Thanks to Jane Reid for initiating this programme, Barbara Terlouw for development, Vahid Aslanzadeh for the &#8220;ura looper&#8221; constructs and Susana de Lucas for many helpful discussions. This work was supported by a scholarship to GIMO from the Consejo Nacional de Ciencia y Tecnolog&#237;a, Mexico (CONACYT) and the University of Edinburgh School of Biological Sciences, a Wellcome PhD studentship to IEM [105256] and by Wellcome funding [104648] to JD Beggs. Work in the Wellcome Centre for Cell Biology is supported by Wellcome core funding [092076].

NOTE: See Figure 2 for a graphical summary.
1. Strain Preparation
<ol>
	<li>Using a&#160;ura3-strain, introduce the &#946;-est AID system (i.e., genes encoding the &#946;-estradiol responsive transcription factor (ATF) and the osTIR) and AID* tag the target protein (see Figure 3 and Table 1 for a summary of the procedure).
	<ol>
		<li>Transform15 either pZTRK (G418 resistance marker) or pZTRL (LEU2&#160;marker) plasmid (available from the Yeast Genetic Resource Centre) into the ura3- yeast strain or use the plasmid as a template to produce the PCR product for genomic integration.</li>
		<li>PCR amplify the ATF (marked Z4EVATF on the plasmid map) and osTIR using a high fidelity polymerase from either of the plasmids pZTRK or pZTRL. Use primers with 50 to 60 base 3&#8217; extensions with homology to the genomic region, to direct integration by homologous recombination16. For genomic integration of the two components either separately or together, see Table 1 for primers and conditions. 
		NOTE: The strain pZ4EV-NTR1 has the components already integrated in the genome (available from the Yeast Genetic Resource Centre, Japan).</li>
		<li>Ensure that the target protein is AID* tagged using the Longtine procedure17 (see Figure 3b and Table 1).</li>
		<li>Perform a growth analysis on the strain without &#946;-estradiol and IAA present to determine if the AID* tag affects growth and to predict growth rate for use at step 1.5.</li>
	</ol>
	</li>
</ol>
2. General Procedure for Depletion
<ol>
	<li>Calculate how much culture is required for all samples to be collected; for example, 10 mL of culture at OD600 of 0.8 is sufficient for protein, RNA and DNA extraction for a single sample, so for 6 samples, at least 60 mL of culture is needed.</li>
	<li>From an overnight culture, set up sufficient new culture at OD600 0.1 to 0.2 and leave to grow at 30 &#176;C. A rich medium such as YPDA is recommended, although other growth conditions can be used:
	<table>
		<tbody>
			<tr>
				<td>Yeast Extract</td>
				<td>10 g</td>
			</tr>
			<tr>
				<td>Peptone</td>
				<td>20 g</td>
			</tr>
			<tr>
				<td>Glucose</td>
				<td>20 g</td>
			</tr>
			<tr>
				<td>Adenine sulphate</td>
				<td>40 mg</td>
			</tr>
			<tr>
				<td>H2O to</td>
				<td>1 L</td>
			</tr>
		</tbody>
	</table>
	 
	NOTE: Autoclave or filter sterilize; filter sterilization is preferred as peptide/sugar complexes produced by autoclaving precipitate in the methanol used in sample collection.</li>
	<li>Prepare to receive the samples.
	<ol>
		<li>Put 30 to 50% of the intended sample volume of methanol into a tube. For example, if a 10 mL sample is to be taken, put 5 mL of methanol into a 15 mL falcon tube and close the tube tightly. Once closed, label the tube and put on dry ice or at -80 &#176;C to chill. 
		CAUTION: Dispense the methanol in a fume hood.</li>
		<li>Label 1.5 mL tubes for long term storage of the samples and place in ice to cool.</li>
		<li>Cool enough H2O (at least 1 mL per sample) on ice.</li>
	</ol>
	</li>
	<li>Anticipate the culture&#8217;s growth. The target OD for collecting the samples is approximately 0.7 to 0.8, but the pre-incubation step (the incubation with &#946;-estradiol to induce the osTIR), needs to be started earlier so that the culture will reach approximately the right OD by the time the samples are collected. 
	NOTE: It is advisable to perform a growth curve in the conditions to be used in the experiment so that this starting OD can be estimated.</li>
	<li>Once the target OD for the start of the pre-incubation has been reached, take a sample (usually 10 mL), into the pre-prepared tube containing cold methanol. Invert briefly to mix and place back in dry ice. 
	NOTE: The sample can be moved to water ice after about 5 min, if convenient to do so.</li>
	<li>Immediately add the &#946;-estradiol, 1 &#181;L/mL of culture (final concentration of 10 &#181;M); have the &#946;-estradiol pre-measured in a pipette ready for use in order to reduce the time taken between collecting the sample and adding the &#946;-estradiol. Rapidly mix by swirling vigorously.</li>
	<li>Continue to grow the culture as before (step 2.2), incubate (this is the &#8220;pre-incubation&#8221; step) with &#946;-estradiol for the optimal time (for determination of the optimal pre-incubation time see Figure 1).</li>
	<li>Prepare to add IAA (auxin). Take up the volume of IAA needed for step 2.10 (i.e., 0.5 &#181;L of IAA per mL of culture). This makes step 2.20 faster.</li>
	<li>Collect a sample as step 2.5.</li>
	<li>Immediately add IAA 0.5 &#181;L/mL of culture to a final concentration of 750 &#181;M as prepared in step 2.8. Rapidly mix by swirling vigorously.</li>
	<li>Collect samples, as step 2.5, according to your experimental design. Either a single sample, at a time when it is expected that the protein will be reliably depleted, or multiple samples in a time course of depletion. For example, 5 min intervals are convenient for timing and provide a range of protein levels. The optimization strategy, as shown in Figure 1, will give an indication of suitable times.</li>
	<li>Process the samples.
	<ol>
		<li>Place the samples on ice, if not done already. Ensure that none of the samples has frozen; if they have, gently warm in the hand, inverting constantly so the temperature does not rise locally. 
		NOTE: This is best done in the hand as the sample&#8217;s temperature can be assessed, it should always feel cold. Place on ice. This is not a pause point - once all the samples are fluid, proceed to the next step.</li>
		<li>Once all samples have been collected and are no longer frozen, spin at 3,500 x g for 2 min (at 4 &#176;C if possible).</li>
		<li>Pour off the methanol/medium mix and place back on ice; do not worry if not all the liquid has been removed.</li>
		<li>Resuspend the cell pellet in 1 mL of ice cold H2O (from step 2.3.3) and transfer to a labelled 1.5 mL tube (prepared in step 2.3.2) on ice.</li>
		<li>Spin briefly (e.g., 10 s total time) at &#62;15,000 x g to re-pellet the cells, place back on ice and remove the liquid.</li>
		<li>Remove the H2O by aspiration. The cell pellets can be stored at -20 &#176;C, or -80 &#176;C for long term storage.</li>
	</ol>
	</li>
	<li>Check the level to which the protein has been depleted by Western blot analysis18. 
	NOTE: Sufficient protein19 and/or nucleic acid can be extracted from a single cell pellet for most purposes, although rare RNA species might require more sample volume.</li>
</ol>

<ol>
	<li>Haruki, H., Nishikawa, J., Laemmli, U. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Anchor-Away+Technique:+Rapid,+Conditional+Establishment+of+Yeast+Mutant+Phenotypes.">The Anchor-Away Technique: Rapid, Conditional Establishment of Yeast Mutant Phenotypes.</a> Molecular Cell. 31, 925-932 (2008).</li><li>Bell&#237;, G., Gar&#237;, E., Piedrafita, L., Aldea, M., Herrero, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+activator/repressor+dual+system+allows+tight+tetracycline-regulated+gene+expression+in+budding+yeast.">An activator/repressor dual system allows tight tetracycline-regulated gene expression in budding yeast.</a> Nucleic Acids Research. 26, 942-947 (1998).</li><li>Alexander, R. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RiboSys,+a+high-resolution,+quantitative+approach+to+measure+the+in+vivo+kinetics+of+pre-mRNA+splicing+and+3&#8242;-end+processing+in+Saccharomyces+cerevisiae.">RiboSys, a high-resolution, quantitative approach to measure the in vivo kinetics of pre-mRNA splicing and 3&#8242;-end processing in Saccharomyces cerevisiae.</a> RNA. 16, 2570-2580 (2010).</li><li>Deshaies, R. J., Joazeiro, C. A. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RING+Domain+E3+Ubiquitin+Ligases.">RING Domain E3 Ubiquitin Ligases.</a> Annual Review of Biochemistry. 78, 399-434 (2009).</li><li>Tan, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanism+of+auxin+perception+by+the+TIR1+ubiquitin+ligase.">Mechanism of auxin perception by the TIR1 ubiquitin ligase.</a> Nature. 446, 640-645 (2007).</li><li>Teale, W. D., Paponov, I. A., Palme, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Auxin+in+action:+signalling,+transport+and+the+control+of+plant+growth+and+development.">Auxin in action: signalling, transport and the control of plant growth and development.</a> Nature Reviews Molecular Cell Biology. 7, 847-859 (2006).</li><li>Nishimura, K., Fukagawa, T., Takisawa, H., Kakimoto, T., Kanemaki, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+auxin-based+degron+system+for+the+rapid+depletion+of+proteins+in+nonplant+cells.">An auxin-based degron system for the rapid depletion of proteins in nonplant cells.</a> Nature Methods. 6, 917-922 (2009).</li><li>Morawska, M., Ulrich, H. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+expanded+tool+kit+for+the+auxin-inducible+degron+system+in+budding+yeast.">An expanded tool kit for the auxin-inducible degron system in budding yeast.</a> Yeast. 30, 341-351 (2013).</li><li>Kubota, T., Nishimura, K., Kanemaki, M. T., Donaldson, A. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Elg1+Replication+Factor+C-like+Complex+Functions+in+PCNA+Unloading+during+DNA+Replication.">The Elg1 Replication Factor C-like Complex Functions in PCNA Unloading during DNA Replication.</a> Molecular Cell. 50, 273-280 (2013).</li><li>Brosh, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+dual+molecular+analogue+tuner+for+dissecting+protein+function+in+mammalian+cells.">A dual molecular analogue tuner for dissecting protein function in mammalian cells.</a> Nature Communications. 7, 11742 (2016).</li><li>DeRisi, J. L., Iyer, V. R., Brown, P. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Exploring+the+metabolic+and+genetic+control+of+gene+expression+on+a+genomic+scale.">Exploring the metabolic and genetic control of gene expression on a genomic scale.</a> Science. 278, 680-686 (1997).</li><li>Mendoza-Ochoa, G. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+fast+and+tuneable+auxin-inducible+degron+for+depletion+of+target+proteins+in+budding.">A fast and tuneable auxin-inducible degron for depletion of target proteins in budding.</a> Yeast. , (2018).</li><li>McIsaac, R. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthetic+gene+expression+perturbation+systems+with+rapid,+tunable,+single-gene+specificity+in+yeast.">Synthetic gene expression perturbation systems with rapid, tunable, single-gene specificity in yeast.</a> Nucleic Acids Res. 41, e57 (2013).</li><li>Prusty, R., Grisafi, P., Fink, G. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+plant+hormone+indoleacetic+acid+induces+invasive+growth+in+Saccharomyces+cerevisiae.">The plant hormone indoleacetic acid induces invasive growth in Saccharomyces cerevisiae.</a> PNAS. 101, 4153-4157 (2004).</li><li>Geitz, D., St Jean, A., Woods, R. A., Schiest, R. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+method+for+high+efficiency+transformation+of+intact+yeast+cells.">Improved method for high efficiency transformation of intact yeast cells.</a> Nucleic Acids Research. 20, 1425 (1992).</li><li>Widlund, P. O., Davis, T. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+high-efficiency+method+to+replace+essential+genes+with+mutant+alleles+in+yeast.">A high-efficiency method to replace essential genes with mutant alleles in yeast.</a> Yeast. 22, 769-774 (2005).</li><li>Longtine, M. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Additional+modules+for+versatile+and+economical+PCR-based+gene+deletion+and+modification+in+Saccharomyces+cerevisiae.">Additional modules for versatile and economical PCR-based gene deletion and modification in Saccharomyces cerevisiae.</a> Yeast. 14, 953-961 (1998).</li><li>Eaton, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+Guide+to+Modern+Quantitative+Fluorescent+Western+Blotting+with+Troubleshooting+Strategies.">A Guide to Modern Quantitative Fluorescent Western Blotting with Troubleshooting Strategies.</a> Journal of Visualized Experiments. , e52099 (2014).</li><li>Volland, C., Urban-Grimal, D., G&#233;raud, G., Haguenauer-Tsapis, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Endocytosis+and+degradation+of+the+yeast+uracil+permease+under+adverse+conditions.">Endocytosis and degradation of the yeast uracil permease under adverse conditions.</a> Journal of Biological Chemistry. 269, 9833-9841 (1994).</li><li>Barrass, J. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptome-wide+RNA+processing+kinetics+revealed+using+extremely+short+4tU+labeling.">Transcriptome-wide RNA processing kinetics revealed using extremely short 4tU labeling.</a> Genome Biology. 16, 282 (2015).</li></ol>

The authors have nothing to disclose.

A well optimized protocol can produce rapid and efficient depletion of the target protein. Determining the approximate pre-incubation time with &#946;-estradiol is important, as this increases reproducibility of the depletion, but small variations in pre-incubation time can be tolerated. On the other hand, care must be taken with timing after auxin addition, as the protein level declines very rapidly.
An advantage of this approach is that tuned depletion can be achieved by varying combinations of pre-incubation time with &#946;-estradiol and IAA incubation time. For example, if desired, the target protein can be more slowly depleted by reducing the pre-incubation time.
The &#946;-est AID system offers certain advantages over systems where OsTIR is constitutively expressed. For example, if the target protein is essential for viability, regulated expression of osTIR can avoid premature depletion of the target protein. Moreover, expression of osTIR can be tuned to suit the abundance of the target protein and its susceptibility to degradation, and the depletion can be either fast or slow. The two small molecule effectors, &#946;-estradiol and auxin, do not perturb the yeast metabolism under the conditions used here, unlike rapamycin, used in the anchor-away system1.
It should be noted that tagging some proteins disrupts their function, which is a problem with any targeted depletion system. In this case, an N-terminal tag may work when a C-terminal tag does not. Also, not all proteins will be depleted efficiently; for example, the AID-tag on the target protein may be inaccessible to the osTIR protein. Therefore, after AID-tagging, each target protein should be tested for any effect of the tag on growth, and to determine whether depletion is effective, before the timings of &#946;-estradiol pre-incubation and auxin treatment are optimized.
This AID* system is very simple and is compatible with any subsequent experimental procedure that does not involve further growth, such as protein, DNA or RNA analysis or microscopy. In addition, the system works well when combined with thiolabelling to purify nascent RNA20.
This system provides a rapid, specific, and reproducible means of depleting a protein without otherwise affecting the metabolism of the yeast cell.

Conditional mutations, such as temperature-sensitive mutants, are a powerful tool for the study of essential proteins, allowing cell growth under the permissive condition but causing loss of function under non-permissive conditions. However, cell metabolism can be seriously perturbed by the change in growth conditions required to induce the defect and may also create off-target effects. Several methods have been developed, in which the protein of interest is conditionally sequestered1 or its expression is controlled2,3 by addition of a small molecule. This protocol uses auxin and the auxin-inducible degron (AID) system to efficiently deplete a target protein.
The AID system has its origin in plants, where an auxin (in this protocol indole-3-acetic acid (IAA) is used), stimulates interaction of the Aux/IAA protein with TIR1, a member of the SCF U3 ubiquitin ligase complex4. SCF complex interaction causes polyubiquitination of Aux/IAA family proteins, which results in their degradation by the proteasome5,6.
This system was previously adapted for use in the yeast Saccharomyces cerevisiae7,8 by expressing the TIR1 protein from Oriza sativa (osTIR) in yeast cells, where it is able to interact with the endogenous yeast SCF complex. The protein of interest was tagged with a motif from the Aux/IAA protein IAA17 to target it for degradation. Functional truncations of IAA17 were developed later, such as AID*8,9,10, containing the 43 amino acid auxin-sensitive motif from Arabidopsis thaliana IAA17, along with an epitope tag to enable detection.
The system initially adapted for use in budding yeast7,8 expressed the osTIR1 protein from a yeast GAL promoter. Expression requires shifting to growth medium with galactose as the sole carbon source, which, unfortunately, results in a diauxic shift with wide-ranging changes to cell metabolism11. On the other hand, it has been reported that constitutive expression of TIR1 can lead to degradation of the target protein in the absence of auxin/IAA12 if the expression level is high, whereas low TIR1 expression causes inefficient depletion. An improved AID system named &#946;-est AID was developed in which the osTIR is under the control of an inducible promoter that is tunable to suit the target protein, with minimal effect on cell metabolism. To achieve this, an artificial transcription factor (ATF) was constructed in which the VP16 viral transcription activator is fused to an oestrogen receptor and a four Zn fingers DNA binding domain (DBD). When &#946;-estradiol (an oestrogen) is present, the ATF can enter the nucleus and induce osTIR transcription by binding to its promoter (Z4EVpr)13,12.
osTIR expression is usually detectable about 20 min after addition of &#946;-estradiol12. However, the optimal duration of osTIR expression to achieve efficient depletion of the tagged protein with auxin, while avoiding depletion before auxin addition, needs to be empirically determined for each target protein. An approximate time for this pre-incubation can be estimated from abundance values in the Saccharomyces Genome Database (SGD https://www.yeastgenome.org/). As can be seen in Figure 1, the abundant protein, Dcp1 (2880 to 4189 molecules/cell), requires 40 min of pre-incubation with &#946;-estradiol, with no auxin-independent depletion observed. The much less abundant protein, Prp2 (172 to 211 molecules/cell), is strongly depleted after only 20 min of pre-incubation. It is advisable to test two additional pre-incubation times, 10 to 20 min before or after this initial estimated time (20 min is the minimum time that is recommended). The optimum pre-incubation time is the time at which target protein has not depleted before adding auxin and once auxin is added the depletion is acceptable or protein levels approach the minimum possible. So, from Figure 1b, for Prp22 with 30 min of pre-incubation, the levels have not declined much 10 min after auxin addition. Comparing this with 40 min of pre-incubation and 15 min with IAA, where there is little additional depletion, there is no benefit in incubating with auxin longer than 10 min or pre-incubating for longer than 30 min, particularly as there is evidence of non-auxin dependent depletion at 40 min. For Dcp1 with 40 min of pre-incubation (the last point at which the protein level is approximately 100% before auxin addition), 15 to 20 min of depletion with auxin is acceptable. It is recommended to keep the depletion time as short as possible to reduce secondary effects on cell metabolism14.
This article demonstrates how to use the &#946;-est AID system by optimizing the timing of &#946;-estradiol incubation for osTIR expression to achieve rapid target protein depletion upon IAA addition without depletion before adding auxin.

<table>
	<tbody>
		<tr>
			<td>Adenine sulphate</td>
			<td>Formedium</td>
			<td>DOC0230</td>
			<td></td>
		</tr>
		<tr>
			<td>Agar</td>
			<td>Formedium</td>
			<td>AGA03</td>
			<td></td>
		</tr>
		<tr>
			<td>&#914;-estradiol</td>
			<td>Sigma Aldrich</td>
			<td>E2758-1G</td>
			<td>10mM solution in ethanol. Store at -20 oC</td>
		</tr>
		<tr>
			<td>DMSO</td>
			<td>Alfa Aesar</td>
			<td>42780</td>
			<td>DMSO should be solid at 4 oC</td>
		</tr>
		<tr>
			<td>Glucose</td>
			<td>Fisher Scientific</td>
			<td>G/0500/60</td>
			<td></td>
		</tr>
		<tr>
			<td>IAA 1H-Indole-3-acetic acid</td>
			<td>Across Orgainics</td>
			<td>122150100</td>
			<td>Auxin analogue. 1.5 M in DMSO. The solution will be a russet colour and darken as time goes on; a deep red solution should be discarded and a new one made. Store at -20 oC.</td>
		</tr>
		<tr>
			<td>Methanol</td>
			<td>Fisher Scientific</td>
			<td>M/4000/PC17</td>
			<td>CAUTION Toxic and flammable</td>
		</tr>
		<tr>
			<td>Phusion&#160;High-Fidelity DNA Polymerase</td>
			<td>NEB</td>
			<td>M0530</td>
			<td></td>
		</tr>
		<tr>
			<td>Peptone</td>
			<td>Formedium</td>
			<td>PEP03</td>
			<td></td>
		</tr>
		<tr>
			<td>SCSM single drop-out &#8211;ura</td>
			<td>Formedium</td>
			<td>DSCS101</td>
			<td></td>
		</tr>
		<tr>
			<td>Yeast Extract</td>
			<td>Formedium</td>
			<td>YEA03</td>
			<td></td>
		</tr>
		<tr>
			<td>Yeast nitrogen base without amino acids with amonium sulphate</td>
			<td>Formedium</td>
			<td>CYN0410</td>
			<td></td>
		</tr>
	</tbody>
</table>

tuning degradation to achieve specific and efficient protein depletion

The plant auxin binding receptor, TIR1, recognizes proteins containing a specific auxin-inducible degron (AID) motif in the presence of auxin, targeting them for degradation. This system is exploited in many non-plant eukaryotes, such that a target protein, tagged with the AID motif, is degraded upon auxin addition. The level of TIR1 expression is critical; excessive expression leads to degradation of the AID-tagged protein even in the absence of auxin, whereas low expression leads to slow depletion. A &#946;-estradiol-inducible AID system was created, with expression of TIR1 under the control of a &#946;-estradiol inducible promoter. The level of TIR1 is tunable by changing the time of incubation with &#946;-estradiol before auxin addition. This protocol describes how to rapidly deplete a target protein using the AID system. The appropriate &#946;-estradiol incubation time depends on the abundance of the target protein. Therefore, efficient depletion depends on optimal timing that also minimizes auxin-independent depletion.

Representative examples of depletion are displayed in Figure 1. The three experiments presented in this figure were optimization experiments for depletion of the proteins Prp2, Prp22 and Dcp1. The low abundance, spliceosomal Prp2 and Prp22 proteins both depleted to less than 20% after 40 min pre-incubation with &#946;-estradiol followed by 15 min with auxin.&#160;Longer pre-incubation times lead to faster depletion but also show undesirable protein depletion before auxin addition. In comparison, the more abundant Dcp1 was only depleted to approximately 30% with the same treatment, but 60 min of pre-incubation resulted in depletion to 13% with the same auxin treatment, at the cost of depletion before the auxin is added. It is possible that 50 min of pre-incubation with &#946;-estradiol and 15 min with auxin would have achieved similar results at a shorter time point and so would have been more optimal.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/59874/59874fig01.jpg" /> 
Figure 1: Depletion rate can be tuned by modulating the duration of &#946;-estradiol pre-incubation.&#160;Western blot18 of target proteins: (a and b) Prp22-AID*-6FLAG, (c and d) Prp2-AID*-6FLAG, and (e and f) Dcp1-AID*-6HA, from cultures pre-incubated with &#946;-estradiol (&#946;-est) for 20, 30, 40, or 60 min prior to auxin addition12. Equal amounts of total protein were loaded in each lane. Pgk1 is detected as a visual loading control, except for panel e, where Pgk1 and Dcp1 co-migrate. Quantification of protein bands in panels a, c and e are shown in panels b, d, and f, respectively. As a measure of depletion rate, the slope (m) was calculated for the linear section (from 100% to 30% of initial values) of each curve. The optimal pre-incubation time is the time at which the protein levels are still close to the un-induced levels (100%) and the subsequent rate of depletion is fast. For Dcp1 (f), 60 min of pre-incubation is too long, as the protein has begun to degrade in the absence of auxin, whereas 20 min is too short, as the protein does not appreciably deplete in this time course. After 40 min pre-incubation, 15 min with auxin can be used as the protein is approximately 70% depleted and, although 20 min would result in further depletion, it could also result in secondary effects. Error bars represent standard deviation of two biological replicates. For each experiment, one representative blot is shown. This figure is derived from previous publication9. <a href="https://www.jove.com/files/ftp_upload/59874/59874fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/59874/59874fig02v2.jpg" /> 
Figure 2: Graphical summary.&#160;Add &#946;-estradiol to sufficient culture growing in rich medium and at the required temperature in order to start pre-incubation. Continue growth for the required pre-incubation time before adding IAA (auxin) to start depletion. The pre-incubation and depletion times depend on the protein to be depleted, but pre-incubation is often in the range of 20-60 min and the depletion time is typically in the order of 10 to 20 min. 10 mL samples should be taken at the start and end of pre-incubation and during the depletion. These samples are rapidly fixed in cold methanol before pelleting and storage. <a href="https://www.jove.com/files/ftp_upload/59874/59874fig02v2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/59874/59874fig03.jpg" /> 
Figure 3: Strain generation for the B-est system.&#160;(a) To generate a yeast strain with the AID* system, either the pZTRL (LEU2) or the pZTRK (kanamycin (G418) resistance), plasmid should be introduced into the strain or, alternatively, the ATF and osTIR can be inserted into the genome by homologous recombination of a fragment generated by PCR from 3&#8217;end primers (see Figure 3b and Table 1). (b) C-terminal tagging of the target protein is achieved by PCR amplification of the appropriate region of the plasmid pURA3-AID*-6FLAG (pURA3_AID*-6HA differs only in the tag and can be treated in exactly the same way), using Longtine primers S3-F and S2-R with 3&#8217; extensions homologous to the 3&#8217; end of the target protein. The forward primer extension should include the last amino acid codon in frame with the start of the AID* tag and must not include the stop codon. The reverse primer extension should be to a region downstream of the coding region. Once inserted into the genome, cells that have lost the URA3 marker (by homologous recombination between the identical regions found at both ends of the marker) can be selected by growth with 5-FOA, that counter-selects URA3 cells. <a href="https://www.jove.com/files/ftp_upload/59874/59874fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="8">a. Primer Sequences</td>
		</tr>
		<tr>
			<td>Target</td>
			<td>Location</td>
			<td>Primer</td>
			<td>Name</td>
			<td colspan="3">Sequence</td>
			<td>Tm (&#176;C)</td>
		</tr>
		<tr>
			<td rowspan="2">pZTRL</td>
			<td>516</td>
			<td>F</td>
			<td>pZTRL_F</td>
			<td colspan="3">&#60;-region of homology-&#62;GCGACAGCATCACCGACTTCG</td>
			<td>61.23</td>
		</tr>
		<tr>
			<td>7897</td>
			<td>R</td>
			<td>pZTR_R</td>
			<td colspan="3">CGCCGCCTCTACCTTGCAGA&#60;-region of homology (RC)-&#62;</td>
			<td>61.30</td>
		</tr>
		<tr>
			<td rowspan="2">pZTRK</td>
			<td>9154</td>
			<td>F</td>
			<td>pZTRK_F</td>
			<td colspan="3">&#60;-region of homology-&#62;ACGTTGAGCCATTAGTATCAATTTGCTTACC</td>
			<td>59.40</td>
		</tr>
		<tr>
			<td>5897</td>
			<td>R</td>
			<td>pZTR_R</td>
			<td colspan="3">CGCCGCCTCTACCTTGCAGA&#60;-region of homology (RC)-&#62;</td>
			<td>61.30</td>
		</tr>
		<tr>
			<td colspan="2" rowspan="2">pURA3-AID*-6FLAG or pURA3_AID*-6HA</td>
			<td>F</td>
			<td>S3-F</td>
			<td colspan="3">&#60;-region of homology-&#62;CGTACGCTGCAGGTCGAC</td>
			<td>59.21</td>
		</tr>
		<tr>
			<td>R</td>
			<td>S2-R</td>
			<td colspan="3">ATCGATGAATTCGAGCTCG&#60;-region of homology (RC)-&#62;</td>
			<td>52.76</td>
		</tr>
		<tr>
			<td colspan="8">pZRTL/K is to amplify the &#946;-est AID system</td>
		</tr>
		<tr>
			<td colspan="8">pURA3-AID*-6FLAG/6HA to amplify the AID* and epitope tag to tag the target protein (Lontine procedure)</td>
		</tr>
		<tr>
			<td colspan="3">&#60;-region of homology-&#62;</td>
			<td colspan="5">Region homologous to the flanking regions where the system is to be inserted. The longer this region is the more likely the modification is to be successful; 50 - 100 bases is recommended.</td>
		</tr>
		<tr>
			<td colspan="3">&#60;-region of homology (RC)-&#62;</td>
			<td colspan="5">Region homologous to the flanking regions where the system is to be inserted, remember to use the reverse complement. As above, the longer this region is the better.</td>
		</tr>
		<tr>
			<td colspan="3">Tm (&#176;C)</td>
			<td colspan="5">Tm using the %GC method with 50 mM NaCl</td>
		</tr>
		<tr>
			<td colspan="8">b. PCR Mix</td>
		</tr>
		<tr>
			<td colspan="4">Component</td>
			<td colspan="4">Volume (&#181;L)</td>
		</tr>
		<tr>
			<td colspan="4">Template</td>
			<td colspan="4">&#60;10</td>
		</tr>
		<tr>
			<td colspan="4">NEB Phusion HF Buffer (5x)*</td>
			<td colspan="4">100</td>
		</tr>
		<tr>
			<td colspan="4">Forward Primer 100 &#181;M</td>
			<td colspan="4">2.5</td>
		</tr>
		<tr>
			<td colspan="4">Reverse Primer 100 &#181;M</td>
			<td colspan="4">2.5</td>
		</tr>
		<tr>
			<td colspan="4">dNTPs 10 mM each</td>
			<td colspan="4">10</td>
		</tr>
		<tr>
			<td colspan="4">H2O</td>
			<td colspan="4">to 500</td>
		</tr>
		<tr>
			<td colspan="8">* The NEB Phusion GC Buffer (5x) can also be used but is not preferred</td>
		</tr>
		<tr>
			<td colspan="8">Make this mix, split into 10 tubes of 50 &#181;l mix each and perform the PCR as Table 1 c.</td>
		</tr>
		<tr>
			<td colspan="8">Check the PCR has worked by running on an agarose gel</td>
		</tr>
		<tr>
			<td colspan="8">Combine all successful reactions into one tube and ethanol precipitate</td>
		</tr>
		<tr>
			<td colspan="8">Transform the yeast with all the material produced by the PCR</td>
		</tr>
		<tr>
			<td colspan="8">c. PCR Conditions</td>
		</tr>
		<tr>
			<td colspan="6">Step</td>
			<td>Temp (&#176;C)</td>
			<td>Time</td>
		</tr>
		<tr>
			<td colspan="6">Initial Denaturation</td>
			<td>98</td>
			<td>30 s</td>
		</tr>
		<tr>
			<td colspan="3" rowspan="3">25-35 Cycles</td>
			<td colspan="3">Denature</td>
			<td>98</td>
			<td>10 s</td>
		</tr>
		<tr>
			<td colspan="3">Anneal</td>
			<td>45&#8211;60</td>
			<td>20 s</td>
		</tr>
		<tr>
			<td colspan="3">Extension</td>
			<td>72</td>
			<td>30 s/kb</td>
		</tr>
		<tr>
			<td colspan="6">Final Extension</td>
			<td>72</td>
			<td>10 min</td>
		</tr>
		<tr>
			<td colspan="6">Hold</td>
			<td>8</td>
			<td></td>
		</tr>
		<tr>
			<td colspan="8">Anneal at 45 &#176;C for the Lontine primer set (S3-F and S2-R) and 60 &#176;C for the pZTRL/K primers</td>
		</tr>
		<tr>
			<td colspan="8">Extend for 3 minutes for the Lontine PCR and 3 minutes for pZTRL/K</td>
		</tr>
	</tbody>
</table>
Table 1: Primer sequences, PCR mix and PCR conditions.

Watch this Scientific Journal Video about Tuning Degradation to Achieve Specific and Efficient Protein Depletion at JoVE.com

Tuning Degradation to Achieve Specific and Efficient Protein Depletion

Here, we present a protocol to effectively and specifically deplete a protein of interest in the yeast Saccharomyces cerevisiae using the &#946;-est AID system.

The plant auxin binding receptor, TIR1, recognizes proteins containing a specific auxin-inducible degron (AID) motif in the presence of auxin, targeting ...

tuning-degradation-to-achieve-specific-and-efficient-protein-depletion

Research

JoVE Journal

Immunology and Infection

6.1K Views.  University of Edinburgh. Here, we present a protocol to effectively and specifically deplete a protein of interest in the yeast Saccharomyces cerevisiae using the β-est AID system.

Video: Tuning Degradation to Achieve Specific and Efficient Protein Depletion

Depletion of Specific Cell Populations by Complement Depletion

The purification of immune cell populations is often required in order to study their unique functions. In particular, molecular approaches such as real-time PCR and microarray analysis require the isolation of cell populations with high purity. Commonly used purification strategies include fluorescent activated cell sorting (FACS), magnetic bead separation and complement depletion. Of the three strategies, complement depletion offers the advantages of being fast, inexpensive, gentle on the cells and a high cell yield. The complement system is composed of a large number of plasma proteins that when activated initiate a proteolytic cascade culminating in the formation of a membrane-attack complex that forms a pore on a cell surface resulting in cell death1. The classical pathway is activated by IgM and IgG antibodies and was first described as a mechanism for killing bacteria. With the generation of monoclonal antibodies (mAb), the complement cascade can be used to lyse any cell population in an antigen-specific manner. Depletion of cells by the complement cascade is achieved by the addition of complement fixing antigen-specific antibodies and rabbit complement to the starting cell population. The cells are incubated for one hour at 37&deg;C and the lysed cells are subsequently removed by two rounds of washing. MAb with a high efficiency for complement fixation typically deplete 95-100% of the targeted cell population. Depending on the purification strategy for the targeted cell population, complement depletion can be used for cell purification or for the enrichment of cell populations that then can be further purified by a subsequent method.

To effectively study the function of immune cell populations their purification is often required. Complement depletion is a fast and inexpensive technique for the isolation of immune cell populations with high purity.

The purification of immune cell populations is often required in order to study their unique functions.  In particular, molecular approaches such as ...

Specific Marking of HIV-1 Positive Cells using a Rev-dependent Lentiviral Vector Expressing the Green Fluorescent Protein

Most of HIV-responsive expression vectors are based on the HIV promoter, the long terminal repeat (LTR). While responsive to an early HIV protein, Tat, the LTR is also responsive to cellular activation states and to the local chromatin activity where the integration has occurred. This can result in high HIV-independent activity, and has restricted the usefulness of LTR-based reporter to mark HIV positive cells 1,2,3. Here, we constructed an expression lentiviral vector that possesses, in addition to the Tat-responsive LTR, numerous HIV DNA sequences that include the Rev-response element and HIV splicing sites 4,5,6. The vector was incorporated into a lentiviral reporter virus, permitting highly specific detection of replicating HIV in living cell populations. The activity of the vector was measured by expression of the green fluorescence protein (GFP). The application of this vector as reported here offers a novel alternative approach to existing methods, such as in situ PCR or HIV antigen staining, to identify HIV-positive cells. The vector can also express therapeutic genes for basic or clinical experimentation to target HIV-positive cells.

We have developed a lentiviral vector that possesses, in addition to the Tat-responsive LTR, the Rev-response element (RRE) that can regulate reporter gene expression in an HIV-1 Tat- and Rev-dependent fashion. The vector permits the specific detection of replicating HIV in living cells via the expression of GFP.

Most of HIV-responsive expression vectors are based on the HIV promoter, the long terminal repeat (LTR). While responsive to an early HIV protein, Tat, ...

Depletion and Reconstitution of Macrophages in Mice

Macrophages are critical players in the innate immune response to infectious challenge or injury, initiating the innate immune response and directing the acquired immune response. Macrophage dysfunction can lead to an inability to mount an appropriate immune response and as such, has been implicated in many disease processes, including inflammatory bowel diseases. Macrophages display polarized phenotypes that are broadly divided into two categories. Classically activated macrophages, activated by stimulation with IFN&gamma; or LPS, play an essential role in response to bacterial challenge whereas alternatively activated macrophages, activated by IL-4 or IL-13, participate in debris scavenging and tissue remodeling and have been implicated in the resolution phase of inflammation. During an inflammatory response in vivo, macrophages are found amid a complex mixture of infiltrating immune cells and may participate by exacerbating or resolving inflammation. To define the role of macrophages in situ in a whole animal model, it is necessary to examine the effect of depleting macrophages from the complex environment. To ask questions about the role of macrophage phenotype in situ, phenotypically defined polarized macrophages can be derived ex vivo, from bone marrow aspirates and added back to mice, with or without prior depletion of macrophages. In the protocol presented here clodronate-containing liposomes, versus PBS injected controls, were used to deplete colonic macrophages during dextran sodium sulfate (DSS)-induced colitis in mice. In addition, polarized macrophages were derived ex vivo and transferred to mice by intravenous injection. A caveat to this approach is that clodronate-containing liposomes deplete all professional phagocytes, including both dendritic cells and macrophages so to ensure the effect observed by depletion is macrophage-specific, reconstitution of phenotype by adoptive transfer of macrophages is necessary. Systemic macrophage depletion in mice can also be achieved by backcrossing mice onto a CD11b-DTR background, which is an excellent complementary approach. The advantage of clodronate-containing liposome-mediated depletion is that it does not require the time and expense involved in backcrossing mice and it can be used in mice regardless of the background of the mice (C57BL/6, BALB/c, or mixed background).

Macrophages play a central role in homeostasis and pathology in many tissues. The protocol presented here describes methods for depleting macrophages in vivo, deriving polarized macrophages from bone marrow aspirates, and adoptively transferring macrophages into mice. These techniques allow determination of the role that polarized macrophages play in health and disease.

Macrophages are critical players in the innate  immune response to infectious challenge or injury, initiating the innate immune  response and directing ...

A Comparative Approach to Characterize the Landscape of Host-Pathogen Protein-Protein Interactions

Significant efforts were gathered to generate large-scale comprehensive protein-protein interaction network maps. This is instrumental to understand the pathogen-host relationships and was essentially performed by genetic screenings in yeast two-hybrid systems. The recent improvement of protein-protein interaction detection by a Gaussia luciferase-based fragment complementation assay now offers the opportunity to develop integrative comparative interactomic approaches necessary to rigorously compare interaction profiles of proteins from different pathogen strain variants against a common set of cellular factors.
This paper specifically focuses on the utility of combining two orthogonal methods to generate protein-protein interaction datasets: yeast two-hybrid (Y2H) and a new assay, high-throughput Gaussia princeps protein complementation assay (HT-GPCA) performed in mammalian cells.
A large-scale identification of cellular partners of a pathogen protein is performed by mating-based yeast two-hybrid screenings of cDNA libraries using multiple pathogen strain variants. A subset of interacting partners selected on a high-confidence statistical scoring is further validated in mammalian cells for pair-wise interactions with the whole set of pathogen variants proteins using HT-GPCA. This combination of two complementary methods improves the robustness of the interaction dataset, and allows the performance of a stringent comparative interaction analysis. Such comparative interactomics constitute a reliable and powerful strategy to decipher any pathogen-host interplays.

This article focuses on the identification of high-confident interaction datasets between host and pathogen proteins using a combination of two orthogonal methods: yeast two-hybrid followed by a high-throughput interaction assay in mammalian cells called HT-GPCA.

Significant efforts were gathered to generate  large-scale comprehensive protein-protein interaction network maps. This is  instrumental to understand the ...

A Simple and Efficient Method to Detect Nuclear Factor Activation in Human Neutrophils by Flow Cytometry

Neutrophils are the most abundant leukocytes in peripheral blood. These cells are the first to appear at sites of inflammation and infection, thus becoming the first line of defense against invading microorganisms. Neutrophils possess important antimicrobial functions such as phagocytosis, release of lytic enzymes, and production of reactive oxygen species. In addition to these important defense functions, neutrophils perform other tasks in response to infection such as production of proinflammatory cytokines and inhibition of apoptosis. Cytokines recruit other leukocytes that help clear the infection, and inhibition of apoptosis allows the neutrophil to live longer at the site of infection. These functions are regulated at the level of transcription. However, because neutrophils are short-lived cells, the study of transcriptionally regulated responses in these cells cannot be performed with conventional reporter gene methods since there are no efficient techniques for neutrophil transfection. Here, we present a simple and efficient method that allows detection and quantification of nuclear factors in isolated and immunolabeled nuclei by flow cytometry. We describe techniques to isolate pure neutrophils from human peripheral blood, stimulate these cells with anti-receptor antibodies, isolate and immunolabel nuclei, and analyze nuclei by flow cytometry. The method has been successfully used to detect NF-&kappa;B and Elk-1 nuclear factors in nuclei from neutrophils and other cell types. Thus, this method represents an option for analyzing activation of transcription factors in isolated nuclei from a variety of cell types.

Neutrophils are the most abundant leukocytes in blood. Neutrophils possess transcriptionally regulated functions such as production of proinflammatory cytokines and inhibition of apoptosis. These functions can be studied with the method presented here, which allows detection and quantification of nuclear factors by flow cytometry in isolated nuclei

Neutrophils  are the most abundant leukocytes in peripheral blood. These cells are the first  to appear at sites of inflammation and infection, thus ...

Killer Artificial Antigen Presenting Cells (KaAPC) for Efficient In Vitro Depletion of Human Antigen-specific T Cells

Current treatment of T cell mediated autoimmune diseases relies mostly on strategies of global immunosuppression, which, in the long term, is accompanied by adverse side effects such as a reduced ability to control infections or malignancies. Therefore, new approaches need to be developed that target only the disease mediating cells and leave the remaining immune system intact. Over the past decade a variety of cell based immunotherapy strategies to modulate T cell mediated immune responses have been developed. Most of these approaches rely on tolerance-inducing antigen presenting cells (APC). However, in addition to being technically difficult and cumbersome, such cell-based approaches are highly sensitive to cytotoxic T cell responses, which limits their therapeutic capacity. Here we present a protocol for the generation of non-cellular killer artificial antigen presenting cells (KaAPC), which allows for the depletion of pathologic T cells while leaving the remaining immune system untouched and functional. KaAPC is an alternative solution to cellular immunotherapy which has potential for treating autoimmune diseases and allograft rejections by regulating undesirable T cell responses in an antigen specific fashion.

Killer Artificial Antigen Presenting Cells KaAPC for Efficient In Vitro Depletion of Human Antigen-specific T Cells

Guidelines are presented for the generation of killer artificial antigen presenting cells, KaAPC, an efficient tool for in vitro depletion of human antigen-specific T cells and an alternative solution to cellular immunotherapy for the treatment of T cell-mediated autoimmune diseases in an antigen-specific fashion without compromising the remaining immune system.

Current treatment of T cell mediated autoimmune diseases relies mostly on strategies of global immunosuppression, which, in the long term, is accompanied ...

Macrophage Cholesterol Depletion and Its Effect on the Phagocytosis of Cryptococcus neoformans

Cryptococcosis is a life-threatening infection caused by pathogenic fungi of the genus Cryptococcus. Infection occurs upon inhalation of spores, which are able to replicate in the deep lung. Phagocytosis of Cryptococcus by macrophages is one of the ways that the disease is able to spread into the central nervous system to cause lethal meningoencephalitis. Therefore, study of the association between Cryptococcus and macrophages is important to understanding the progression of the infection. The present study describes a step-by-step protocol to study macrophage infectivity by C. neoformansin vitro. Using this protocol, the role of host sterols on host-pathogen interactions is studied. Different concentrations of methyl--cyclodextrin (MCD) were used to deplete cholesterol from murine reticulum sarcoma macrophage-like cell line J774A.1. Cholesterol depletion was confirmed and quantified using both a commercially available cholesterol quantification kit and thin layer chromatography. Cholesterol depleted cells were activated using Lipopolysacharide (LPS) and Interferon gamma (IFN&#947;) and infected with antibody-opsonized Cryptococcus neoformans wild-type H99 cells at an effector-to-target ratio of 1:1. Infected cells were monitored after 2 hr of incubation with C. neoformans and their phagocytic index was calculated. Cholesterol depletion resulted in a significant reduction in the phagocytic index. The presented protocols offer a convenient method to mimic the initiation of the infection process in a laboratory environment and study the role of host lipid composition on infectivity.

Macrophage Cholesterol Depletion and Its Effect on the Phagocytosis of Cryptococcus neoformans

In this article, a protocol for infection of macrophages with Cryptococcus neoformans is described. Also, a method for sterol depletion from the macrophages is explained. These protocols provide a guide to study fungal infections in vitro and examine the role of sterols in such infections.

Cryptococcosis is a life-threatening infection caused by pathogenic fungi of the genus Cryptococcus. Infection occurs upon inhalation of spores, which are ...

A Simple and Efficient Approach to Construct Mutant Vaccinia Virus Vectors

The CRISPR-associated endonuclease Cas9 can edit particular genomic loci directed by a single guide RNA (gRNA). The CRISPR/Cas9 system has been successfully employed for editing genomes of various organisms. Here we describe a protocol for editing the vaccinia virus (VV) genome in the cytoplasm of VV-infected CV-1 cells using the RNA-guided Cas9. RNA-guided Cas9 induces double-stranded DNA breaks facilitating homologous recombination efficiently and specifically in the targeted site of VV and a transgene can be incorporated into these sites by homologous recombination. By using a site-specific homologous vector with transgene(s), a N1L gene-deleted VV with the red fluorescence protein (RFP) gene incorporated in this region was generated with a successful recombination efficiency 10 times greater than that obtained from the conventional homologous recombination method. This protocol demonstrates successful use of RNA-guided Cas9 system to generate mutant VVs with enhanced efficiency.

Vaccinia virus (VV) has been widely used in biomedical research and the improvement of human health. This article describes a simple, highly efficient method to edit the VV genome using a CRISPR-Cas9 system.

The CRISPR-associated endonuclease Cas9 can edit particular genomic loci directed by a single guide RNA (gRNA). The CRISPR/Cas9 system has been ...

Zika Virus Specific Diagnostic Epitope Discovery

High-density peptide microarrays allow screening of more than six thousand peptides on a single standard microscopy slide. This method can be applied for drug discovery, therapeutic target identification, and developing of diagnostics. Here, we present a protocol to discover specific Zika virus (ZIKV) diagnostic peptides using a high-density peptide microarray. A human serum sample validated for ZIKV infection was incubated with a high-density peptide microarray containing the entire ZIKV protein translated into 3,423 unique 15 linear amino acid (aa) residues with a 14-aa residue overlap printed in duplicate. Staining with different secondary antibodies within the same array, we detected peptides that bind to Immunoglobulin M (IgM) and Immunoglobulin G (IgG) antibodies present in serum. These peptides were selected for further validation experiments. In this protocol, we describe the strategy followed to design, process, and analyze a high-density peptide microarray.

In this protocol, we describe a technique to discover Zika virus specific diagnostic peptides using a high-density peptide microarray. This protocol can readly be adapted for other emerging infectious diseases.

High-density peptide microarrays allow screening of more than six thousand peptides on a single standard microscopy slide. This method can be applied for ...

A Protein Microarray Assay for Serological Determination of Antigen-specific Antibody Responses Following Clostridium difficile Infection

We provide a detailed overview of a novel high-throughput protein microarray assay for the determination of anti-Clostridium difficile antibody levels in human sera and in separate preparations of polyclonal intravenous immunoglobulin (IVIg). The protocol describes the methodological steps involved in sample preparation, printing of arrays, assay procedure, and data analysis. In addition, this protocol could be further developed to incorporate diverse clinical samples including plasma and cell culture supernatants. We show how protein microarray can be used to determine a combination of isotype (IgG, IgA, IgM), subclass (IgG1, IgG2, IgG3, IgG4, IgA1, IgA2), and strain-specific antibodies to highly purified whole C. difficile toxins A and B (toxinotype 0, strain VPI 10463, ribotype 087), toxin B from a C. difficile toxin-B-only expressing strain (CCUG 20309), a precursor form of a B fragment of binary toxin, pCDTb, ribotype-specific whole surface layer proteins (SLPs; 001, 002, 027), and control proteins (tetanus toxoid and Candida albicans). During the experiment, microarrays are probed with sera from individuals with C. difficile infection (CDI), individuals with cystic fibrosis (CF) without diarrhea, healthy controls (HC), and from individuals pre- and post-IVIg therapy for the treatment of CDI, combined immunodeficiency disorder, and chronic inflammatory demyelinating polyradiculopathy. We encounter significant differences in toxin neutralization efficacies and multi-isotype specific antibody levels between patient groups, commercial preparations of IVIg, and sera before and following IVIg administration. Also, there is a significant correlation between microarray and enzyme-linked immunosorbent assay (ELISA) for antitoxin IgG levels in serum samples. These results suggest that microarray could become a promising tool for profiling antibody responses to C.difficile antigens in vaccinated or infected humans. With further refinement of antigen panels and a reduction in production costs, we anticipate that microarray technology may help optimize and select the most clinically useful immunotherapies for C. difficile infection in a patient-specific manner.

A Protein Microarray Assay for Serological Determination of Antigen-specific Antibody Responses Following Clostridium difficile Infection

This article describes a simple protein microarray method for profiling humoral immune responses to a 7-plex panel of highly purified Clostridium difficile antigens in human sera. The protocol can be extended for the determination of specific antibody responses in preparations of polyclonal intravenous immunoglobulin.

We provide a detailed overview of a novel high-throughput protein microarray assay for the determination of anti-Clostridium difficile antibody levels in ...