Thanks to Jane Reid for initiating this programme, Barbara Terlouw for development, Vahid Aslanzadeh for the &#8220;ura looper&#8221; constructs and Susana de Lucas for many helpful discussions. This work was supported by a scholarship to GIMO from the Consejo Nacional de Ciencia y Tecnolog&#237;a, Mexico (CONACYT) and the University of Edinburgh School of Biological Sciences, a Wellcome PhD studentship to IEM [105256] and by Wellcome funding [104648] to JD Beggs. Work in the Wellcome Centre for Cell Biology is supported by Wellcome core funding [092076].

NOTE: See Figure 2 for a graphical summary.
1. Strain Preparation
<ol>
	<li>Using a&#160;ura3-strain, introduce the &#946;-est AID system (i.e., genes encoding the &#946;-estradiol responsive transcription factor (ATF) and the osTIR) and AID* tag the target protein (see Figure 3 and Table 1 for a summary of the procedure).
	<ol>
		<li>Transform15 either pZTRK (G418 resistance marker) or pZTRL (LEU2&#160;marker) plasmid (available from the Yeast Genetic Resource Centre) into the ura3- yeast strain or use the plasmid as a template to produce the PCR product for genomic integration.</li>
		<li>PCR amplify the ATF (marked Z4EVATF on the plasmid map) and osTIR using a high fidelity polymerase from either of the plasmids pZTRK or pZTRL. Use primers with 50 to 60 base 3&#8217; extensions with homology to the genomic region, to direct integration by homologous recombination16. For genomic integration of the two components either separately or together, see Table 1 for primers and conditions. 
		NOTE: The strain pZ4EV-NTR1 has the components already integrated in the genome (available from the Yeast Genetic Resource Centre, Japan).</li>
		<li>Ensure that the target protein is AID* tagged using the Longtine procedure17 (see Figure 3b and Table 1).</li>
		<li>Perform a growth analysis on the strain without &#946;-estradiol and IAA present to determine if the AID* tag affects growth and to predict growth rate for use at step 1.5.</li>
	</ol>
	</li>
</ol>
2. General Procedure for Depletion
<ol>
	<li>Calculate how much culture is required for all samples to be collected; for example, 10 mL of culture at OD600 of 0.8 is sufficient for protein, RNA and DNA extraction for a single sample, so for 6 samples, at least 60 mL of culture is needed.</li>
	<li>From an overnight culture, set up sufficient new culture at OD600 0.1 to 0.2 and leave to grow at 30 &#176;C. A rich medium such as YPDA is recommended, although other growth conditions can be used:
	<table>
		<tbody>
			<tr>
				<td>Yeast Extract</td>
				<td>10 g</td>
			</tr>
			<tr>
				<td>Peptone</td>
				<td>20 g</td>
			</tr>
			<tr>
				<td>Glucose</td>
				<td>20 g</td>
			</tr>
			<tr>
				<td>Adenine sulphate</td>
				<td>40 mg</td>
			</tr>
			<tr>
				<td>H2O to</td>
				<td>1 L</td>
			</tr>
		</tbody>
	</table>
	 
	NOTE: Autoclave or filter sterilize; filter sterilization is preferred as peptide/sugar complexes produced by autoclaving precipitate in the methanol used in sample collection.</li>
	<li>Prepare to receive the samples.
	<ol>
		<li>Put 30 to 50% of the intended sample volume of methanol into a tube. For example, if a 10 mL sample is to be taken, put 5 mL of methanol into a 15 mL falcon tube and close the tube tightly. Once closed, label the tube and put on dry ice or at -80 &#176;C to chill. 
		CAUTION: Dispense the methanol in a fume hood.</li>
		<li>Label 1.5 mL tubes for long term storage of the samples and place in ice to cool.</li>
		<li>Cool enough H2O (at least 1 mL per sample) on ice.</li>
	</ol>
	</li>
	<li>Anticipate the culture&#8217;s growth. The target OD for collecting the samples is approximately 0.7 to 0.8, but the pre-incubation step (the incubation with &#946;-estradiol to induce the osTIR), needs to be started earlier so that the culture will reach approximately the right OD by the time the samples are collected. 
	NOTE: It is advisable to perform a growth curve in the conditions to be used in the experiment so that this starting OD can be estimated.</li>
	<li>Once the target OD for the start of the pre-incubation has been reached, take a sample (usually 10 mL), into the pre-prepared tube containing cold methanol. Invert briefly to mix and place back in dry ice. 
	NOTE: The sample can be moved to water ice after about 5 min, if convenient to do so.</li>
	<li>Immediately add the &#946;-estradiol, 1 &#181;L/mL of culture (final concentration of 10 &#181;M); have the &#946;-estradiol pre-measured in a pipette ready for use in order to reduce the time taken between collecting the sample and adding the &#946;-estradiol. Rapidly mix by swirling vigorously.</li>
	<li>Continue to grow the culture as before (step 2.2), incubate (this is the &#8220;pre-incubation&#8221; step) with &#946;-estradiol for the optimal time (for determination of the optimal pre-incubation time see Figure 1).</li>
	<li>Prepare to add IAA (auxin). Take up the volume of IAA needed for step 2.10 (i.e., 0.5 &#181;L of IAA per mL of culture). This makes step 2.20 faster.</li>
	<li>Collect a sample as step 2.5.</li>
	<li>Immediately add IAA 0.5 &#181;L/mL of culture to a final concentration of 750 &#181;M as prepared in step 2.8. Rapidly mix by swirling vigorously.</li>
	<li>Collect samples, as step 2.5, according to your experimental design. Either a single sample, at a time when it is expected that the protein will be reliably depleted, or multiple samples in a time course of depletion. For example, 5 min intervals are convenient for timing and provide a range of protein levels. The optimization strategy, as shown in Figure 1, will give an indication of suitable times.</li>
	<li>Process the samples.
	<ol>
		<li>Place the samples on ice, if not done already. Ensure that none of the samples has frozen; if they have, gently warm in the hand, inverting constantly so the temperature does not rise locally. 
		NOTE: This is best done in the hand as the sample&#8217;s temperature can be assessed, it should always feel cold. Place on ice. This is not a pause point - once all the samples are fluid, proceed to the next step.</li>
		<li>Once all samples have been collected and are no longer frozen, spin at 3,500 x g for 2 min (at 4 &#176;C if possible).</li>
		<li>Pour off the methanol/medium mix and place back on ice; do not worry if not all the liquid has been removed.</li>
		<li>Resuspend the cell pellet in 1 mL of ice cold H2O (from step 2.3.3) and transfer to a labelled 1.5 mL tube (prepared in step 2.3.2) on ice.</li>
		<li>Spin briefly (e.g., 10 s total time) at &#62;15,000 x g to re-pellet the cells, place back on ice and remove the liquid.</li>
		<li>Remove the H2O by aspiration. The cell pellets can be stored at -20 &#176;C, or -80 &#176;C for long term storage.</li>
	</ol>
	</li>
	<li>Check the level to which the protein has been depleted by Western blot analysis18. 
	NOTE: Sufficient protein19 and/or nucleic acid can be extracted from a single cell pellet for most purposes, although rare RNA species might require more sample volume.</li>
</ol>

<ol>
	<li>Haruki, H., Nishikawa, J., Laemmli, U. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Anchor-Away+Technique:+Rapid,+Conditional+Establishment+of+Yeast+Mutant+Phenotypes.">The Anchor-Away Technique: Rapid, Conditional Establishment of Yeast Mutant Phenotypes.</a> Molecular Cell. 31, 925-932 (2008).</li><li>Bell&#237;, G., Gar&#237;, E., Piedrafita, L., Aldea, M., Herrero, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+activator/repressor+dual+system+allows+tight+tetracycline-regulated+gene+expression+in+budding+yeast.">An activator/repressor dual system allows tight tetracycline-regulated gene expression in budding yeast.</a> Nucleic Acids Research. 26, 942-947 (1998).</li><li>Alexander, R. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RiboSys,+a+high-resolution,+quantitative+approach+to+measure+the+in+vivo+kinetics+of+pre-mRNA+splicing+and+3&#8242;-end+processing+in+Saccharomyces+cerevisiae.">RiboSys, a high-resolution, quantitative approach to measure the in vivo kinetics of pre-mRNA splicing and 3&#8242;-end processing in Saccharomyces cerevisiae.</a> RNA. 16, 2570-2580 (2010).</li><li>Deshaies, R. J., Joazeiro, C. A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RING+Domain+E3+Ubiquitin+Ligases.">RING Domain E3 Ubiquitin Ligases.</a> Annual Review of Biochemistry. 78, 399-434 (2009).</li><li>Tan, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanism+of+auxin+perception+by+the+TIR1+ubiquitin+ligase.">Mechanism of auxin perception by the TIR1 ubiquitin ligase.</a> Nature. 446, 640-645 (2007).</li><li>Teale, W. D., Paponov, I. A., Palme, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Auxin+in+action:+signalling,+transport+and+the+control+of+plant+growth+and+development.">Auxin in action: signalling, transport and the control of plant growth and development.</a> Nature Reviews Molecular Cell Biology. 7, 847-859 (2006).</li><li>Nishimura, K., Fukagawa, T., Takisawa, H., Kakimoto, T., Kanemaki, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+auxin-based+degron+system+for+the+rapid+depletion+of+proteins+in+nonplant+cells.">An auxin-based degron system for the rapid depletion of proteins in nonplant cells.</a> Nature Methods. 6, 917-922 (2009).</li><li>Morawska, M., Ulrich, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+expanded+tool+kit+for+the+auxin-inducible+degron+system+in+budding+yeast.">An expanded tool kit for the auxin-inducible degron system in budding yeast.</a> Yeast. 30, 341-351 (2013).</li><li>Kubota, T., Nishimura, K., Kanemaki, M. T., Donaldson, A. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Elg1+Replication+Factor+C-like+Complex+Functions+in+PCNA+Unloading+during+DNA+Replication.">The Elg1 Replication Factor C-like Complex Functions in PCNA Unloading during DNA Replication.</a> Molecular Cell. 50, 273-280 (2013).</li><li>Brosh, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+dual+molecular+analogue+tuner+for+dissecting+protein+function+in+mammalian+cells.">A dual molecular analogue tuner for dissecting protein function in mammalian cells.</a> Nature Communications. 7, 11742 (2016).</li><li>DeRisi, J. L., Iyer, V. R., Brown, P. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+the+metabolic+and+genetic+control+of+gene+expression+on+a+genomic+scale.">Exploring the metabolic and genetic control of gene expression on a genomic scale.</a> Science. 278, 680-686 (1997).</li><li>Mendoza-Ochoa, G. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+fast+and+tuneable+auxin-inducible+degron+for+depletion+of+target+proteins+in+budding.">A fast and tuneable auxin-inducible degron for depletion of target proteins in budding.</a> Yeast. , (2018).</li><li>McIsaac, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+gene+expression+perturbation+systems+with+rapid,+tunable,+single-gene+specificity+in+yeast.">Synthetic gene expression perturbation systems with rapid, tunable, single-gene specificity in yeast.</a> Nucleic Acids Res. 41, e57 (2013).</li><li>Prusty, R., Grisafi, P., Fink, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+plant+hormone+indoleacetic+acid+induces+invasive+growth+in+Saccharomyces+cerevisiae.">The plant hormone indoleacetic acid induces invasive growth in Saccharomyces cerevisiae.</a> PNAS. 101, 4153-4157 (2004).</li><li>Geitz, D., St Jean, A., Woods, R. A., Schiest, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+method+for+high+efficiency+transformation+of+intact+yeast+cells.">Improved method for high efficiency transformation of intact yeast cells.</a> Nucleic Acids Research. 20, 1425 (1992).</li><li>Widlund, P. O., Davis, T. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+high-efficiency+method+to+replace+essential+genes+with+mutant+alleles+in+yeast.">A high-efficiency method to replace essential genes with mutant alleles in yeast.</a> Yeast. 22, 769-774 (2005).</li><li>Longtine, M. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Additional+modules+for+versatile+and+economical+PCR-based+gene+deletion+and+modification+in+Saccharomyces+cerevisiae.">Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae.</a> Yeast. 14, 953-961 (1998).</li><li>Eaton, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Guide+to+Modern+Quantitative+Fluorescent+Western+Blotting+with+Troubleshooting+Strategies.">A Guide to Modern Quantitative Fluorescent Western Blotting with Troubleshooting Strategies.</a> Journal of Visualized Experiments. , e52099 (2014).</li><li>Volland, C., Urban-Grimal, D., G&#233;raud, G., Haguenauer-Tsapis, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endocytosis+and+degradation+of+the+yeast+uracil+permease+under+adverse+conditions.">Endocytosis and degradation of the yeast uracil permease under adverse conditions.</a> Journal of Biological Chemistry. 269, 9833-9841 (1994).</li><li>Barrass, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptome-wide+RNA+processing+kinetics+revealed+using+extremely+short+4tU+labeling.">Transcriptome-wide RNA processing kinetics revealed using extremely short 4tU labeling.</a> Genome Biology. 16, 282 (2015).</li></ol>

The authors have nothing to disclose.

A well optimized protocol can produce rapid and efficient depletion of the target protein. Determining the approximate pre-incubation time with &#946;-estradiol is important, as this increases reproducibility of the depletion, but small variations in pre-incubation time can be tolerated. On the other hand, care must be taken with timing after auxin addition, as the protein level declines very rapidly.
An advantage of this approach is that tuned depletion can be achieved by varying combinations of pre-incubation time with &#946;-estradiol and IAA incubation time. For example, if desired, the target protein can be more slowly depleted by reducing the pre-incubation time.
The &#946;-est AID system offers certain advantages over systems where OsTIR is constitutively expressed. For example, if the target protein is essential for viability, regulated expression of osTIR can avoid premature depletion of the target protein. Moreover, expression of osTIR can be tuned to suit the abundance of the target protein and its susceptibility to degradation, and the depletion can be either fast or slow. The two small molecule effectors, &#946;-estradiol and auxin, do not perturb the yeast metabolism under the conditions used here, unlike rapamycin, used in the anchor-away system1.
It should be noted that tagging some proteins disrupts their function, which is a problem with any targeted depletion system. In this case, an N-terminal tag may work when a C-terminal tag does not. Also, not all proteins will be depleted efficiently; for example, the AID-tag on the target protein may be inaccessible to the osTIR protein. Therefore, after AID-tagging, each target protein should be tested for any effect of the tag on growth, and to determine whether depletion is effective, before the timings of &#946;-estradiol pre-incubation and auxin treatment are optimized.
This AID* system is very simple and is compatible with any subsequent experimental procedure that does not involve further growth, such as protein, DNA or RNA analysis or microscopy. In addition, the system works well when combined with thiolabelling to purify nascent RNA20.
This system provides a rapid, specific, and reproducible means of depleting a protein without otherwise affecting the metabolism of the yeast cell.

Conditional mutations, such as temperature-sensitive mutants, are a powerful tool for the study of essential proteins, allowing cell growth under the permissive condition but causing loss of function under non-permissive conditions. However, cell metabolism can be seriously perturbed by the change in growth conditions required to induce the defect and may also create off-target effects. Several methods have been developed, in which the protein of interest is conditionally sequestered1 or its expression is controlled2,3 by addition of a small molecule. This protocol uses auxin and the auxin-inducible degron (AID) system to efficiently deplete a target protein.
The AID system has its origin in plants, where an auxin (in this protocol indole-3-acetic acid (IAA) is used), stimulates interaction of the Aux/IAA protein with TIR1, a member of the SCF U3 ubiquitin ligase complex4. SCF complex interaction causes polyubiquitination of Aux/IAA family proteins, which results in their degradation by the proteasome5,6.
This system was previously adapted for use in the yeast Saccharomyces cerevisiae7,8 by expressing the TIR1 protein from Oriza sativa (osTIR) in yeast cells, where it is able to interact with the endogenous yeast SCF complex. The protein of interest was tagged with a motif from the Aux/IAA protein IAA17 to target it for degradation. Functional truncations of IAA17 were developed later, such as AID*8,9,10, containing the 43 amino acid auxin-sensitive motif from Arabidopsis thaliana IAA17, along with an epitope tag to enable detection.
The system initially adapted for use in budding yeast7,8 expressed the osTIR1 protein from a yeast GAL promoter. Expression requires shifting to growth medium with galactose as the sole carbon source, which, unfortunately, results in a diauxic shift with wide-ranging changes to cell metabolism11. On the other hand, it has been reported that constitutive expression of TIR1 can lead to degradation of the target protein in the absence of auxin/IAA12 if the expression level is high, whereas low TIR1 expression causes inefficient depletion. An improved AID system named &#946;-est AID was developed in which the osTIR is under the control of an inducible promoter that is tunable to suit the target protein, with minimal effect on cell metabolism. To achieve this, an artificial transcription factor (ATF) was constructed in which the VP16 viral transcription activator is fused to an oestrogen receptor and a four Zn fingers DNA binding domain (DBD). When &#946;-estradiol (an oestrogen) is present, the ATF can enter the nucleus and induce osTIR transcription by binding to its promoter (Z4EVpr)13,12.
osTIR expression is usually detectable about 20 min after addition of &#946;-estradiol12. However, the optimal duration of osTIR expression to achieve efficient depletion of the tagged protein with auxin, while avoiding depletion before auxin addition, needs to be empirically determined for each target protein. An approximate time for this pre-incubation can be estimated from abundance values in the Saccharomyces Genome Database (SGD https://www.yeastgenome.org/). As can be seen in Figure 1, the abundant protein, Dcp1 (2880 to 4189 molecules/cell), requires 40 min of pre-incubation with &#946;-estradiol, with no auxin-independent depletion observed. The much less abundant protein, Prp2 (172 to 211 molecules/cell), is strongly depleted after only 20 min of pre-incubation. It is advisable to test two additional pre-incubation times, 10 to 20 min before or after this initial estimated time (20 min is the minimum time that is recommended). The optimum pre-incubation time is the time at which target protein has not depleted before adding auxin and once auxin is added the depletion is acceptable or protein levels approach the minimum possible. So, from Figure 1b, for Prp22 with 30 min of pre-incubation, the levels have not declined much 10 min after auxin addition. Comparing this with 40 min of pre-incubation and 15 min with IAA, where there is little additional depletion, there is no benefit in incubating with auxin longer than 10 min or pre-incubating for longer than 30 min, particularly as there is evidence of non-auxin dependent depletion at 40 min. For Dcp1 with 40 min of pre-incubation (the last point at which the protein level is approximately 100% before auxin addition), 15 to 20 min of depletion with auxin is acceptable. It is recommended to keep the depletion time as short as possible to reduce secondary effects on cell metabolism14.
This article demonstrates how to use the &#946;-est AID system by optimizing the timing of &#946;-estradiol incubation for osTIR expression to achieve rapid target protein depletion upon IAA addition without depletion before adding auxin.

<table><tbody><tr><td>Adenine sulphate</td><td>Formedium</td><td>DOC0230</td><td></td></tr><tr><td>Agar</td><td>Formedium</td><td>AGA03</td><td></td></tr><tr><td>&amp;Beta;-estradiol</td><td>Sigma Aldrich</td><td>E2758-1G</td><td>10 mM solution in ethanol. Store at -20 &amp;deg;C</td></tr><tr><td>DMSO</td><td>Alfa Aesar</td><td>42780</td><td>DMSO should be solid at 4 &amp;deg;C</td></tr><tr><td>Glucose</td><td>Fisher Scientific</td><td>G/0500/60</td><td></td></tr><tr><td>IAA 1H-Indole-3-acetic acid</td><td>Across Orgainics</td><td>122150100</td><td>Auxin analogue. 1.5 M in DMSO. The solution will be a russet colour and darken as time goes on; a deep red solution should be discarded and a new one made. Store at -20 &amp;deg;C.</td></tr><tr><td>Methanol</td><td>Fisher Scientific</td><td>M/4000/PC17</td><td>CAUTION Toxic and flammable</td></tr><tr><td>Phusion&amp;nbsp;High-Fidelity DNA Polymerase</td><td>NEB</td><td>M0530</td><td></td></tr><tr><td>Peptone</td><td>Formedium</td><td>PEP03</td><td></td></tr><tr><td>SCSM single drop-out &amp;ndash;ura</td><td>Formedium</td><td>DSCS101</td><td></td></tr><tr><td>Yeast Extract</td><td>Formedium</td><td>YEA03</td><td></td></tr><tr><td>Yeast nitrogen base without amino acids with amonium sulphate</td><td>Formedium</td><td>CYN0410</td><td></td></tr></tbody></table>

tuning degradation to achieve specific and efficient protein depletion

The plant auxin binding receptor, TIR1, recognizes proteins containing a specific auxin-inducible degron (AID) motif in the presence of auxin, targeting them for degradation. This system is exploited in many non-plant eukaryotes, such that a target protein, tagged with the AID motif, is degraded upon auxin addition. The level of TIR1 expression is critical; excessive expression leads to degradation of the AID-tagged protein even in the absence of auxin, whereas low expression leads to slow depletion. A &#946;-estradiol-inducible AID system was created, with expression of TIR1 under the control of a &#946;-estradiol inducible promoter. The level of TIR1 is tunable by changing the time of incubation with &#946;-estradiol before auxin addition. This protocol describes how to rapidly deplete a target protein using the AID system. The appropriate &#946;-estradiol incubation time depends on the abundance of the target protein. Therefore, efficient depletion depends on optimal timing that also minimizes auxin-independent depletion.

Representative examples of depletion are displayed in Figure 1. The three experiments presented in this figure were optimization experiments for depletion of the proteins Prp2, Prp22 and Dcp1. The low abundance, spliceosomal Prp2 and Prp22 proteins both depleted to less than 20% after 40 min pre-incubation with &#946;-estradiol followed by 15 min with auxin.&#160;Longer pre-incubation times lead to faster depletion but also show undesirable protein depletion before auxin addition. In comparison, the more abundant Dcp1 was only depleted to approximately 30% with the same treatment, but 60 min of pre-incubation resulted in depletion to 13% with the same auxin treatment, at the cost of depletion before the auxin is added. It is possible that 50 min of pre-incubation with &#946;-estradiol and 15 min with auxin would have achieved similar results at a shorter time point and so would have been more optimal.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/59874/59874fig01.jpg" /> 
Figure 1: Depletion rate can be tuned by modulating the duration of &#946;-estradiol pre-incubation.&#160;Western blot18 of target proteins: (a and b) Prp22-AID*-6FLAG, (c and d) Prp2-AID*-6FLAG, and (e and f) Dcp1-AID*-6HA, from cultures pre-incubated with &#946;-estradiol (&#946;-est) for 20, 30, 40, or 60 min prior to auxin addition12. Equal amounts of total protein were loaded in each lane. Pgk1 is detected as a visual loading control, except for panel e, where Pgk1 and Dcp1 co-migrate. Quantification of protein bands in panels a, c and e are shown in panels b, d, and f, respectively. As a measure of depletion rate, the slope (m) was calculated for the linear section (from 100% to 30% of initial values) of each curve. The optimal pre-incubation time is the time at which the protein levels are still close to the un-induced levels (100%) and the subsequent rate of depletion is fast. For Dcp1 (f), 60 min of pre-incubation is too long, as the protein has begun to degrade in the absence of auxin, whereas 20 min is too short, as the protein does not appreciably deplete in this time course. After 40 min pre-incubation, 15 min with auxin can be used as the protein is approximately 70% depleted and, although 20 min would result in further depletion, it could also result in secondary effects. Error bars represent standard deviation of two biological replicates. For each experiment, one representative blot is shown. This figure is derived from previous publication9. <a href="https://www.jove.com/files/ftp_upload/59874/59874fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/59874/59874fig02v2.jpg" /> 
Figure 2: Graphical summary.&#160;Add &#946;-estradiol to sufficient culture growing in rich medium and at the required temperature in order to start pre-incubation. Continue growth for the required pre-incubation time before adding IAA (auxin) to start depletion. The pre-incubation and depletion times depend on the protein to be depleted, but pre-incubation is often in the range of 20-60 min and the depletion time is typically in the order of 10 to 20 min. 10 mL samples should be taken at the start and end of pre-incubation and during the depletion. These samples are rapidly fixed in cold methanol before pelleting and storage. <a href="https://www.jove.com/files/ftp_upload/59874/59874fig02v2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/59874/59874fig03.jpg" /> 
Figure 3: Strain generation for the B-est system.&#160;(a) To generate a yeast strain with the AID* system, either the pZTRL (LEU2) or the pZTRK (kanamycin (G418) resistance), plasmid should be introduced into the strain or, alternatively, the ATF and osTIR can be inserted into the genome by homologous recombination of a fragment generated by PCR from 3&#8217;end primers (see Figure 3b and Table 1). (b) C-terminal tagging of the target protein is achieved by PCR amplification of the appropriate region of the plasmid pURA3-AID*-6FLAG (pURA3_AID*-6HA differs only in the tag and can be treated in exactly the same way), using Longtine primers S3-F and S2-R with 3&#8217; extensions homologous to the 3&#8217; end of the target protein. The forward primer extension should include the last amino acid codon in frame with the start of the AID* tag and must not include the stop codon. The reverse primer extension should be to a region downstream of the coding region. Once inserted into the genome, cells that have lost the URA3 marker (by homologous recombination between the identical regions found at both ends of the marker) can be selected by growth with 5-FOA, that counter-selects URA3 cells. <a href="https://www.jove.com/files/ftp_upload/59874/59874fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="8">a. Primer Sequences</td>
		</tr>
		<tr>
			<td>Target</td>
			<td>Location</td>
			<td>Primer</td>
			<td>Name</td>
			<td colspan="3">Sequence</td>
			<td>Tm (&#176;C)</td>
		</tr>
		<tr>
			<td rowspan="2">pZTRL</td>
			<td>516</td>
			<td>F</td>
			<td>pZTRL_F</td>
			<td colspan="3">&#60;-region of homology-&#62;GCGACAGCATCACCGACTTCG</td>
			<td>61.23</td>
		</tr>
		<tr>
			<td>7897</td>
			<td>R</td>
			<td>pZTR_R</td>
			<td colspan="3">CGCCGCCTCTACCTTGCAGA&#60;-region of homology (RC)-&#62;</td>
			<td>61.30</td>
		</tr>
		<tr>
			<td rowspan="2">pZTRK</td>
			<td>9154</td>
			<td>F</td>
			<td>pZTRK_F</td>
			<td colspan="3">&#60;-region of homology-&#62;ACGTTGAGCCATTAGTATCAATTTGCTTACC</td>
			<td>59.40</td>
		</tr>
		<tr>
			<td>5897</td>
			<td>R</td>
			<td>pZTR_R</td>
			<td colspan="3">CGCCGCCTCTACCTTGCAGA&#60;-region of homology (RC)-&#62;</td>
			<td>61.30</td>
		</tr>
		<tr>
			<td colspan="2" rowspan="2">pURA3-AID*-6FLAG or pURA3_AID*-6HA</td>
			<td>F</td>
			<td>S3-F</td>
			<td colspan="3">&#60;-region of homology-&#62;CGTACGCTGCAGGTCGAC</td>
			<td>59.21</td>
		</tr>
		<tr>
			<td>R</td>
			<td>S2-R</td>
			<td colspan="3">ATCGATGAATTCGAGCTCG&#60;-region of homology (RC)-&#62;</td>
			<td>52.76</td>
		</tr>
		<tr>
			<td colspan="8">pZRTL/K is to amplify the &#946;-est AID system</td>
		</tr>
		<tr>
			<td colspan="8">pURA3-AID*-6FLAG/6HA to amplify the AID* and epitope tag to tag the target protein (Lontine procedure)</td>
		</tr>
		<tr>
			<td colspan="3">&#60;-region of homology-&#62;</td>
			<td colspan="5">Region homologous to the flanking regions where the system is to be inserted. The longer this region is the more likely the modification is to be successful; 50 - 100 bases is recommended.</td>
		</tr>
		<tr>
			<td colspan="3">&#60;-region of homology (RC)-&#62;</td>
			<td colspan="5">Region homologous to the flanking regions where the system is to be inserted, remember to use the reverse complement. As above, the longer this region is the better.</td>
		</tr>
		<tr>
			<td colspan="3">Tm (&#176;C)</td>
			<td colspan="5">Tm using the %GC method with 50 mM NaCl</td>
		</tr>
		<tr>
			<td colspan="8">b. PCR Mix</td>
		</tr>
		<tr>
			<td colspan="4">Component</td>
			<td colspan="4">Volume (&#181;L)</td>
		</tr>
		<tr>
			<td colspan="4">Template</td>
			<td colspan="4">&#60;10</td>
		</tr>
		<tr>
			<td colspan="4">NEB Phusion HF Buffer (5x)*</td>
			<td colspan="4">100</td>
		</tr>
		<tr>
			<td colspan="4">Forward Primer 100 &#181;M</td>
			<td colspan="4">2.5</td>
		</tr>
		<tr>
			<td colspan="4">Reverse Primer 100 &#181;M</td>
			<td colspan="4">2.5</td>
		</tr>
		<tr>
			<td colspan="4">dNTPs 10 mM each</td>
			<td colspan="4">10</td>
		</tr>
		<tr>
			<td colspan="4">H2O</td>
			<td colspan="4">to 500</td>
		</tr>
		<tr>
			<td colspan="8">* The NEB Phusion GC Buffer (5x) can also be used but is not preferred</td>
		</tr>
		<tr>
			<td colspan="8">Make this mix, split into 10 tubes of 50 &#181;l mix each and perform the PCR as Table 1 c.</td>
		</tr>
		<tr>
			<td colspan="8">Check the PCR has worked by running on an agarose gel</td>
		</tr>
		<tr>
			<td colspan="8">Combine all successful reactions into one tube and ethanol precipitate</td>
		</tr>
		<tr>
			<td colspan="8">Transform the yeast with all the material produced by the PCR</td>
		</tr>
		<tr>
			<td colspan="8">c. PCR Conditions</td>
		</tr>
		<tr>
			<td colspan="6">Step</td>
			<td>Temp (&#176;C)</td>
			<td>Time</td>
		</tr>
		<tr>
			<td colspan="6">Initial Denaturation</td>
			<td>98</td>
			<td>30 s</td>
		</tr>
		<tr>
			<td colspan="3" rowspan="3">25-35 Cycles</td>
			<td colspan="3">Denature</td>
			<td>98</td>
			<td>10 s</td>
		</tr>
		<tr>
			<td colspan="3">Anneal</td>
			<td>45&#8211;60</td>
			<td>20 s</td>
		</tr>
		<tr>
			<td colspan="3">Extension</td>
			<td>72</td>
			<td>30 s/kb</td>
		</tr>
		<tr>
			<td colspan="6">Final Extension</td>
			<td>72</td>
			<td>10 min</td>
		</tr>
		<tr>
			<td colspan="6">Hold</td>
			<td>8</td>
			<td></td>
		</tr>
		<tr>
			<td colspan="8">Anneal at 45 &#176;C for the Lontine primer set (S3-F and S2-R) and 60 &#176;C for the pZTRL/K primers</td>
		</tr>
		<tr>
			<td colspan="8">Extend for 3 minutes for the Lontine PCR and 3 minutes for pZTRL/K</td>
		</tr>
	</tbody>
</table>
Table 1: Primer sequences, PCR mix and PCR conditions.

Watch this Scientific Journal Video about Tuning Degradation to Achieve Specific and Efficient Protein Depletion at JoVE.com

Tuning Degradation to Achieve Specific and Efficient Protein Depletion

Here, we present a protocol to effectively and specifically deplete a protein of interest in the yeast Saccharomyces cerevisiae using the &#946;-est AID system.

The plant auxin binding receptor, TIR1, recognizes proteins containing a specific auxin-inducible degron (AID) motif in the presence of auxin, targeting ...

tuning-degradation-to-achieve-specific-and-efficient-protein-depletion

Research

JoVE Journal

Immunology and Infection

6.2K Views.  University of Edinburgh. Een veel voorkomende techniek om erachter te komen van de functie van een eiwit is om het te verwijderen en te zien wat er gebeurt. Maar dat kun je niet doen met een essentieel eiwit. Het is essentieel, de cel sterft.Dus je hebt een manier nodig om dat eiwit te verwijderen en een glimp op te vangen van wat er gebeurt net voor de celdood. Eiwituitputting moet snel zijn, dus je krijgt geen secundaire effecten. Het moet specifiek zijn, zodat alleen dat eiwit wordt verwijderd en alleen uit...

Video: Tuning Degradation to Achieve Specific and Efficient Protein Depletion

Utilizing a Comprehensive Immunoprecipitation Enrichment System to Identify an Endogenous Post-translational Modification Profile for Target Proteins

It is now well-appreciated that post-translational modifications (PTMs) play an integral role in regulating a protein&#39;s structure and function, which may be essential for a given protein&#39;s role both physiologically and pathologically. Enrichment of PTMs is often necessary when investigating the PTM status of a target protein, because PTMs are often transient and relatively low in abundance. Many pitfalls are encountered when enriching for a PTM of a target protein, such as buffer incompatibility, the target protein antibody is not IP-compatible, loss of PTM signal, and others. The degree of difficulty is magnified when investigating multiple PTMs like acetylation, ubiquitination, SUMOylation 2/3, and tyrosine phosphorylation for a given target protein. Studying a combination of these PTMs may be necessary, as crosstalk between PTMs is prevalent and critical for protein regulation. Often, these PTMs are studied in different lysis buffers and with unique inhibitor compositions. To simplify the process, a unique denaturing lysis system was developed that effectively isolates and preserves these four PTMs; thus, enabling investigation of potential crosstalk in a single lysis system. A unique filter system was engineered to remove contaminating genomic DNA from the lysate, which is a problematic by-product of denaturing buffers. Robust affinity matrices targeting each of the four PTMs were developed in concert with the buffer system to maximize the enrichment and detection of the endogenous states of these four PTMs. This comprehensive PTM detection toolset streamlines the process of obtaining critical information about whether a protein is modified by one or more of these PTMs.

Investigating multiple, endogenous post-translational modifications for a target protein can be extremely challenging. Techniques described here utilize an optimized lysis buffer and filter system developed with specific PTM-targeting, affinity matrices to detect the acetylation, ubiquitination, SUMOylation 2/3, and tyrosine phosphorylation modifications for a target protein using a single, streamlined system.

It is now well-appreciated that post-translational modifications (PTMs) play an integral role in regulating a protein&#39;s structure and function, which ...

Biochemistry

Characterization at the Molecular Level using Robust Biochemical Approaches of a New Kinase Protein

Extensive whole genome sequencing has identified many Open Reading Frames (ORFs) providing many potential proteins. These proteins may have important roles for the cell and may unravel new cellular processes. Among proteins, kinases are major actors as they belong to cell signaling pathways and have the ability to switch on or off many processes crucial to the fate of the cell, such as cell growth, division, differentiation, motility, and death.
In this study, we focused on a new potential kinase protein, LIMK2-1. We demonstrated its existence by Western Blot using a specific antibody. We evaluated its interaction with an upstream regulating protein using coimmunoprecipitation experiments. Coimmunoprecipitation is a very powerful technique able to detect the interaction between two target proteins. It may also be used to detect new partners of a bait protein. The bait protein may be purified either via a tag engineered to its sequence or via an antibody specifically targeting it. These protein complexes may then be separated by SDS-PAGE (Sodium Dodecyl Sulfate PolyAcrylamide Gel) and identified using mass spectrometry. Immunoprecipitated LIMK2-1 was also used to test its kinase activity in vitro by &#947;[32P] ATP labeling. This well-established assay may use many different substrates, and mutated versions of the bait may be used to assess the role of specific residues. The effects of pharmacological agents may also be evaluated since this technique is both highly sensitive and quantitative. Nonetheless, radioactivity handling requires particular caution. Kinase activity may also be assessed with specific antibodies targeting the phospho group of the modified amino acid. These kinds of antibodies are not commercially available for all the phospho modified residues.

We characterized a new kinase protein using robust biochemical approaches: Western Blot analysis with a dedicated specific antibody on different cell lines and tissues, interactions by coimmunoprecipitation experiments, kinase activity detected by Western Blot using a phospho-specific antibody and by &#947;[32P] ATP labeling.

Extensive whole genome sequencing has identified many Open Reading Frames (ORFs) providing many potential proteins. These proteins may have important ...

High-Throughput Cellular Profiling of Targeted Protein Degradation Compounds Using HiBiT CRISPR Cell Lines

Targeted protein degradation compounds, including molecular glues or proteolysis targeting chimeras, are an exciting new therapeutic modality in small molecule drug discovery. This class of compounds induces protein degradation by bringing into proximity the target protein and the E3 ligase machinery proteins required to ubiquitinate and ultimately degrade the target protein through the ubiquitin-proteasomal pathway (UPP). Profiling of target protein degradation in a high-throughput fashion, however, remains highly challenging given the complexity of cellular pathways required to achieve degradation. Here we present a protocol and screening strategy based on the use of CRISPR/Cas9 endogenous tagging of target proteins with the 11 amino acid HiBiT tag which complements with high affinity to the LgBiT protein, to produce a luminescent protein. These CRISPR targeted cell lines with endogenous tags can be used to measure compound induced degradation in either real-time, kinetic live cell or endpoint lytic modes by monitoring luminescent signal using a luminescent plate-based reader. Here we outline the recommended screening protocols for the different formats, and&#160;also describe the calculation of key degradation parameters of rate, Dmax, DC50, Dmax50, as well as multiplexing with cell viability assays. These approaches enable rapid discovery and triaging of early stage compounds while maintaining endogenous expression and regulation of target proteins in relevant cellular backgrounds, allowing for efficient optimization of lead therapeutic compounds.

This protocol describes the quantitative luminescent detection of protein degradation kinetics in living cells that have been engineered using CRISPR/Cas9 to express antibody free endogenous protein detection tag fused to a target protein. Detailed instructions for calculating and obtaining quantitative degradation parameters, rate, Dmax, DC50, and Dmax50 are included.

Targeted protein degradation compounds, including molecular glues or proteolysis targeting chimeras, are an exciting new therapeutic modality in small ...

Cancer Research

Profiling Ubiquitin and Ubiquitin-like Dependent Post-translational Modifications and Identification of Significant Alterations

Ubiquitin (ub) and ubiquitin-like (ubl) dependent post-translational modifications of proteins play fundamental biological regulatory roles within the cell by controlling protein stability, activity, interactions, and intracellular localization. They enable the cell to respond to signals and to adapt to changes in its environment. Alterations within these mechanisms can lead to severe pathological situations such as neurodegenerative diseases and cancers. The aim of the technique described here is to establish ub/ubls dependent PTMs profiles, rapidly and accurately, from cultured cell lines. The comparison of different profiles obtained from different conditions allows the identification of specific alterations, such as those induced by a treatment for example. Lentiviral mediated cell transduction is performed to create stable cell lines expressing a two-tags (6His and Flag) version of the modifier (ubiquitin or a ubl such as SUMO1 or Nedd8). These tags permit the purification of ubiquitin and therefore of ubiquitinated proteins from the cells. This is done through a two-step purification process: The first one is performed in denaturing conditions using the 6His tag, and the second one in native conditions using the Flag tag. This leads to a highly specific and pure isolation of modified proteins which are subsequently identified and semi-quantified by liquid chromatography followed by tandem mass spectrometry (LC-MS/MS) technology. Easy informatics analysis of MS data using Excel software enables the establishment of PTM profiles by eliminating background signals. These profiles are compared between each condition in order to identify specific alterations which will then be studied more specifically, starting with their validation by standard biochemistry techniques.

This protocol aims at establishing ubiquitin (Ub) and ubiquitin-likes (Ubls) specific proteomes in order to identify alterations of these kind of post-translational modifications (PTMs), associated with a specific condition such as a treatment or a phenotype.

Ubiquitin (ub) and ubiquitin-like (ubl) dependent post-translational modifications of proteins play fundamental biological regulatory roles within the ...

An Economical and Versatile High-Throughput Protein Purification System Using a Multi-Column Plate Adapter

Protein purification is imperative to the study of protein structure and function and is usually used in combination with biophysical techniques. It is also a key component in the development of new therapeutics. The evolving era of functional proteomics is fueling the demand for high-throughput protein purification and improved techniques to facilitate this. It was hypothesized that a multi column plate adaptor (MCPA) can interface multiple chromatography columns of different resins with multi-well plates for parallel purification. This method offers an economical and versatile method of protein purification that can be used under gravity or vacuum, rivaling the speed of an automated system. The MCPA can be used to recover milligram yields of protein by an affordable and time efficient method for subsequent characterization and analysis. The MCPA has been used for high-throughput affinity purification of SH3 domains. Ion exchange has also been demonstrated via the MCPA to purify protein post Ni-NTA affinity chromatography, indicating how this system can be adapted to other purification types. Due to its setup with multiple columns, individual customization of parameters can be made in the same purification, unachievable by the current plate-based methods.

A multi-column plate adapter allows chromatography columns to be interfaced with multi-well collection plates for parallel affinity or ion exchange purification providing an economical high throughput protein purification method. It can be used under gravity or vacuum yielding milligram quantities of protein via affordable instrumentation.

Protein purification is imperative to the study of protein structure and function and is usually used in combination with biophysical techniques. It is ...

Pulldown Assay Coupled with Co-Expression in Bacteria Cells as a Time-Efficient Tool for Testing Challenging Protein-Protein Interactions

Pulldown is an easy and widely used protein-protein interaction assay. However, it has limitations in studying protein complexes that do not assemble effectively in vitro. Such complexes may require co-translational assembly and the presence of molecular chaperones; either they form stable oligomers which cannot dissociate and re-associate in vitro or are unstable without a binding partner. To overcome these problems, it is possible to use a method based on the bacterial co-expression of differentially tagged proteins using a set of compatible vectors followed by the conventional pulldown techniques. The workflow is more time-efficient compared to traditional pulldown because it lacks the time-consuming steps of separate purification of interacting proteins and their following incubation. Another advantage is a higher reproducibility due to a significantly smaller number of steps and a shorter period of time in which proteins that exist within the in vitro environment are exposed to proteolysis and oxidation. The method was successfully applied for studying a number of protein-protein interactions when other in vitro techniques were found to be unsuitable. The method can be used for batch testing protein-protein interactions. Representative results are shown for studies of interactions between BTB domain and intrinsically disordered proteins, and of heterodimers of zinc-finger-associated domains.

Here, we describe a method for the bacterial co-expression of differentially tagged proteins using a set of compatible vectors, followed by the conventional pulldown techniques to study protein complexes that cannot assemble in vitro.

Pulldown is an easy and widely used protein-protein interaction assay. However, it has limitations in studying protein complexes that do not assemble ...

A Protocol for the Identification of Protein-protein Interactions Based on 15N Metabolic Labeling, Immunoprecipitation, Quantitative Mass Spectrometry and Affinity Modulation

Protein-protein interactions are fundamental for many biological processes in the cell. Therefore, their characterization plays an important role in current research and a plethora of methods for their investigation is available1. Protein-protein interactions often are highly dynamic and may depend on subcellular localization, post-translational modifications and the local protein environment2. Therefore, they should be investigated in their natural environment, for which co-immunoprecipitation approaches are the method of choice3. Co-precipitated interaction partners are identified either by immunoblotting in a targeted approach, or by mass spectrometry (LC-MS/MS) in an untargeted way. The latter strategy often is adversely affected by a large number of false positive discoveries, mainly derived from the high sensitivity of modern mass spectrometers that confidently detect traces of unspecifically precipitating proteins. A recent approach to overcome this problem is based on the idea that reduced amounts of specific interaction partners will co-precipitate with a given target protein whose cellular concentration is reduced by RNAi, while the amounts of unspecifically precipitating proteins should be unaffected. This approach, termed QUICK for QUantitative Immunoprecipitation Combined with Knockdown4, employs Stable Isotope Labeling of Amino acids in Cell culture (SILAC)5 and MS to quantify the amounts of proteins immunoprecipitated from wild-type and knock-down strains. Proteins found in a 1:1 ratio can be considered as contaminants, those enriched in precipitates from the wild type as specific interaction partners of the target protein. Although innovative, QUICK bears some limitations: first, SILAC is cost-intensive and limited to organisms that ideally are auxotrophic for arginine and/or lysine. Moreover, when heavy arginine is fed, arginine-to-proline interconversion results in additional mass shifts for each proline in a peptide and slightly dilutes heavy with light arginine, which makes quantification more tedious and less accurate5,6. Second, QUICK requires that antibodies are titrated such that they do not become saturated with target protein in extracts from knock-down mutants.
Here we introduce a modified QUICK protocol which overcomes the abovementioned limitations of QUICK by replacing SILAC for 15N metabolic labeling and by replacing RNAi-mediated knock-down for affinity modulation of protein-protein interactions. We demonstrate the applicability of this protocol using the unicellular green alga Chlamydomonas reinhardtii as model organism and the chloroplast HSP70B chaperone as target protein7 (Figure 1). HSP70s are known to interact with specific co-chaperones and substrates only in the ADP state8. We exploit this property as a means to verify the specific interaction of HSP70B with its nucleotide exchange factor CGE19.

A Protocol for the Identification of Protein-protein Interactions Based on 15N Metabolic Labeling, Immunoprecipitation, Quantitative Mass Spectrometry and Affinity Modulation

We present a variation of the QUICK (QUantitative Immunoprecipitation Combined with Knockdown) approach that was introduced previously to distinguish between true and false protein-protein interactions. Our approach is based on 15N metabolic labeling, the modulation of affinities of protein-protein interactions by the presence/absence of ATP, immunoprecipitation, and quantitative mass spectrometry.

Protein-protein interactions are fundamental for many biological processes in the cell. Therefore, their characterization plays an important role in ...

Biology

Reporter-based Growth Assay for Systematic Analysis of Protein Degradation

Protein degradation by the ubiquitin-proteasome system (UPS) is a major regulatory mechanism for protein homeostasis in all eukaryotes. The standard approach to determining intracellular protein degradation relies on biochemical assays for following the kinetics of protein decline. Such methods are often laborious and time consuming and therefore not amenable to experiments aimed at assessing multiple substrates and degradation conditions. As an alternative, cell growth-based assays have been developed, that are, in their conventional format, end-point assays that cannot quantitatively determine relative changes in protein levels.
Here we describe a method that faithfully determines changes in protein degradation rates by coupling them to yeast cell-growth kinetics. The method is based on an established selection system where uracil auxotrophy of URA3-deleted yeast cells is rescued by an exogenously expressed reporter protein, comprised of a fusion between the essential URA3 gene and a degradation determinant (degron). The reporter protein is designed so that its synthesis rate is constant whilst its degradation rate is determined by the degron. As cell growth in uracil-deficient medium is proportional to the relative levels of Ura3, growth kinetics are entirely dependent on the reporter protein degradation.
This method accurately measures changes in intracellular protein degradation kinetics. It was applied to: (a) Assessing the relative contribution of known ubiquitin-conjugating factors to proteolysis (b) E2 conjugating enzyme structure-function analyses (c) Identification and characterization of novel degrons. Application of the degron-URA3-based system transcends the protein degradation field, as it can also be adapted to monitoring changes of protein levels associated with functions of other cellular pathways.

Here we describe a robust biological assay for quantifying the relative rate of proteolysis by the ubiquitin-proteasome system. The assay readout is yeast growth rate in liquid culture, which is dependent on the cellular levels of a reporter protein comprising a degradation signal fused to an essential metabolic marker.

Protein degradation by the ubiquitin-proteasome system (UPS) is a major regulatory mechanism for protein homeostasis in all eukaryotes. The standard ...

Cell-Type Specific Protein Purification and Identification from Complex Tissues Using a Mutant Methionine tRNA Synthetase Mouse Line

Understanding protein homeostasis in vivo is key to knowing how the cells work in both physiological and disease conditions. The present protocol describes in vivo labeling and subsequent purification of newly synthesized proteins using an engineered mouse line to direct protein labeling to specific cellular populations. It is an inducible line by Cre recombinase expression of L274G-Methionine tRNA synthetase (MetRS*), enabling azidonorleucine (ANL) incorporation to the proteins, which otherwise will not occur. Using the method described here, it is possible to purify cell-type-specific proteomes labeled in vivo and detect subtle changes in protein content due to sample complexity reduction.

This protocol describes how to perform cell-type-specific protein labeling with azidonorleucine (ANL) using a mouse line expressing a mutant L274G-Methionine tRNA synthetase (MetRS*) and the necessary steps for labeled cell-type-specific proteins isolation. We outline two possible ANL administration routes in live mice by (1) drinking water and (2) intraperitoneal injections.

Understanding protein homeostasis in vivo is key to knowing how the cells work in both physiological and disease conditions. The present protocol ...

Neuroscience

Cycloheximide Chase Analysis of Protein Degradation in Saccharomyces cerevisiae

Regulation of protein abundance is crucial to virtually every cellular process. Protein abundance reflects the integration of the rates of protein synthesis and protein degradation. Many assays reporting on protein abundance (e.g., single-time point western blotting, flow cytometry, fluorescence microscopy, or growth-based reporter assays) do not allow discrimination of the relative effects of translation and proteolysis on protein levels. This article describes the use of cycloheximide chase followed by western blotting to specifically analyze protein degradation in the model unicellular eukaryote, Saccharomyces cerevisiae (budding yeast). In this procedure, yeast cells are incubated in the presence of the translational inhibitor cycloheximide. Aliquots of cells are collected immediately after and at specific time points following addition of cycloheximide. Cells are lysed, and the lysates are separated by polyacrylamide gel electrophoresis for western blot analysis of protein abundance at each time point. The cycloheximide chase procedure permits visualization of the degradation kinetics of the steady state population of a variety of cellular proteins. The procedure may be used to investigate the genetic requirements for and environmental influences on protein degradation.

Cycloheximide Chase Analysis of Protein Degradation in Saccharomyces cerevisiae

Protein abundance reflects the rates of both protein synthesis and protein degradation. This article describes the use of cycloheximide chase followed by western blotting to analyze protein degradation in the model unicellular eukaryote, Saccharomyces cerevisiae (budding yeast).

Tuning Degradation to Achieve Specific and Efficient Protein Depletion

Samenvatting

Meer video's verkennen