The authors thank Helen Crawford for preparing this manuscript, Jim Woolace for graphic design, and Veronica Nelson and Devikha Chandrasekaran for participating in the development of the protocol. The development of this protocol was supported by grants from the NIH National Institute of Allergy and Infectious Diseases (R01 AI135953 and AI138329 to H.P.K.) and the National Heart, Lung, and Blood Institute (R01 HL136135, HL116217, P01 HL122173, and U19 HL129902 to H.P.K.), as well as NIH P51 OD010425 and, in part through the NIH/NCI Cancer Center, Support Grant P30 CA015704. H.P.K. is a Markey Molecular Medicine Investigator and received support as the inaugural recipient of the Jos&#233; Carreras/E. Donnall Thomas Endowed Chair for Cancer Research and the Fred Hutch Endowed Chair for Cell and Gene Therapy.

The authors have nothing to disclose.

LV vector engineering is the best-characterized method to gene-modify cell types such as CD34+ HSPCs, for subsequent transplantation in vivo. The protocol described here is designed to maximize the number of gene-modified HSPCs that persist long-term in vivo, and provide clinical benefits to patients with various malignant, infectious, and genetic diseases. Although gene-editing strategies have emerged over the last decade, LV-modified cells are the best studied in vitro, in animal models, and in patients<sup ...

Stem cell gene therapy is a powerful means to address a wide range of human pathologies. HSPC gene therapy is a particularly attractive approach, due to i) the relative ease of collecting these cells from patients, ii) the wealth of knowledge that is available regarding cell surface phenotypes and ex vivo culture parameters, and, as the field expands, because iii) it presents scientists with an ever-increasing toolbox of gene modification strategies tailored to various diseases of interest. We are actively investigating HSPC gene therapy approaches from multiple angles, including the basic science of HSPC biology, the engraftment of gene-modified HSPCs in preclinical in vivo models, and the application to relevant patient populations. We and others have characterized the cell surface phenotype of functionally distinct HSPC subsets1,2,3, the mobilization and conditioning regimens that maximize HSPC yield and engraftment while minimizing toxicity4,5, and the gene modification and gene-editing strategies that have been tailored to a wide range of malignant, genetic, and infectious diseases6,7,8,9,10. The function and engraftment of gene-modified HSPCs can be evaluated in a number of small- and large-animal models, including mice, dogs, and NHPs. In particular, NHP models are advantageous because many reagents, for example, antibodies specific for HSPC cell surface proteins like CD34 and CD90, can be used interchangeably in human and NHP cells. Furthermore, in contrast to mice, large animals such as NHPs allow a closer approximation of the scale of gene modification necessary for clinical efficacy. Finally, NHPs are the gold standard for the modeling of human pathologies such as HIV-1 infection11 and are an emerging model system for candidate anticancer and anti-HIV immunotherapies12,13.
The purpose of this protocol is to outline methods for purifying, genetically modifying, and preparing NHP HSPC infusion products. Although outside the scope of this protocol, we have previously shown that these products engraft in autologous NHP hosts, give rise to all hematopoietic lineages, and provide therapeutic efficacy in a broad range of disease models1. We have also characterized the clonality of engrafting HSPCs and built a platform to track the kinetics, trafficking, and phenotype of individual HSPCs and their progeny, following autologous transplantation1,14. The methods presented here have been developed with the following goals: i) to isolate highly pure HSPCs and long-term engrafting HSC subsets, ii) to maintain primitive HSCs during ex vivo culture, and iii) to efficiently gene-modify either bulk HSPCs or long-term engrafting HSC subsets. We employ magnetic-assisted cell-sorting (MACS), as well as fluorescence-activated cell sorting (FACS), to isolate phenotypically/functionally distinct HSPC populations, consistent with the methods of many groups2,15,16. The maintenance of primitive HSCs in culture (i.e., minimizing the differentiation of these cells into committed progenitors that give rise to fully differentiated lymphoid and myeloid subsets) is an essential facet of the protocol described here. Although we have previously characterized approaches to expand HSPCs while retaining a primitive phenotype17,18, here, we describe a protocol that focuses on maintaining HSCs via a minimal (48 h) and defined ex vivo culture.
The efficient modification of HSPCs and HSC subsets is a central goal of this protocol. Among several approaches we have reported, two are by far the most investigated in clinical trials: LV-mediated gene modification and nuclease-mediated gene editing1,6,19.&#160;Gene-editing strategies use one of a number of nuclease platforms to specifically modify a targeted gene of interest, for example, C-C chemokine receptor type 5 (CCR5) for the treatment of HIV infection7,19 or Bcl11A for the treatment of hemoglobinopathies6. Here, we focus on LV-mediated gene modification, in which transgenic cargoes integrate semirandomly into the genome1,8,20. A key advantage of LV approaches is the ability to deliver large amounts of genetic material (up to 8 or 9 kilobases). Although gene-editing strategies are being developed to target a transgene of interest to integrate only at a specified locus by homologous donor recombination (HDR), these methods require further development in vitro and in small animal models. In contrast, LV vectors have been used extensively in NHPs and in patients21,22. Importantly, the protocol described here, which uses primed BM as a starting HSPC source, can be easily and broadly adapted, for example, to isolate PBSCs. As described above, we take advantage of the high degree of genetic similarity between NHPs and humans to use reagents that are applicable to both species. Finally, this approach has been adapted to modify other hematopoietic subsets, namely T cells12,23,24; the advent of efficacious T-cell immunotherapy approaches has relied heavily on the same LV platform utilized in this protocol. These methods are appropriate for any researcher interested in either HSPC biology or LV-mediated gene modification. For example, the HSPC purification protocol presented here could be used to characterize novel HSC-enriched subsets, as described previously1,15,25. Likewise, the LV transduction methods presented here could similarly be applied and further developed for numerous other cell types and experimental questions, both in in vitro and in vivo models.
In summary, we present methods to isolate and genetically modify NHP HSPCs. These methods can be easily adapted for other species and other sources of HSPCs. This thoroughly vetted protocol shows great promise in the modeling of efficacious therapies for numerous human diseases.

<table>
	<tbody>
		<tr>
			<td>Stemspam SFEM II (&#34;HSPC&#34;) Media</td>
			<td>StemCell</td>
			<td>09655</td>
			<td></td>
		</tr>
		<tr>
			<td>Hank&#39;s Balanced Salt Solution</td>
			<td>Gibco</td>
			<td>14175095</td>
			<td></td>
		</tr>
		<tr>
			<td>Phosphate-Buffered Saline</td>
			<td>Gibco</td>
			<td>14190-144</td>
			<td></td>
		</tr>
		<tr>
			<td>Penicillin/Streptomycin</td>
			<td>Gibco</td>
			<td>15140-122</td>
			<td></td>
		</tr>
		<tr>
			<td>Dimethyl Sulfoxide</td>
			<td>Sigma Aldrich</td>
			<td>D2650-100</td>
			<td></td>
		</tr>
		<tr>
			<td>100% Ethanol</td>
			<td>Decon labs</td>
			<td>M18027161M</td>
			<td></td>
		</tr>
		<tr>
			<td>Cyclosporine</td>
			<td>Sigma</td>
			<td>30024-25MG</td>
			<td></td>
		</tr>
		<tr>
			<td>500 mM EDTA</td>
			<td>Invitrogen</td>
			<td>15575-038</td>
			<td></td>
		</tr>
		<tr>
			<td>Heat-Inactivated Fetal Bovine Serum</td>
			<td>Sigma Aldrich</td>
			<td>PS-0500-A</td>
			<td></td>
		</tr>
		<tr>
			<td>CH-296/ RetroNectin (2.5 mL, 1 &#181;g/&#181;L)</td>
			<td>TaKaRA</td>
			<td>T100B</td>
			<td></td>
		</tr>
		<tr>
			<td>Bovine Serum Albumin</td>
			<td>Sigma</td>
			<td>A7906-100g</td>
			<td></td>
		</tr>
		<tr>
			<td>HEPES</td>
			<td>Sigma</td>
			<td>H9897</td>
			<td></td>
		</tr>
		<tr>
			<td>Rat anti-mouse IgM magnetic beads</td>
			<td>Miltenyi Biotec</td>
			<td>130-047-301</td>
			<td></td>
		</tr>
		<tr>
			<td>Recombinant HumanStem Cell Factor (SCF)</td>
			<td>Peprotech</td>
			<td>300-07</td>
			<td></td>
		</tr>
		<tr>
			<td>Recombinant Human Thrombopoietin (TPO)</td>
			<td>Peprotech</td>
			<td>300-18</td>
			<td></td>
		</tr>
		<tr>
			<td>Recombinant Human FMS-like tyrosine kinase 3 (FLT-3)</td>
			<td>Peprotech</td>
			<td>300-19</td>
			<td></td>
		</tr>
		<tr>
			<td>Protamine sulfate</td>
			<td>Sigma</td>
			<td>P-4505</td>
			<td></td>
		</tr>
		<tr>
			<td>14 mL Polypropylene Round-Bottom Tube</td>
			<td>Corning</td>
			<td>352059</td>
			<td></td>
		</tr>
		<tr>
			<td>Colony Gel 1402</td>
			<td>ReachBio</td>
			<td>1402</td>
			<td></td>
		</tr>
		<tr>
			<td>QuadroMACS Separators</td>
			<td>Miltenyi Biotec</td>
			<td>130-090-976</td>
			<td></td>
		</tr>
		<tr>
			<td>MACS L25 Columns</td>
			<td>Miltenyi biotec</td>
			<td>130-042-401</td>
			<td></td>
		</tr>
		<tr>
			<td>10 mM PGE2</td>
			<td>Cayman Chemical</td>
			<td>14753-5mg</td>
			<td></td>
		</tr>
		<tr>
			<td>TC-treated T-75 flasks</td>
			<td>Bioexpress</td>
			<td>T-3001-2</td>
			<td></td>
		</tr>
		<tr>
			<td>Non-TC-treated T-75 flasks</td>
			<td>Thermo-Fisher</td>
			<td>13680-57</td>
			<td></td>
		</tr>
		<tr>
			<td>20 ml syringes</td>
			<td>BD Biosciences</td>
			<td>302830</td>
			<td></td>
		</tr>
		<tr>
			<td>16.5 G needles</td>
			<td>BD Precision</td>
			<td>305198</td>
			<td></td>
		</tr>
		<tr>
			<td>Syringe Tip Cap</td>
			<td>BD Biosciences</td>
			<td>305819</td>
			<td></td>
		</tr>
		<tr>
			<td>QuickExtract DNA Solution</td>
			<td>Epicentre</td>
			<td>QE09050</td>
			<td></td>
		</tr>
		<tr>
			<td>8-tube strip cap PCR Tubes</td>
			<td>USA scientific</td>
			<td>1402-2708</td>
			<td></td>
		</tr>
		<tr>
			<td>96-well Thermocycler</td>
			<td>Thermo-Fisher</td>
			<td>4375786</td>
			<td></td>
		</tr>
		<tr>
			<td>Pre-Separation filters</td>
			<td>Miltenyi Biotec</td>
			<td>130-041-407</td>
			<td></td>
		</tr>
		<tr>
			<td>Strainer, Cell; BD Falcon; Sterile; Nylon mesh; Mesh size: 70um; Color: white; 50/CS</td>
			<td>fisher scientific</td>
			<td>352350</td>
			<td></td>
		</tr>
		<tr>
			<td>Ultracomp ebeads</td>
			<td>eBioscience</td>
			<td>01-2222-42</td>
			<td></td>
		</tr>
		<tr>
			<td>MACSmix Tube Rotator</td>
			<td>Miltenyi</td>
			<td>130-090-753</td>
			<td></td>
		</tr>
		<tr>
			<td>3 mL Luer-Lock Syringes</td>
			<td>Thermo-Fisher</td>
			<td>14823435</td>
			<td></td>
		</tr>
		<tr>
			<td>35 mm x 10 mm cell culture dish</td>
			<td>Corning</td>
			<td>430165</td>
			<td></td>
		</tr>
		<tr>
			<td>60 mm x 15 mm cell culture dish</td>
			<td>Corning</td>
			<td>430196</td>
			<td></td>
		</tr>
		<tr>
			<td>150 mm x 25 mm cell culture dish</td>
			<td>Corning</td>
			<td>430599</td>
			<td></td>
		</tr>
		<tr>
			<td>Non TC treated flasks</td>
			<td>Falcon</td>
			<td>353133</td>
			<td></td>
		</tr>
		<tr>
			<td>Qiagen DNA extraction</td>
			<td>Qiagen</td>
			<td>51104</td>
			<td></td>
		</tr>
		<tr>
			<td>PE Anti-Human CD90 (Thy1) Clone:5E10</td>
			<td>Biolegend</td>
			<td>328110</td>
			<td></td>
		</tr>
		<tr>
			<td>PE-CF594 Mouse Anti-Human CD34 Clone:563</td>
			<td>BD horizon</td>
			<td>562449</td>
			<td></td>
		</tr>
		<tr>
			<td>APC-H7 Mouse Anti-Human CD45RA Clone: 5H9</td>
			<td>BD Pharmingen</td>
			<td>561212</td>
			<td></td>
		</tr>
		<tr>
			<td>V450 Mouse Anti-NHP CD45 Clone:d058-1283</td>
			<td>BD Biosciences</td>
			<td>561291</td>
			<td></td>
		</tr>
		<tr>
			<td>Autologous Serum</td>
			<td>Collected from autologous host and cryopreserved prior to mobilization and collection of CD34+ HSPCs</td>
			<td>N/A</td>
			<td>Beard, B. C. et al. Efficient and stable MGMT-mediated selection of long-term repopulating stem cells in nonhuman primates. Journal of Clinical Investigation. 120 (7), 2345-2354, (2010).</td>
		</tr>
		<tr>
			<td>Virus-Conditioned Media (VCM)</td>
			<td>Kiem Lab, FHCRC Co-operative Center for Excellence in Hematology (CCEH)</td>
			<td>N/A</td>
			<td>Beard, B. C. et al. Efficient and stable MGMT-mediated selection of long-term repopulating stem cells in nonhuman primates. Journal of Clinical Investigation. 120 (7), 2345-2354, (2010).</td>
		</tr>
		<tr>
			<td>Anti-CD34 antibody, Clone 12.8</td>
			<td>Kiem Lab</td>
			<td>N/A</td>
			<td>Beard, B. C. et al. Efficient and stable MGMT-mediated selection of long-term repopulating stem cells in nonhuman primates. Journal of Clinical Investigation. 120 (7), 2345-2354, (2010).</td>
		</tr>
		<tr>
			<td>Lenti F primer: AGAGATGGGTGCGAGAGCGTCA</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td>Peterson, C. W. et al. Multilineage polyclonal engraftment of Cal-1 gene-modified cells and in vivo selection after SHIV infection in a nonhuman primate model of AIDS. Mol Ther Methods Clin Dev. 3 16007, (2016).</td>
		</tr>
		<tr>
			<td>Lenti R primer: TGCCTTGGTGGGTGCTACTCCTAA</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td>Peterson, C. W. et al. Multilineage polyclonal engraftment of Cal-1 gene-modified cells and in vivo selection after SHIV infection in a nonhuman primate model of AIDS. Mol Ther Methods Clin Dev. 3 16007, (2016).</td>
		</tr>
		<tr>
			<td>Actin F primer: TCCTGTGGCACTCACGAAACT</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td>Peterson, C. W. et al. Multilineage polyclonal engraftment of Cal-1 gene-modified cells and in vivo selection after SHIV infection in a nonhuman primate model of AIDS. Mol Ther Methods Clin Dev. 3 16007, (2016).</td>
		</tr>
		<tr>
			<td>Actin R primer: GAAGCATTTGCGGTGGACGAT</td>
			<td>Integrated DNA Technologies</td>
			<td>N/A</td>
			<td>Peterson, C. W. et al. Multilineage polyclonal engraftment of Cal-1 gene-modified cells and in vivo selection after SHIV infection in a nonhuman primate model of AIDS. Mol Ther Methods Clin Dev. 3 16007, (2016).</td>
		</tr>
	</tbody>
</table>

preparation and gene modification of nonhuman primate hematopoietic stem and progenitor cells

Hematopoietic stem and progenitor cell (HSPC) transplantation has been a cornerstone therapy for leukemia and other cancers for nearly half a century, underlies the only known cure of human immunodeficiency virus (HIV-1) infection, and shows immense promise in the treatment of genetic diseases such as beta thalassemia. Our group has developed a protocol to model HSPC gene therapy in nonhuman primates (NHPs), allowing scientists to optimize many of the same reagents and techniques that are applied in the clinic. Here, we describe methods for purifying CD34+ HSPCs and long-term persisting hematopoietic stem cell (HSC) subsets from primed bone marrow (BM). Identical techniques can be employed for the purification of other HSPC sources (e.g., mobilized peripheral blood stem cells [PBSCs]). Outlined is a 2 day protocol in which cells are purified, cultured, modified with lentivirus (LV), and prepared for infusion back into the autologous host. Key readouts of success include the purity of the CD34+ HSPC population, the ability of purified HSPCs to form morphologically distinct colonies in semisolid media, and, most importantly, gene modification efficiency. The key advantage to HSPC gene therapy is the ability to provide a source of long-lived cells that give rise to all hematopoietic cell types. As such, these methods have been used to model therapies for cancer, genetic diseases, and infectious diseases. In each case, therapeutic efficacy is established by enhancing the function of distinct HSPC progeny, including red blood cells, T cells, B cells, and/or myeloid subsets. The methods to isolate, modify, and prepare HSPC products are directly applicable and translatable to multiple diseases in human patients.

The protocol described above is designed to isolate and gene-modify NHP CD34+ HSPCs, which can subsequently be infused back into the autologous host (Figure 1 and Figure 2). When following this protocol, we usually obtain up to 8 x 109 total WBCs from primed BM from pigtail macaques and, sometimes, double that amount from rhesus macaques. In both species, the number of CD34+ HSPCs that we enrich i...

Watch this Scientific Journal Video about Preparation and Gene Modification of Nonhuman Primate Hematopoietic Stem and Progenitor Cells at JoVE.com

Preparation and Gene Modification of Nonhuman Primate Hematopoietic Stem and Progenitor Cells

Preparazione e modificazione genetica di staminali ematopoietiche Nonhuman Primate e cellule progenitrici

The goal of this protocol is to isolate nonhuman primate CD34+ cells from primed bone marrow, to gene-modify these cells with lentiviral vectors, and to prepare a product for infusion into the autologous host. The total protocol length is approximately 48 h.

Hematopoietic stem and progenitor cell (HSPC) transplantation has been a cornerstone therapy for leukemia and other cancers for nearly half a century, ...

preparation-gene-modification-nonhuman-primate-hematopoietic-stem

Research

JoVE Journal

Genetics

7.5K Views.  Fred Hutchinson Cancer Research Center. Per valutare l'efficienza e la sicurezza di approcci di terapia genica promettenti e nuovi, è fondamentale il test completo delle cellule geneticamente modificate in modelli preclinici in vivo convalidati. La conservazione della reattività incrociata dei reagenti dei marcatori di superficie cellulare pertinenti e la capacità di applicare gli stessi trattamenti di supporto somministrati ai pazienti lungo modelli di primati non umani per imitare strettamente i parametri clinici. A dimostrare...

Video: Preparation and Gene Modification of Nonhuman Primate Hematopoietic Stem and Progenitor Cells

Selection-dependent and Independent Generation of CRISPR/Cas9-mediated Gene Knockouts in Mammalian Cells

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide RNA (sgRNA) that confers specificity, the Cas9 protein cleaves both DNA strands at the targeted locus. The DNA break can trigger either non-homologous end joining (NHEJ) or homology directed repair (HDR). NHEJ can introduce small deletions or insertions which lead to frame-shift mutations, while HDR allows for larger and more precise perturbations. Here, we present protocols for generating knockout cell lines by coupling established CRISPR/Cas9 methods with two options for downstream selection/screening. The NHEJ approach uses a single sgRNA cut site and selection-independent screening, where protein production is assessed by dot immunoblot in a high-throughput manner. The HDR approach uses two sgRNA cut sites that span the gene of interest. Together with a provided HDR template, this method can achieve deletion of tens of kb, aided by the inserted selectable resistance marker. The appropriate applications and advantages of each method are discussed.

Recent advances in the ability to genetically manipulate somatic cell lines hold great potential for basic and applied research. Here, we present two approaches for CRISPR/Cas9 generated knockout production and screening in mammalian cell lines, with and without the use of selectable markers.

Selezione-dipendente e generazione indipendente di CRISPR / Cas9-mediata Gene Knockouts nelle cellule di mammiferi

The CRISPR/Cas9 genome engineering system has revolutionized biology by allowing for precise genome editing with little effort. Guided by a single guide ...

Ricerca

Genetica

Sample Preparation and Analysis of RNASeq-based Gene Expression Data from Zebrafish

The analysis of global gene expression changes is a valuable tool for identifying novel pathways underlying observed phenotypes. The zebrafish is an excellent model for rapid assessment of whole transcriptome from whole animal or individual cell populations due to the ease of isolation of RNA from large numbers of animals. Here a protocol for global gene expression analysis in zebrafish embryos using RNA sequencing (RNASeq) is presented. We describe preparation of RNA from whole embryos or from cell populations obtained using cell sorting in transgenic animals. We also describe an approach for analysis of RNASeq data to identify enriched pathways and Gene Ontology (GO) terms in global gene expression data sets. Finally, we provide a protocol for validation of gene expression changes using quantitative reverse transcriptase PCR (qRT-PCR). These protocols can be used for comparative analysis of control and experimental sets of zebrafish to identify novel gene expression changes, and provide molecular insight into phenotypes of interest.

This protocol presents an approach for whole transcriptome analysis from zebrafish embryos, larvae, or sorted cells. We include isolation of RNA, pathway analysis of RNASeq data, and qRT-PCR-based validation of gene expression changes.

Preparazione dei campioni e analisi dei dati di espressione genica basati su RNASeq dallo Zebrafish

The analysis of global gene expression changes is a valuable tool for identifying novel pathways underlying observed phenotypes. The zebrafish is an ...

A Standard Methodology to Examine On-site Mutagenicity As a Function of Point Mutation Repair Catalyzed by CRISPR/Cas9 and SsODN in Human Cells

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point mutations, which often are responsible for a variety of human inherited disorders. Using a well-established cell-based model system, the point mutation of a single-copy mutant eGFP gene integrated into HCT116 cells has been repaired using this combinatorial approach. The analysis of corrected and uncorrected cells reveals both the precision of gene editing and the development of genetic lesions, when indels are created in uncorrected cells in the DNA sequence surrounding the target site. Here, the specific methodology used to analyze this combinatorial approach to the gene editing of a point mutation, coupled with a detailed experimental strategy to measuring indel formation at the target site, is outlined. This protocol outlines a foundational approach and workflow for investigations aimed at developing CRISPR/Cas9-based gene editing for human therapy. The conclusion of this work is that on-site mutagenesis takes place as a result of CRISPR/Cas9 activity during the process of point mutation repair. This work puts in place a standardized methodology to identify the degree of mutagenesis, which should be an important and critical aspect of any approach destined for clinical implementation.

This protocol outlines the workflow of a CRISPR/Cas9-based gene editing system for the repair of point mutations in mammalian cells. Here, we use a combinatorial approach to gene editing with a detailed follow-on experimental strategy for measuring indel formation at the target site&#8212;in essence, analyzing onsite mutagenesis.

Una metodologia Standard per esaminare in loco mutagenicità in funzione della mutazione di punto riparazione catalizzata da CRISPR/Cas9 e SsODN in cellule umane

Combinatorial gene editing using CRISPR/Cas9 and single-stranded oligonucleotides is an effective strategy for the correction of single-base point ...

Immunostaining for DNA Modifications: Computational Analysis of Confocal Images

For several decades, 5-methylcytosine (5mC) has been thought to be the only DNA modification with a functional significance in metazoans. The discovery of enzymatic oxidation of 5mC to 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC) as well as detection of N6-methyladenine (6mA) in the DNA of multicellular organisms provided additional degrees of complexity to the epigenetic research. According to a growing body of experimental evidence, these novel DNA modifications may play specific roles in different cellular and developmental processes. Importantly, as some of these marks (e. g. 5hmC, 5fC and 5caC) exhibit tissue- and developmental stage-specific occurrence in vertebrates, immunochemistry represents an important tool allowing assessment of spatial distribution of DNA modifications in different biological contexts. Here the methods for computational analysis of DNA modifications visualized by immunostaining followed by confocal microscopy are described. Specifically, the generation of 2.5 dimension (2.5D) signal intensity plots, signal intensity profiles, quantification of staining intensity in multiple cells and determination of signal colocalization coefficients are shown. Collectively, these techniques may be operational in evaluating the levels and localization of these DNA modifications in the nucleus, contributing to elucidating their biological roles in metazoans.

Newly discovered oxidized forms of 5-methylcytosine (oxi-mCs), 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC) and 5-carboxylcytosine (5caC) may represent distinct DNA modifications with unique functional roles. Here a semi-quantitative workflow for visualization of oxi-mCs' spatial distribution, signal intensity profiling and colocalization is described.

Immunostaining per modificazioni del DNA: analisi computazionale delle immagini Confocal

For several decades, 5-methylcytosine (5mC) has been thought to be the only DNA modification with a functional significance in metazoans. The discovery of ...

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in which the gene of interest has been disrupted. A gene-disruption DNA construct containing a suitable antibiotic resistance marker gene is useful for the generation of gene-disrupted strains in bacteria. However, conventional construction methods, which require gene cloning steps, involve complex and time-consuming protocols. Here, a relatively facile, rapid, and cost-effective method for targeted gene disruption in Streptococcus mutans is described. The method utilizes a 2-step fusion polymerase chain reaction (PCR) to generate the disruption construct and electroporation for genetic transformation. This method does not require an enzymatic reaction, other than PCR, and additionally offers greater flexibility in terms of the design of the disruption construct. Employment of electroporation facilitates the preparation of competent cells and improves the transformation efficiency. The present method may be adapted for the generation of gene-disrupted strains of various species.

Generation of a Gene-disrupted Streptococcus mutans Strain Without Gene Cloning

We describe a facile, rapid, and relatively inexpensive method for the generation of gene-disrupted Streptococcus mutans strains; this technique may be adapted for the generation of gene-disrupted strains of various species.

Generazione di un Gene-interrotto lo streptococco mutans Strain senza clonaggio genico

Typical methods for the elucidation of the function of a particular gene involve comparative phenotypic analyses of the wild-type strain and a strain in ...

Production and Purification of Baculovirus for Gene Therapy Application

Baculovirus has traditionally been used for the production of recombinant protein and vaccine. However, more recently, baculovirus is emerging as a promising vector for gene therapy application. Here, baculovirus is produced by transient transfection of the baculovirus plasmid DNA (bacmid) in an adherent culture of Sf9 cells. Baculovirus is subsequently expanded in Sf9 cells in a serum-free suspension culture until the desired volume is obtained. It is then purified from the culture supernatant using heparin affinity chromatography. Virus supernatant is loaded onto the heparin column which binds baculovirus particles in the supernatant due to the affinity of heparin for baculovirus envelop glycoprotein. The column is washed with a buffer to remove contaminants and baculovirus is eluted from the column with a high-salt buffer. The eluate is diluted to an isotonic salt concentration and baculovirus particles are further concentrated using ultracentrifugation. Using this method, baculovirus can be concentrated up to 500-fold with a 25% recovery of infectious particles. Although the protocol described here demonstrates the production and purification of the baculovirus from cultures up to 1 L, the method can be scaled-up in a closed-system suspension culture to produce a clinical-grade vector for gene therapy application.

In this protocol, baculovirus is produced by transient transfection of baculovirus plasmid into Sf9 cells and amplified in a serum-free suspension culture. The supernatant is purified by heparin affinity chromatography and further concentrated by ultracentrifugation. This protocol is useful for the production and purification of baculovirus for gene therapy application.

Produzione e purificazione di Baculovirus per applicazione di terapia genica

Baculovirus has traditionally been used for the production of recombinant protein and vaccine. However, more recently, baculovirus is emerging as a ...

Highly Efficient Gene Disruption of Murine and Human Hematopoietic Progenitor Cells by CRISPR/Cas9

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. Complete gene ablation in HSCs required the generation of knockout mice from which HSCs could be isolated, and gene ablation in primary human HSCs was not possible. Viral transduction could be used for knock-down approaches, but these suffered from variable efficacy. In general, genetic manipulation of human and mouse hematopoietic cells was hampered by low efficiencies and extensive time and cost commitments. Recently, CRISPR/Cas9 has dramatically expanded the ability to engineer the DNA of mammalian cells. However, the application of CRISPR/Cas9 to hematopoietic cells has been challenging, mainly due to their low transfection efficiencies, the toxicity of plasmid-based approaches and the slow turnaround time of virus-based protocols.
A rapid method to perform CRISPR/Cas9-mediated gene editing in murine and human hematopoietic stem and progenitor cells with knockout efficiencies of up to 90% is provided in this article. This approach utilizes a ribonucleoprotein (RNP) delivery strategy with a streamlined three-day workflow. The use of Cas9-sgRNA RNP allows for a hit-and-run approach, introducing no exogenous DNA sequences in the genome of edited cells and reducing off-target effects. The RNP-based method is fast and straightforward: it does not require cloning of sgRNAs, virus preparation or specific sgRNA chemical modification. With this protocol, scientists should be able to successfully generate knockouts of a gene of interest in primary hematopoietic cells within a week, including downtimes for oligonucleotide synthesis. This approach will allow a much broader group of users to adapt this protocol for their needs.

A protocol for fast CRISPR/Cas9-mediated gene disruption in mouse and human primary hematopoietic cells is described in this article. Cas9-sgRNA ribonucleoproteins are introduced via electroporation with sgRNAs generated through in vitro transcription and commercial Cas9. High editing efficiencies are achieved with limited time and financial cost.

Rottura del Gene altamente efficiente di cellule progenitrici ematopoietiche Murine ed umane di CRISPR/Cas9

Advances in the hematopoietic stem cell (HSCs) field have been aided by methods to genetically engineer primary progenitor cells as well as animal models. ...

A Fast and Quantitative Method for Post-translational Modification and Variant Enabled Mapping of Peptides to Genomes

Cross-talk between genes, transcripts, and proteins is the key to cellular responses; hence, analysis of molecular levels as distinct entities is slowly being extended to integrative studies to enhance the understanding of molecular dynamics within cells. Current tools for the visualization and integration of proteomics with other omics datasets are inadequate for large-scale studies. Furthermore, they only capture basic sequence identify, discarding post-translational modifications and quantitation. To address these issues, we developed PoGo to map peptides with associated post-translational modifications and quantification to reference genome annotation. In addition, the tool was developed to enable the mapping of peptides identified from customized sequence databases incorporating single amino acid variants. While PoGo is a command line tool, the graphical interface PoGoGUI enables non-bioinformatics researchers to easily map peptides to 25 species supported by Ensembl genome annotation. The generated output borrows file formats from the genomics field and, therefore, visualization is supported in most genome browsers. For large-scale studies, PoGo is supported by TrackHubGenerator to create web-accessible repositories of data mapped to genomes that also enable an easy sharing of proteogenomics data. With little effort, this tool can map millions of peptides to reference genomes within only a few minutes, outperforming other available sequence-identity based tools. This protocol demonstrates the best approaches for proteogenomics mapping through PoGo with publicly available datasets of quantitative and phosphoproteomics, as well as large-scale studies.

Here we present the proteogenomic tool PoGo and protocols for fast, quantitative, post-translational modification and variant enabled mapping of peptides identified through mass spectrometry onto reference genomes. This tool is of use to integrate and visualize proteogenomic and personal proteomic studies interfacing with orthogonal genomics data.

Un metodo veloce e quantitativo per la modificazione post-traduzionale e variante attivato Mapping dei peptidi di genomi

Cross-talk between genes, transcripts, and proteins is the key to cellular responses; hence, analysis of molecular levels as distinct entities is slowly ...

A Combinatorial Single-cell Approach to Characterize the Molecular and Immunophenotypic Heterogeneity of Human Stem and Progenitor Populations

Immunophenotypic characterization and molecular analysis have long been used to delineate heterogeneity and define distinct cell populations. FACS is inherently a single-cell assay, however prior to molecular analysis, the target cells are often prospectively isolated in bulk, thereby losing single-cell resolution. Single-cell gene expression analysis provides a means to understand molecular differences between individual cells in heterogeneous cell populations. In bulk cell analysis an overrepresentation of a distinct cell type results in biases and occlusions of signals from rare cells with biological importance. By utilizing FACS index sorting coupled to single-cell gene expression analysis, populations can be investigated without the loss of single-cell resolution while cells with intermediate cell surface marker expression are also captured, enabling evaluation of the relevance of continuous surface marker expression. Here, we describe an approach that combines single-cell reverse transcription quantitative PCR (RT-qPCR) and FACS index sorting to simultaneously characterize the molecular and immunophenotypic heterogeneity within cell populations.
In contrast to single-cell RNA sequencing methods, the use of qPCR with specific target amplification allows for robust measurements of low-abundance transcripts with fewer dropouts, while it is not confounded by issues related to cell-to-cell variations in read depth. Moreover, by directly index-sorting single-cells into lysis buffer this method, allows for cDNA synthesis and specific target pre-amplification to be performed in one step as well as for correlation of subsequently derived molecular signatures with cell surface marker expression. The described approach has been developed to investigate hematopoietic single-cells, but have also been used successfully on other cell types.
In conclusion, the approach described herein allows for sensitive measurement of mRNA expression for a panel of pre-selected genes with the possibility to develop protocols for subsequent prospective isolation of molecularly distinct subpopulations.

Bulk gene expression measurements cloud individual cell differences in heterogeneous cell populations. Here, we describe a protocol for how single-cell gene expression analysis and index sorting by Florescence Activated Cell Sorting (FACS) can be combined to delineate heterogeneity and immunophenotypically characterize molecularly distinct cell populations.

Una combinatoria unicellulare approccio per la caratterizzazione molecolare e Immunophenotypic eterogeneità del tronco umano e popolazioni di cellule progenitrici

Immunophenotypic characterization and molecular analysis have long been used to delineate heterogeneity and define distinct cell populations. FACS is ...

Isolation, Characterization and MicroRNA-based Genetic Modification of Human Dental Follicle Stem Cells

To date, several stem cell types at different developmental stages are in the focus for the treatment of degenerative diseases. Yet, certain aspects, such as initial massive cell death and low therapeutic effects, impaired their broad clinical translation. Genetic engineering of stem cells prior to transplantation emerged as a promising method to optimize therapeutic stem cell effects. However, safe and efficient gene delivery systems are still lacking. Therefore, the development of suitable methods may provide an approach to resolve current challenges in stem cell-based therapies.
The present protocol describes the extraction and characterization of human dental follicle stem cells (hDFSCs) as well as their non-viral genetic modification. The postnatal dental follicle unveiled as a promising and easily accessible source for harvesting adult multipotent stem cells possessing high proliferation potential. The described isolation procedure presents a simple and reliable method to harvest hDFSCs from impacted wisdom teeth. Also this protocol comprises methods to define stem cell characteristics of isolated cells. For genetic engineering of hDFSCs, an optimized cationic lipid-based transfection strategy is presented enabling highly efficient microRNA introduction without causing cytotoxic effects. MicroRNAs are suitable candidates for transient cell manipulation, as these small translational regulators control the fate and behavior of stem cells without the hazard of stable genome integration. Thus, this protocol represents a safe and efficient procedure for engineering of hDFSCs that may become important for optimizing their therapeutic efficacy.

This protocol describes the transient genetic engineering of dental stem cells extracted from the human dental follicle. The applied non-viral modification strategy may become a basis for the improvement of therapeutic stem cell products.

Isolamento, caratterizzazione e MicroRNA-basato di modificazione genetica di cellule staminali del follicolo dentale umano

To date, several stem cell types at different developmental stages are in the focus for the treatment of degenerative diseases. Yet, certain aspects, such ...