clinical Investigation. 120 (7), 2345-2354, (2010).</td></tr><tr><td>Anti-CD34 antibody, Clone 12.8</td><td>Kiem Lab</td><td>N/A</td><td>Beard, B. C. et al. Efficient and stable MGMT-mediated selection of long-term repopulating stem cells in nonhuman primates. Journal of Clinical Investigation. 120 (7), 2345-2354, (2010).</td></tr><tr><td>Lenti F primer: AGAGATGGGTGCGAGAGCGTCA</td><td>Integrated DNA Technologies</td><td>N/A</td><td>Peterson, C. W. et al. Multilineage polyclonal engraftment of Cal-1 gene-modified cells and in vivo selection after SHIV infection in a nonhuman primate model of AIDS. Mol Ther Methods Clin Dev. 3 16007, (2016).</td></tr><tr><td>Lenti R primer: TGCCTTGGTGGGTGCTACTCCTAA</td><td>Integrated DNA Technologies</td><td>N/A</td><td>Peterson, C. W. et al. Multilineage polyclonal engraftment of Cal-1 gene-modified cells and in vivo selection after SHIV infection in a nonhuman primate model of AIDS. Mol Ther Methods Clin Dev. 3 16007, (2016).</td></tr><tr><td>Actin F primer: TCCTGTGGCACTCACGAAACT</td><td>Integrated DNA Technologies</td><td>N/A</td><td>Peterson, C. W. et al. Multilineage polyclonal engraftment of Cal-1 gene-modified cells and in vivo selection after SHIV infection in a nonhuman primate model of AIDS. Mol Ther Methods Clin Dev. 3 16007, (2016).</td></tr><tr><td>Actin R primer: GAAGCATTTGCGGTGGACGAT</td><td>Integrated DNA Technologies</td><td>N/A</td><td>Peterson, C. W. et al. Multilineage polyclonal engraftment of Cal-1 gene-modified cells and in vivo selection after SHIV infection in a nonhuman primate model of AIDS. Mol Ther Methods Clin Dev. 3 16007, (2016).</td></tr></tbody></table>

preparation and gene modification of nonhuman primate hematopoietic stem and progenitor cells

Hematopoietic stem and progenitor cell (HSPC) transplantation has been a cornerstone therapy for leukemia and other cancers for nearly half a century, underlies the only known cure of human immunodeficiency virus (HIV-1) infection, and shows immense promise in the treatment of genetic diseases such as beta thalassemia. Our group has developed a protocol to model HSPC gene therapy in nonhuman primates (NHPs), allowing scientists to optimize many of the same reagents and techniques that are applied in the clinic. Here, we describe methods for purifying CD34+ HSPCs and long-term persisting hematopoietic stem cell (HSC) subsets from primed bone marrow (BM). Identical techniques can be employed for the purification of other HSPC sources (e.g., mobilized peripheral blood stem cells [PBSCs]). Outlined is a 2 day protocol in which cells are purified, cultured, modified with lentivirus (LV), and prepared for infusion back into the autologous host. Key readouts of success include the purity of the CD34+ HSPC population, the ability of purified HSPCs to form morphologically distinct colonies in semisolid media, and, most importantly, gene modification efficiency. The key advantage to HSPC gene therapy is the ability to provide a source of long-lived cells that give rise to all hematopoietic cell types. As such, these methods have been used to model therapies for cancer, genetic diseases, and infectious diseases. In each case, therapeutic efficacy is established by enhancing the function of distinct HSPC progeny, including red blood cells, T cells, B cells, and/or myeloid subsets. The methods to isolate, modify, and prepare HSPC products are directly applicable and translatable to multiple diseases in human patients.

The protocol described above is designed to isolate and gene-modify NHP CD34+ HSPCs, which can subsequently be infused back into the autologous host (Figure 1 and Figure 2). When following this protocol, we usually obtain up to 8 x 109 total WBCs from primed BM from pigtail macaques and, sometimes, double that amount from rhesus macaques. In both species, the number of CD34+ HSPCs that we enrich i...

Watch this Scientific Journal Video about Preparation and Gene Modification of Nonhuman Primate Hematopoietic Stem and Progenitor Cells at JoVE.com

Preparation and Gene Modification of Nonhuman Primate Hematopoietic Stem and Progenitor Cells

The goal of this protocol is to isolate nonhuman primate CD34+ cells from primed bone marrow, to gene-modify these cells with lentiviral vectors, and to prepare a product for infusion into the autologous host. The total protocol length is approximately 48 h.

Hematopoietic stem and progenitor cell (HSPC) transplantation has been a cornerstone therapy for leukemia and other cancers for nearly half a century, ...

preparation-gene-modification-nonhuman-primate-hematopoietic-stem

Research

JoVE Journal

Genetics

7.5K Views.  Fred Hutchinson Cancer Research Center. Om de efficiëntie en veiligheid van veelbelovende en nieuwe gentherapiebenaderingen te evalueren, is het is van cruciaal belang dat gengemodificeerde cellen worden getest in gevalideerde preklinische in vivo-modellen. Het behoud van de kruisreactiviteit van reagentia van het gebied van het celoppervlak van reagentia en het vermogen om dezelfde ondersteunende behandelingen toe te passen die aan patiënten worden toegediend langs niet-menselijke primatenmodellen om klinische parameters nauw na...

Video: Preparation and Gene Modification of Nonhuman Primate Hematopoietic Stem and Progenitor Cells

Directed Differentiation of Primitive and Definitive Hematopoietic Progenitors from Human Pluripotent Stem Cells

One of the major goals for regenerative medicine is the generation and maintenance of hematopoietic stem cells (HSCs) derived from human pluripotent stem cells (hPSCs). Until recently, efforts to differentiate hPSCs into HSCs have predominantly generated hematopoietic progenitors that lack HSC potential, and instead resemble yolk sac hematopoiesis.&#160;These resulting hematopoietic progenitors may have limited utility for in vitro disease modeling of various adult hematopoietic disorders, particularly those of the lymphoid lineages. However, we have recently described methods to generate erythro-myelo-lymphoid multilineage definitive hematopoietic progenitors from hPSCs using a stage-specific directed differentiation protocol, which we outline here. Through enzymatic dissociation of hPSCs on basement membrane matrix-coated plasticware, embryoid bodies (EBs) are formed. EBs are differentiated to mesoderm by recombinant BMP4, which is subsequently specified to the definitive hematopoietic program by the GSK3&#946; inhibitor, CHIR99021. Alternatively, primitive hematopoiesis is specified by the PORCN inhibitor, IWP2. Hematopoiesis is further driven through the addition of recombinant VEGF and supportive hematopoietic cytokines. The resulting hematopoietic progenitors generated using this method have the potential to be used for disease and developmental modeling, in vitro.

Here, we present human pluripotent stem cell (hPSC) culture protocols, used to differentiate hPSCs into CD34+ hematopoietic progenitors. This method uses stage-specific manipulation of canonical WNT signaling to specify cells exclusively to either the definitive or primitive hematopoietic program.

One of the major goals for regenerative medicine is the generation and maintenance of hematopoietic stem cells (HSCs) derived from human pluripotent stem ...

Developmental Biology

The Preparation of Primary Hematopoietic Cell Cultures From Murine Bone Marrow for Electroporation

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser MXcell  electroporation system and Gene Pulser  electroporation buffer were specifically developed to transfect nucleic acids into mammalian cells and difficult-to-transfect cells, such as primary and stem cells.This video demonstrates how to establish primary hematopoietic cell cultures from murine bone marrow, and then prepare them for electroporation in the MXcell system. We begin by isolating femur and tibia. Bone marrow from both femur and tibia are then harvested and cultures are established. Cultured bone marrow cells are then transfected and analyzed.

This procedure describes how to establish primary hematopoietic cell cultures from murine bone marrow and is followed by transfection using the Gene Pulser MXCell electroporation system.

It is becoming increasingly apparent that electroporation is the most effective way to introduce plasmid DNA or siRNA into primary cells. The Gene Pulser ...

Biology

Engineering Oncogenic Heterozygous Gain-of-Function Mutations in Human Hematopoietic Stem and Progenitor Cells

Throughout their lifetime, hematopoietic stem and progenitor cells (HSPCs) acquire somatic mutations. Some of these mutations alter HSPC functional properties such as proliferation and differentiation, thereby promoting the development of hematologic malignancies. Efficient and precise genetic manipulation of HSPCs is required to model, characterize, and better understand the functional consequences of recurrent somatic mutations. Mutations can have a deleterious effect on a gene and result in loss-of-function (LOF) or, in stark contrast, may enhance function or even lead to novel characteristics of a particular gene, termed gain-of-function (GOF). In contrast to LOF mutations, GOF mutations almost exclusively occur in a heterozygous fashion. Current genome-editing protocols do not allow for the selective targeting of individual alleles, hampering the ability to model heterozygous GOF mutations. Here, we provide a detailed protocol on how to engineer heterozygous GOF hotspot mutations in human HSPCs by combining CRISPR/Cas9-mediated homology-directed repair and recombinant AAV6 technology for efficient DNA donor template transfer. Importantly, this strategy makes use of a dual fluorescent reporter system to allow for the tracking and purification of successfully heterozygously edited HSPCs. This strategy can be employed to precisely investigate how GOF mutations affect HSPC function and their progression toward hematological malignancies.

Novel strategies to faithfully model somatic mutations in hematopoietic stem and progenitor cells (HSPCs) are necessary to better study hematopoietic stem cell biology and hematological malignancies. Here, a protocol to model heterozygous gain-of-function mutations in HSPCs by combining the use of CRISPR/Cas9 and dual rAAV donor transduction is described.

Throughout their lifetime, hematopoietic stem and progenitor cells (HSPCs) acquire somatic mutations. Some of these mutations alter HSPC functional ...

Cancer Research

Protocol for MicroRNA Transfer into Adult Bone Marrow-derived Hematopoietic Stem Cells to Enable Cell Engineering Combined with Magnetic Targeting

While CD133+ hematopoietic stem cells (SCs) have been proven to provide high potential in the field of regenerative medicine, their low retention rates after injection into injured tissues as well as the observed massive cell death rates lead to very restricted therapeutic effects. To overcome these limitations, we sought to establish a non-viral based protocol for suitable cell engineering prior to their administration. The modification of human CD133+ expressing SCs using microRNA (miR) loaded magnetic polyplexes was addressed with respect to uptake efficiency and safety as well as the targeting potential of the cells. Relying on our protocol, we can achieve high miR uptake rates of 80&#8211;90% while the CD133+ stem cell properties remain unaffected. Moreover, these modified cells offer the option of magnetic targeting. We describe here a safe and highly efficient procedure for the modification of CD133+ SCs. We expect this approach to provide a standard technology for optimization of therapeutic stem cell effects and for monitoring of the administered cell product via magnetic resonance imaging (MRI).

This protocol illustrates a safe and efficient procedure to modify CD133+ hematopoietic stem cells. The presented non-viral, magnetic polyplex-based approach may provide a basis for the optimization of therapeutic stem cell effects as well as for monitoring the administered cell product via magnetic resonance imaging.

While CD133+ hematopoietic stem cells (SCs) have been proven to provide high potential in the field of regenerative medicine, their low retention rates ...

Bioengineering

Genetic Modification of Primate Cerebral Organoids

Targeted Microinjection and Electroporation of Primate Cerebral Organoids for Genetic Modification

The cerebral cortex is the outermost brain structure and is responsible for the processing of sensory input and motor output; it is seen as the seat of higher-order cognitive abilities in mammals, in particular, primates. Studying gene functions in primate brains is challenging due to technical and ethical reasons, but the establishment of the brain organoid technology has enabled the study of brain development in traditional primate models (e.g., rhesus macaque and common marmoset), as well as in previously experimentally inaccessible primate species (e.g., great apes), in an ethically justifiable and less technically demanding system. Moreover, human brain organoids allow the advanced investigation of neurodevelopmental and neurological disorders.
As brain organoids recapitulate many processes of brain development, they also represent a powerful tool to identify differences in, and to functionally compare, the genetic determinants underlying the brain development of various species in an evolutionary context. A great advantage of using organoids is the possibility to introduce genetic modifications, which permits the testing of gene functions. However, the introduction of such modifications is laborious and expensive. This paper describes a fast and cost-efficient approach to genetically modify cell populations within the ventricle-like structures of primate cerebral organoids, a subtype of brain organoids. This method combines a modified protocol for the reliable generation of cerebral organoids from human-, chimpanzee-, rhesus macaque-, and common marmoset-derived induced pluripotent stem cells (iPSCs) with a microinjection and electroporation approach. This provides an effective tool for the study of neurodevelopmental and evolutionary processes that can also be applied for disease modeling.

Author Spotlight: Targeted Microinjection and Electroporation of Primate Cerebral Organoids for Genetic Modification  

The electroporation of primate cerebral organoids provides a precise and efficient approach to introduce transient genetic modification(s) into different progenitor types and neurons in a model system close to primate (patho)physiological neocortex development. This allows the study of neurodevelopmental and evolutionary processes and can also be applied for disease modeling.

The cerebral cortex is the outermost brain structure and is responsible for the processing of sensory input and motor output; it is seen as the seat of ...

Lentiviral CRISPR/Cas9-Mediated Genome Editing for the Study of Hematopoietic Cells in Disease Models

Manipulating genes in hematopoietic stem cells using conventional transgenesis approaches can be time-consuming, expensive, and challenging. Benefiting from advances in genome editing technology and lentivirus-mediated transgene delivery systems, an efficient and economical method is described here that establishes mice in which genes are manipulated specifically in hematopoietic stem cells. Lentiviruses are used to transduce Cas9-expressing lineage-negative bone marrow cells with a guide RNA (gRNA) targeting specific genes and a red fluorescence reporter gene (RFP), then these cells are transplanted into lethally-irradiated C57BL/6 mice. Mice transplanted with lentivirus expressing non-targeting gRNA are used as controls. Engraftment of transduced hematopoietic stem cells are evaluated by flow cytometric analysis of RFP-positive leukocytes of peripheral blood. Using this method, ~90% transduction of myeloid cells and ~70% of lymphoid cells at 4 weeks after transplantation can be achieved. Genomic DNA is isolated from RFP-positive blood cells, and portions of the targeted site DNA are amplified by PCR to validate the genome editing. This protocol provides a high-throughput evaluation of hematopoiesis-regulatory genes and can be extended to a variety of mouse disease models with hematopoietic cell involvement.

Described are protocols for the highly efficient genome editing of murine hematopoietic stem and progenitor cells (HSPC) by the CRISPR/Cas9 system to rapidly develop mouse model systems with hematopoietic system-specific gene modifications.

Manipulating genes in hematopoietic stem cells using conventional transgenesis approaches can be time-consuming, expensive, and challenging. Benefiting ...

Immunology and Infection

Ex Vivo Expansion of Hematopoietic Stem Cells from Human Umbilical Cord Blood-derived CD34+ Cells Using Valproic Acid

Umbilical cord blood (UCB) units provide an alternative source of human hematopoietic stem cells (HSCs) for patients who require allogeneic bone marrow transplantation. While UCB has several unique advantages, the limited numbers of HSCs within each UCB unit limits their use in regenerative medicine and HSC transplantation in adults. Efficient expansion of functional human HSCs can be achieved by ex vivo culturing of CD34+ cells isolated from UCBs and treated with a deacetylase inhibitor, valproic acid (VPA). The protocol detailed here describes the culture conditions and methodology to rapidly isolate CD34+ cells and expand to a high degree a pool of primitive HSCs. The expanded HSCs are capable of establishing both short-term and long-term engraftment and are able to give rise to all types of differentiated hematopoietic cells. This method also holds potential for clinical application in autologous HSC gene therapy and provides an attractive approach to overcome the loss of functional HSCs associated with gene editing.

Ex Vivo Expansion of Hematopoietic Stem Cells from Human Umbilical Cord Blood-derived CD34+ Cells Using Valproic Acid

Here, we describe the ex vivo expansion of hematopoietic stem cells from CD34+ cells derived from umbilical cord blood treated with a combination of a cytokine cocktail and VPA. This method leads to a significant degree of ex vivo expansion of primitive HSCs for either clinical or laboratory applications.

Umbilical cord blood (UCB) units provide an alternative source of human hematopoietic stem cells (HSCs) for patients who require allogeneic bone marrow ...

Medicine

Gene Editing of Primary Rhesus Macaque B Cells

B cells and their progeny are the sources of highly expressed antibodies. Their high protein expression capabilities together with their abundance, easy accessibility via peripheral blood, and amenability to simple adoptive transfers have made them an attractive target for gene editing approaches to express recombinant antibodies or other therapeutic proteins. The gene editing of mouse and human primary B cells is efficient, and mouse models for in vivo studies have shown promise, but feasibility and scalability for larger animal models have so far not been demonstrated. We, therefore, developed a protocol to edit rhesus macaque primary B cells in vitro to enable such studies. We report conditions for in vitro culture and gene-editing of primary rhesus macaque B cells from peripheral blood mononuclear cells or splenocytes using CRISPR/Cas9. To achieve the targeted integration of large (&#60;4.5 kb) cassettes, a fast and efficient protocol was included for preparing recombinant adeno-associated virus serotype 6 as a homology-directed repair template using a tetracycline-enabled self-silencing adenoviral helper vector. These protocols enable the study of prospective B cell therapeutics in rhesus macaques.

We present a method for culturing and gene editing primary rhesus macaque B cells using CRISPR/Cas9 and recombinant adeno-associated virus serotype 6 for the study of B cell therapies.

B cells and their progeny are the sources of highly expressed antibodies. Their high protein expression capabilities together with their abundance, easy ...

Chemogenetic Regulation in Reprogrammed Stem Cell-derived Precursor Cells in Treating Neurodegenerative Diseases

The integration of designer receptors exclusively activated by designer drugs (DREADD) with stem cell-based therapies presents an advanced strategy for precise neuronal modulation. Here, we utilized CRISPR-engineered human reprogrammed stem cells expressing excitatory (hM3Dq) or inhibitory (hM4Di) DREADD receptors to evaluate the functional integration and modulation of transplanted dopaminergic precursors in a murine model of Parkinson&#39;s disease (PD). Key steps included generating non-fusion DREADD-expressing stem cell lines, differentiating them into midbrain dopaminergic precursors, and transplanting these cells into the striatum of 6-hydroxydopamine (6-OHDA)-lesioned mice. We conducted behavioral assessments and electrophysiological recordings to analyze the effects of the transplanted cells. Behavioral tests, such as the cylinder test, demonstrated significant modulation of motor function following clozapine-N-oxide (CNO) administration. Specifically, activation of hM4Di reduced contralateral forelimb movement, whereas activation of hM3Dq was associated with enhanced motor behavior. Electrophysiological recordings revealed distinct synaptic responses. hM4Di activation increased interevent intervals and decreased peak amplitudes of spontaneous excitatory postsynaptic currents (sEPSCs), whereas hM3Dq activation decreased interevent intervals and increased peak amplitudes, reflecting enhanced excitatory signaling. In summary, the integration of behavioral and electrophysiological assessments validates the precise functional incorporation of engineered chemically reprogrammed stem cells into host neural circuits.

Here, we describe a protocol for engineering chemically reprogrammed stem cells to achieve precise neuronal modulation by differentiating these cells into dopaminergic precursor cells, transplanting them into mouse models of Parkinson's disease, and evaluating behavioral and electrophysiological outcomes to confirm the successful integration and functional effectiveness of the transplanted cells.

The integration of designer receptors exclusively activated by designer drugs (DREADD) with stem cell-based therapies presents an advanced strategy for ...

Neuroscience

CRISPR/Cas9 Gene Editing of Hematopoietic Stem and Progenitor Cells for Gene Therapy Applications

CRISPR/Cas9 is a highly versatile and efficient gene-editing tool adopted widely to correct various genetic mutations. The feasibility of gene manipulation of hematopoietic stem and progenitor cells (HSPCs) in vitro makes HSPCs an ideal target cell for gene therapy. However, HSPCs moderately lose their engraftment and multilineage repopulation potential in ex vivo culture. In the present study, ideal culture conditions are described that improves HSPC engraftment and generate an increased number of gene-modified cells in vivo. The current report displays optimized in vitro culture conditions, including the type of culture media, unique small molecule cocktail supplementation, cytokine concentration, cell culture plates, and culture density. In addition to that, an optimized HSPC gene-editing procedure, along with the validation of the gene-editing events, are provided. For in vivo validation, the gene-edited HSPCs infusion and post-engraftment analysis in mouse recipients are displayed. The results demonstrated that the culture system increased the frequency of functional HSCs in vitro, resulting in robust engraftment of gene-edited cells in vivo.

The present protocol describes an optimized hematopoietic stem and progenitor cell (HSPC) culture procedure for the robust engraftment of gene-edited cells in vivo.

Preparation and Gene Modification of Nonhuman Primate Hematopoietic Stem and Progenitor Cells

Samenvatting

Meer video's verkennen

Hoofdstukken in deze video