The authors are grateful to E. Makeyev (Nanyang Technological University, Singapore) for the HeLa-Cre cells and pRD-RIPE and pCAGGS-Cre plasmids. We thank Edna Kimura, Carolina Purcell Goes, Gisela Ramos, Lucia Rossetti Lopes, and Anselmo Moriscot for their support.

An overview of the protocol described here is depicted in Figure 1.
1. Plasmid construction
<ol>
	<li>pCAGGS-Cre: This plasmid was provided by Dr. E. Makeyev21.</li>
	<li>pRD-miR-17-92:
	<ol>
		<li>Amplify pre-miR-17-92 by PCR using 0.5 &#181;M of each specific primer (Table of Materials), 150 ng of cDNA, 1 mM dNTPs, 1x Taq PCR buffer, and 5 U of high-fidelity Taq DNA polymerase. Perform a no-template control PCR reaction (use water instead of cDNA) to check for DNA contamination.</li>
		<li>Ligate the PCR product into pRD-RIPE (kindly provided by Dr. E. Makeyev, Nanyang Technological University, Singapore)21 inside the intron between the EcoRI and EcoRV restriction sites using DNA ligase, creating pRD-miR-17-92. Confirm sequence integrity by Sanger sequencing.</li>
	</ol>
	</li>
	<li>pmiRGLO-RAP-IB
	<ol>
		<li>Design forward and reverse primers flanked by XhoI/XbaI restriction sites and with one NotI restriction site inside. Mix equimolar amounts of forward and reverse primers and incubate the mixture at 90 &#176;C for 5 min, then transfer to 37 &#176;C for 15 min. As controls, use primers with scrambled target sequences (Table of Materials).</li>
		<li>Cleave the annealed fragments using XhoI/XbaI restriction enzymes and ligate them downstream of the luc2 sequence into pmiR-GLO, generating pmiRGLO-RAP-IB-3&#697;-UTR (Luc-RAP-1B) and pmiRGLO-scrambled-3&#697;-UTR (Luc-scrambled) reporter constructs. Confirm ligation with NotI cleavage. 
		&#8203;NOTE: Ensure that the overhangs created after primer annealing are complementary to the vector after cleavage reaction.</li>
	</ol>
	</li>
	<li>pFLAG-HuR
	<ol>
		<li>To generate a HuR over-expressing plasmid, amplify the HuR sequence with specific primers. Mix 300 ng of cDNA, 0.5 &#181;M of each specific primer, 1 mM dNTPs mix, 1x PCR buffer, and 5 U of high-fidelity Taq DNA polymerase.</li>
		<li>Ligate the PCR product into pGEM-T and confirm the DNA sequence integrity by Sanger sequencing. Remove the HuR fragment from pGEM-T and subclone it into pFLAG-CMV-3 mammalian expression vector to generate the pFLAG-HuR vector.</li>
	</ol>
	</li>
</ol>
2. Cell culture
NOTE: The HeLa-Cre cell line was a gift from Dr. E. Makeyev21, and the papillary thyroid cancer cell (BCPAP) was kindly provided by Dr. Massimo Santoro (University &#34;Federico II&#34;, Naples, Italy). HeLa cell, papillary thyroid cancer cell (BCPAP), and HEK-293T were used to overexpress HuR.
<ol>
	<li>Maintain the cells in DMEM/high-glucose supplemented with 10% fetal bovine serum, 1 mM sodium pyruvate, 200 mM L-glutamine, and 1x penicillin-streptomycin (100 U/mL penicillin, 100 &#181;g/mL streptomycin) in 100 mm Petri dishes, unless otherwise indicated. Incubate the cells at 37 &#176;C in a humidified, controlled-atmosphere incubator (5% CO2).</li>
	<li>Incubate adherent cells with trypsin/EDTA (0.5% solution mixture) at 37 &#176;C for 3-5 min. Let them detach from the plate (incubation period can vary according to the cell type).</li>
	<li>Perform transfections with a lipid-based transfection reagent following the manufacturer&#39;s instructions. Ensure that the cell cultures are approximately 70% confluent. Use similar amounts of DNA for all transfection combinations, as described below, by adding the appropriate DNAs. Perform transfection experiments in replicates.
	<ol>
		<li>Mix 200 ng of DNA and 1.25 &#181;L of transfection reagent in 100 &#181;L of the culture medium. Add the transfection mixture to the cells. Incubate the cells with the transfection mixtures for 4 h at 37 &#176;C. Then, replace the medium with medium containing 10% FBS, and incubate for another 24 h before adding the antibiotics for selection.</li>
	</ol>
	</li>
</ol>
3. HuR overexpression
<ol>
	<li>Transfect pFLAG-HuR and empty pFLAG into HeLa. Select cells by increasing the concentration of geneticin (G418) (1 &#181;g/mL) from 100 &#181;g/mL to 1000 &#181;g/mL, generating stable cell lines.</li>
	<li>Confirm overexpression with quantitative PCR using specific primers for HuR mRNA, as described in step 7.</li>
</ol>
4. Total RNA isolation
<ol>
	<li>Use freshly collected cells. Trypsinize 70% confluent cell cultures (for this assay, HeLa-Cre cells were used), as described in step 2.2.</li>
	<li>Collect the cell pellet by centrifugation for 5 min at 500 x g at 4 &#176;C and wash it with 1x PBS (phosphate-buffered saline); repeat the centrifugation.</li>
	<li>Resuspend the cell pellet in 1 mL of 1x PBS and transfer it to a 1.5 mL microcentrifuge tube.</li>
	<li>Centrifuge for 5 min at 500 x g at 4 &#176;C.</li>
	<li>Weigh the dry cell pellet, and adjust the volumes and size of tubes accordingly. 1 mg of cells yields approximately 1 &#181;g of total RNA.</li>
	<li>In a hood, add 500-1,000 &#181;L of phenol/chloroform to the cell pellet (ideally 750 &#181;L per 0.25 g of cells) and homogenize it by pipetting up and down and mixing with the vortex.</li>
	<li>Incubate the mixture for 5 min at room temperature (20 &#176;C to 25 &#176;C) to allow the complete dissociation of nucleoprotein complexes.</li>
	<li>Centrifuge the sample at 500 x g for 5 min at 4 &#176;C.</li>
	<li>Transfer the supernatant to a new 1.5 mL microcentrifuge tube and add 200 &#181;L of chloroform per 1 mL of phenol:chloroform used. Cap the sample tubes securely.</li>
	<li>Mix vigorously for 15 s (by hand or briefly vortexing at a lower speed) and incubate at room temperature (20 &#176;C to 25 &#176;C) for 2 min to 3 min.</li>
	<li>Centrifuge the samples at 12,000 x g for 15 min at 4 &#176;C.</li>
	<li>Check for the presence of a lower red phenol-chloroform phase, an intermediary phase, and a colorless upper aqueous phase. RNA remains in the upper aqueous phase. In a hood, collect the aqueous phase, avoiding contacting the intermediary phase, and transfer to a fresh tube.</li>
	<li>Precipitate RNA by mixing the aqueous phase with 400 &#181;L of molecular grade isopropanol (1:1 ratio to phenol/chloroform used) and 2 &#181;L of glycogen in each tube (it will help to visualize the presence of the pellet).</li>
	<li>Mix vigorously by hand or homogenize with the tip for ~10 s. Incubate for 15 min or overnight at &#8722;20 &#176;C.</li>
	<li>Centrifuge the sample at 12,000 x g for 20 min at 4 &#176;C and discard the supernatant.</li>
	<li>Wash the RNA pellet by adding 3 volumes of 100% ethanol (approximately 1 mL, diluted using DEPC water) and mix the sample by vortexing until the pellet is released and floats from the bottom.</li>
	<li>Centrifuge at 7,500 x g for 5 min at 4 &#176;C.</li>
	<li>Wash the RNA pellet 1x by adding 1 mL of 75% ethanol and mix the sample by vortexing until the pellet is released and floats from the bottom. Repeat the centrifugation as described in step 4.17.</li>
	<li>Perform an additional 5 s centrifugation spin to collect residual liquid from the side of the tube and remove any residual liquid with a pipette without disturbing the pellet.</li>
	<li>Briefly air-dry the RNA pellet by opening the cap of the tube at room temperature for 3-5 min and dissolve the RNA pellet in 20-50 &#181;L of RNase-free DEPC-treated water. Incubate the RNA for 10 min at 55-60 &#176;C to facilitate resuspension of the pellet.</li>
</ol>
5. Determination of total RNA concentration and quality
<ol>
	<li>Determine the RNA concentration by measuring the absorbance at 260 nm and 280 nm using a spectrophotometer. Obtain full-spectral data before using the samples in downstream applications.</li>
	<li>Control the RNA quality by resolving 800-1000 ng on a 1.5% agarose gel using 0.5X TBE buffer (45 mM Tris base, 45 mM boric acid, 1 mM EDTA). Total RNA separates into two bands referring to 28S and 18S rRNAs.
	<ol>
		<li>Make all reagents and wash all equipment used for running the gel with DEPC-treated water. DEPC-treated water is prepared in the hood by adding 1 mL of diethylpyrocarbonate to 1000 mL of ultra-pure water. Incubate for ~2 h at room temperature or at 37 &#176;C and autoclave. Store at room temperature for up to 10 months. 
		NOTE: Electrophoresis of mammalian total RNAs leads to the separation of 28S and 18S rRNAs at a ratio of approximately 2:1. The bands should be intact and visible as two sharp bands. Degraded RNA will result in blurry bands.</li>
	</ol>
	</li>
</ol>
6. Reverse transcription
<ol>
	<li>Set the reverse transcription reaction using 1 &#181;g of total RNA.</li>
	<li>Perform reverse transcription (RT) using reverse transcriptase enzyme (see Table of Materials) and 50 ng/&#181;L random decamer primers.
	<ol>
		<li>Mix RNA, random primers, and 1 mM dNTP mix (10 mM) in 10 &#181;L. Incubate at 65 &#176;C for 5 min and on ice for 1 min. Add the following reagents: 1x RT buffer, 5 mM MgCl2, 10 mM DTT, 40 U of RNase inhibitor, and 200 U of Reverse Transcriptase.</li>
		<li>Incubate for 10 min at 25 &#176;C and for 1 h at 50 &#176;C (temperatures may change if different enzymes are used). Terminate the reaction by incubating at 85 &#176;C for 5 min. cDNAs can be stored at &#8722;20 &#176;C.</li>
	</ol>
	</li>
</ol>
7. Quantitative PCR
<ol>
	<li>To assemble the reaction in a final volume of 15 &#181;L, mix 3 &#181;L of cDNA (100 ng/&#181;L), 3.2 pmol of each primer, 6 &#181;L of master mix containing the dNTPs and enzyme, and 2.8 &#181;L of ultrapure water. 
	NOTE: Use primers for endogenous constitutive genes as controls (housekeeping genes) to normalize the expression levels of HuR mRNA and miRNAs. &#946;-Actin and snRNA U6 (RNU6B) are available options for the normalization of mRNAs and miRNAs, respectively, but other genes might also be suitable depending on the case.</li>
	<li>Quantify the expression levels using the delta-delta Ct (2-&#916;&#916;Ct) method20.</li>
</ol>
8. The reporter assay
<ol>
	<li>Cells used for the assay
	<ol>
		<li>Transfect the plasmids in HeLa-Cre cells as follows. Transfect with pTK-Renilla (40 ng), then pRD-miR-17-92, generating HeLa-Cre-miR-17-92, and selecting with 1 &#181;g/mL puromycin.</li>
		<li>Transfect HeLa-Cre-miR-17-92-pTK-Renilla with pmiRGLO-RAP-IB-3&#697;-UTR or pmiRGLO-scrambled-3&#697;-UTR, separately. Select using penicillin (100 U/mL) and streptomycin (100 &#181;g/mL). These transfections generate Luc-RAP-1-B and Luc-scrambled.</li>
		<li>Transfect the cells with pFLAG-HuR or empty pFLAG (step 3).</li>
		<li>Proceed to cell culture, as detailed in step 2.2., with HeLa-Cre miR-17-92-luc, HeLa-Cre miR-17-92-scrambled, HeLa-Cre miR-17-92-HuR, and HeLa-Cre miR-17-92-HuR-luc until approximately 80% of confluence. Induce with 1 &#181;L of doxycycline (1 &#181;g/mL) for 30 min at 37 &#176;C. Also, keep all the cells without doxycycline as controls, for the same period. 
		NOTE: The final concentration of doxycycline depends on the cell line of choice. An excess of doxycycline can be toxic for mammalian cells.</li>
	</ol>
	</li>
	<li>Luminescent assay
	<ol>
		<li>To quantify and compare different luminescence intensities, use the Dual-luciferase reporter assay kit. Thaw luciferase assay solutions and leave them at room temperature before beginning the assay.</li>
		<li>Prepare the mix Stop and Glo (blue cap tubes) by mixing 200 &#181;L of the substrate in 10 mL of Luciferase Assay Buffer II. Prepare the mix LAR II (green cap tubes) by mixing 10 mL of Luciferase Assay Buffer II into the amber vial of Luciferase Assay Substrate II and shake well.</li>
		<li>Transfer the solutions to 15 mL centrifuge tubes previously identified and protected from light. 
		NOTE: As an alternative, the solutions can be previously prepared in 1-2 mL aliquots and frozen at &#8722;80 &#176;C protected from light in aluminum foil.</li>
		<li>Perform the luminescence readings using an equipment such as Synergy; measure expressed luciferase as relative light units (RLU).</li>
		<li>Export the results to a spreadsheet for further statistical analysis.</li>
		<li>Perform normalization of firefly-luciferase activity by the control Renilla (luciferase/Renilla) and plot that as relative light units (RLU) in a graphic. Repeat this for groups with and without doxycycline induction.</li>
		<li>Calculate the mean and standard error of the mean (SEM). Perform a Student&#39;s t-test or two-way ANOVA followed by Tukey&#39;s post-test to allow group comparison. These analyses are available in a package such as GraphPad Prism. Differences at p-values &#60; 0.05 are considered significant.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Wilkinson, M. E., Charenton, C., Nagai, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+splicing+by+the+spliceosome.">RNA splicing by the spliceosome.</a> Annual Review of Biochemistry. 89, 359-388 (2020).</li><li>Will, C. L., Luhrmann, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spliceosome+structure+and+function.">Spliceosome structure and function.</a> Cold Spring Harbor Perspectives in Biology. 3 (7), 003707 (2011).</li><li>Zhang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+atomic+structure+of+the+human+spliceosome.">An atomic structure of the human spliceosome.</a> Cell. 169 (5), 918-929 (2017).</li><li>Staley, J. P., Guthrie, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanical+devices+of+the+spliceosome:+Motors,+clocks,+springs,+and+things.">Mechanical devices of the spliceosome: Motors, clocks, springs, and things.</a> Cell. 92 (3), 315-326 (1998).</li><li>Kornblihtt, A. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+splicing:+a+pivotal+step+between+eukaryotic+transcription+and+translation.">Alternative splicing: a pivotal step between eukaryotic transcription and translation.</a> Nature Reviews Molecular Cell Biology. 14 (3), 153-165 (2013).</li><li>Wang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+complex+network+of+factors+with+overlapping+affinities+represses+splicing+through+intronic+elements.">A complex network of factors with overlapping affinities represses splicing through intronic elements.</a> Nature Structural &amp; Molecular Biology. 20 (1), 36-45 (2013).</li><li>Mukherjee, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+regulatory+mapping+indicates+that+the+RNA-binding+protein+HuR+couples+pre-mRNA+processing+and+mRNA+stability.">Integrative regulatory mapping indicates that the RNA-binding protein HuR couples pre-mRNA processing and mRNA stability.</a> Molecular Cell. 43 (3), 327-339 (2011).</li><li>Pandit, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+analysis+reveals+SR+protein+cooperation+and+competition+in+regulated+splicing.">Genome-wide analysis reveals SR protein cooperation and competition in regulated splicing.</a> Molecular Cell. 50 (2), 223-235 (2013).</li><li>Gatti da Silva, G. H., Dos Santos, M. G. P., Nagasse, H. Y., Coltri, P. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+antigen+R+(HuR)+facilitates+miR-19+synthesis+and+affects+cellular+kinetics+in+papillary+thyroid+cancer.">Human antigen R (HuR) facilitates miR-19 synthesis and affects cellular kinetics in papillary thyroid cancer.</a> Cellular Physiology and Biochemistry. 56, 105-119 (2022).</li><li>Westholm, J. O., Lai, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mirtrons:+MicroRNA+biogenesis+via+splicing.">Mirtrons: MicroRNA biogenesis via splicing.</a> Biochimie. 93 (11), 1897-1904 (2011).</li><li>Michlewski, G., C&#225;ceres, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Post-transcriptional+control+of+miRNA+biogenesis.">Post-transcriptional control of miRNA biogenesis.</a> RNA. 25 (1), 1-16 (2019).</li><li>Bartel, D. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNAs:+Target+recognition+and+regulatory+functions.">MicroRNAs: Target recognition and regulatory functions.</a> Cell. 136 (2), 215-233 (2009).</li><li>Esquela-Kerscher, A., Slack, F. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oncomirs+-+MicroRNAs+with+a+role+in+cancer.">Oncomirs - MicroRNAs with a role in cancer.</a> Nature Reviews Cancer. 6 (4), 259-269 (2006).</li><li>Lin, S., Gregory, R. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+biogenesis+pathways+in+cancer.">MicroRNA biogenesis pathways in cancer.</a> Nature Reviews Cancer. 15 (6), 321-333 (2015).</li><li>Curtis, H. J., Sibley, C. R., Wood, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mirtrons,+an+emerging+class+of+atypical+miRNA.">Mirtrons, an emerging class of atypical miRNA.</a> Wiley Interdisciplinary Reviews. RNA. 3 (5), 617-632 (2012).</li><li>Alarcon, C. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HNRNPA2B1+is+a+mediator+of+m(6)A-dependent+nuclear+RNA+processing+events.">HNRNPA2B1 is a mediator of m(6)A-dependent nuclear RNA processing events.</a> Cell. 162 (6), 1299-1308 (2015).</li><li>Paiva, M. M., Kimura, E. T., Coltri, P. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=miR18a+and+miR19a+recruit+specific+proteins+for+splicing+in+thyroid+cancer+cells.">miR18a and miR19a recruit specific proteins for splicing in thyroid cancer cells.</a> Cancer Genomics and Proteomics. 14 (5), 373-381 (2017).</li><li>He, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+microRNA+polycistron+as+a+potential+human+oncogene.">A microRNA polycistron as a potential human oncogene.</a> Nature. 435 (7043), 828-833 (2005).</li><li>Olive, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=miR-19+is+a+key+oncogenic+component+of+mir-17-92.">miR-19 is a key oncogenic component of mir-17-92.</a> Genes &amp; Development. 23 (24), 2839-2849 (2009).</li><li>Livak, K. J., Schmittgen, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+relative+gene+expression+data+using+real-time+quantitative+PCR+and+the+2(-Delta+Delta+C(T))+Method.">Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.</a> Methods. 25 (4), 402-408 (2001).</li><li>Khandelia, P., Yap, K., Makeyev, E. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Streamlined+platform+for+short+hairpin+RNA+interference+and+transgenesis+in+cultured+mammalian+cells.">Streamlined platform for short hairpin RNA interference and transgenesis in cultured mammalian cells.</a> Proceedings of the National Academy of Sciences of the United States of America. 108 (31), 12799-12804 (2011).</li><li>Huelga, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genome-wide+analysis+reveals+cooperative+regulation+of+alternative+splicing+by+hnRNP+proteins.">Integrative genome-wide analysis reveals cooperative regulation of alternative splicing by hnRNP proteins.</a> Cell Reports. 1 (2), 167-178 (2012).</li><li>Karni, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+gene+encoding+the+splicing+factor+SF2/ASF+is+a+proto-oncogene.">The gene encoding the splicing factor SF2/ASF is a proto-oncogene.</a> Nature Structural &amp; Molecular Biology. 14 (3), 185-193 (2007).</li><li>Franca, G. S., Vibranovski, M. D., Galante, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host+gene+constraints+and+genomic+context+impact+the+expression+and+evolution+of+human+microRNAs.">Host gene constraints and genomic context impact the expression and evolution of human microRNAs.</a> Nature Communications. 7, 11438 (2016).</li><li>Havens, M. A., Reich, A. A., Hastings, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drosha+promotes+splicing+of+a+pre-microRNA-like+alternative+exon.">Drosha promotes splicing of a pre-microRNA-like alternative exon.</a> PLoS Genetics. 10 (5), 1004312 (2014).</li><li>Grammatikakis, I., Abdelmohsen, K., Gorospe, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Posttranslational+control+of+HuR+function.">Posttranslational control of HuR function.</a> Wiley Interdisciplinary Reviews. RNA. 8 (1), (2017).</li><li>Chang, S. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ELAVL1+regulates+alternative+splicing+of+eIF4E+transporter+to+promote+postnatal+angiogenesis.">ELAVL1 regulates alternative splicing of eIF4E transporter to promote postnatal angiogenesis.</a> Proceedings of the National Academy of Sciences of the United States of America. 111 (51), 18309-18314 (2014).</li><li>Huang, Y. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delivery+of+therapeutics+targeting+the+mRNA-binding+protein+HuR+using+3DNA+nanocarriers+suppresses+ovarian+tumor+growth.">Delivery of therapeutics targeting the mRNA-binding protein HuR using 3DNA nanocarriers suppresses ovarian tumor growth.</a> Cancer Research. 76 (6), 1549-1559 (2016).</li><li>Wang, W., Caldwell, M. C., Lin, S., Furneaux, H., Gorospe, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HuR+regulates+cyclin+A+and+cyclin+B1+mRNA+stability+during+cell+proliferation.">HuR regulates cyclin A and cyclin B1 mRNA stability during cell proliferation.</a> The EMBO Journal. 19 (10), 2340-2350 (2000).</li><li>Guo, X., Connick, M. C., Vanderhoof, J., Ishak, M. A., Hartley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA-16+modulates+HuR+regulation+of+cyclin+E1+in+breast+cancer+cells.">MicroRNA-16 modulates HuR regulation of cyclin E1 in breast cancer cells.</a> International Journal of Molecular Sciences. 16 (4), 7112-7132 (2015).</li></ol>

The authors have no conflicts of interest.

Pre-mRNA splicing is an important process for gene expression regulation, and its control can trigger strong effects on cell phenotypic modifications22,23. More than 70% of miRNAs are transcribed from introns in humans, and we hypothesized that their processing and maturation could be facilitated by splicing regulatory proteins24,25. We developed a method to analyze intronic miRNA processing and function ...

Precursor mRNA splicing is an important process for gene expression regulation in eukaryotes1. The removal of introns and the union of exons in mature RNA is catalyzed by the spliceosome, a 2 megadalton ribonucleoprotein complex composed of 5 snRNAs (U1, U2, U4, U5, and U6) along with more than 100 proteins2,3. The splicing reaction occurs co-transcriptionally, and the spliceosome is assembled at each new intron guided by the recognition of conserved splice sites at exon-intron boundaries and within the intron4. Different introns might have different splicing rates despite the remarkable conservation of the spliceosome complex and its components. In addition to the differences in splice site conservation, regulatory sequences distributed on introns and exons can guide RNA-binding proteins (RBP) and stimulate or repress splicing5,6. HuR is a ubiquitously expressed RBP and is an important factor to control mRNA stability7. Previous results from our group showed that HuR can bind to introns containing miRNAs, indicating this protein might be an important factor to facilitate miRNA processing and maturation, also leading to the generation of alternative splicing isoforms6,8,9.
Many microRNAs (miRNAs) are coded from intronic sequences. Whereas some are part of the intron, others are known as "mirtrons" and are formed by the entire intron10,11. miRNAs are short non-coding RNAs, ranging from 18 to 24 nucleotides in length12. Their mature sequence shows partial or total complementarity with target sequences in mRNAs, therefore affecting translation and/or mRNA decay rates. The combinations of miRNAs and targets drive the cell to different outcomes. Several miRNAs can drive cells to pro- or anti-tumoral phenotypes13. Oncogenic miRNAs usually target mRNAs that trigger a suppressive characteristic, leading to increased cellular proliferation, migration, and invasion14. On the other hand, tumor-suppressive miRNAs might target oncogenic mRNAs or mRNAs related to increased cell proliferation. 
The processing and maturation of miRNAs are also dependent on their origin. Most intronic miRNAs are processed with the participation of the microprocessor, formed by the ribonuclease Drosha and protein co-factors12. Mirtrons are processed with the activity of the spliceosome independently of Drosha15. Considering the high frequency of miRNAs found within introns, we hypothesized that RNA-binding proteins involved with splicing could also facilitate the processing and maturation of these miRNAs. Notably, the RBP hnRNP A2/B1 has already been associated with the microprocessor and miRNA biogenesis16. 
We have previously reported that several RNA-binding proteins, such as hnRNPs and HuR, are associated with intronic miRNAs by mass spectrometry17. HuR's (ELAVL1) association with miRNAs from the miR-17-92 intronic cluster was confirmed using immunoprecipitation and in silico analysis9. miR-17-92 is an intronic miRNA cluster composed of six miRNAs with increased expression in different cancers18,19. This cluster is also known as "oncomiR-1" and is composed of miR-17, miR-18a, miR-19a, miR-20, miR-19b, and miR-92a. miR-19a and miR-19b are among the most oncogenic miRNAs of this cluster19. The increased expression of HuR stimulates miR-19a and miR-19b synthesis9. Since intronic regions flanking this cluster are associated with HuR, we developed a method to investigate if this protein could regulate miR-19a and miR-19b expression and maturation. One important prediction of our hypothesis was that, as a regulatory protein, HuR could facilitate miRNA biogenesis, leading to phenotypic alterations. One possibility was that miRNAs were processed by the stimulation of HuR but would not be mature and functional and, therefore, the effects of the protein would not directly impact the phenotype. Therefore, we developed a splicing reporter assay to investigate whether an RBP such as HuR could affect the biogenesis and maturation of an intronic miRNA. By confirming miRNA processing and maturation, our assay shows the interaction with the target sequence and the generation of a mature and functional miRNA. In our assay, we couple the expression of an intronic miRNA cluster with a luciferase plasmid to check for miRNA target-binding in cultured cells.

<table><tbody><tr><td>&lt;strong&gt;Recombinant DNA&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>pCAGGS-Cre (Cre- encoding plasmid)</td><td></td><td></td><td>A kind gift from E. Makeyev from Khandelia et al., 2011</td></tr><tr><td>pFLAG-HuR</td><td></td><td></td><td>Generated during this work</td></tr><tr><td>pmiRGLO-RAP-IB</td><td></td><td></td><td>Generated during this work</td></tr><tr><td>pmiRGLO-scrambled</td><td></td><td></td><td>Generated during this work</td></tr><tr><td>pRD-miR-17-92</td><td></td><td></td><td>Generated during this work</td></tr><tr><td>pRD-RIPE-donor</td><td></td><td></td><td>A kind gift from E. Makeyev from Khandelia et al., 2011</td></tr><tr><td>pTK-Renilla</td><td>Promega</td><td>E2241</td><td></td></tr><tr><td>&lt;strong&gt;Antibodies&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>anti-B-actin</td><td>Sigma Aldrich</td><td>A5316</td><td></td></tr><tr><td>anti-HuR</td><td>Cell Signaling</td><td>mAb&amp;nbsp;12582</td><td></td></tr><tr><td>IRDye 680CW Goat anti-mouse IgG</td><td>Li-Cor Biosciences</td><td>926-68070</td><td></td></tr><tr><td>IRDye 800CW Goat anti-rabbit IgG</td><td>Li-Cor Biosciences</td><td>929-70020</td><td></td></tr><tr><td>&lt;strong&gt;Experimental Models: Cell Lines&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>HeLa-Cre</td><td></td><td></td><td>A kind gift from E. Makeyev from Khandelia et al., 2011</td></tr><tr><td>HeLa-Cre miR17-92</td><td></td><td></td><td>Generated during this work</td></tr><tr><td>HeLa-Cre miR17-92-HuR</td><td></td><td></td><td>Generated during this work</td></tr><tr><td>HeLa-Cre miR17-92-HuR-luc</td><td></td><td></td><td>Generated during this work</td></tr><tr><td>HeLa-Cre miR17-92-luc</td><td></td><td></td><td>Generated during this work</td></tr><tr><td>HeLa-Cre miR17-92-scrambled</td><td></td><td></td><td>Generated during this work</td></tr><tr><td>&lt;strong&gt;Chemicals and Peptides&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>DMEM/high-glucose</td><td>Thermo Fisher Scientific</td><td>12800-017</td><td></td></tr><tr><td>Doxycycline</td><td>BioBasic</td><td>MB719150</td><td></td></tr><tr><td>Dual-Glo Luciferase Assay System</td><td>Promega</td><td>E2940</td><td></td></tr><tr><td>EcoRI</td><td>Thermo Fisher Scientific</td><td>ER0271</td><td></td></tr><tr><td>EcoRV</td><td>Thermo Fisher Scientific</td><td>ER0301</td><td></td></tr><tr><td>Geneticin</td><td>Thermo Fisher Scientific</td><td>E859-EG</td><td></td></tr><tr><td>L-glutamine</td><td>Life Technologies</td><td></td><td></td></tr><tr><td>Opti-MEM I</td><td>Life Technologies</td><td>31985-070</td><td></td></tr><tr><td>pFLAG-CMV&amp;trade;-3 Expression Vector</td><td>Sigma Aldrich</td><td>E6783</td><td></td></tr><tr><td>pGEM-T</td><td>Promega</td><td>A3600</td><td></td></tr><tr><td>Platinum Taq DNA polymerase</td><td>Thermo Fisher Scientific</td><td>10966-030</td><td></td></tr><tr><td>pmiR-GLO</td><td>Promega</td><td>E1330</td><td></td></tr><tr><td>Puromycin</td><td>Sigma Aldrich</td><td>P8833</td><td></td></tr><tr><td>RNAse OUT</td><td>Thermo Fisher Scientific</td><td>752899</td><td></td></tr><tr><td>SuperScript IV kit</td><td>Thermo Fisher Scientific</td><td>18091050</td><td></td></tr><tr><td>Trizol-LS reagent</td><td>Thermo Fisher</td><td>10296-028</td><td></td></tr><tr><td>trypsin/EDTA 10X</td><td>Life Technologies</td><td>15400-054</td><td></td></tr><tr><td>XbaI</td><td>Thermo Fisher Scientific</td><td>10131035</td><td></td></tr><tr><td>XhoI</td><td>Promega</td><td>R616A</td><td></td></tr><tr><td>&lt;strong&gt;Oligonucleotides&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>forward RAP-1B pmiRGLO</td><td>Exxtend</td><td>TCGAGTAGCGGCCGCTAGTAAG&lt;br/&gt; CTACTATATCAGTTTGCACAT</td><td></td></tr><tr><td>reverse RAP-1B pmiRGLO</td><td>Exxtend</td><td>CTAGATGTGCAAACTGATATAGT&lt;br/&gt; AGCTTACTAGCGGCCGCTAC</td><td></td></tr><tr><td>forward scrambled pmiRGLO</td><td>Exxtend</td><td>TCGAGTAGCGGCCGCTAGTAA&lt;br/&gt; GCTACTATATCAGGGGTAAAAT</td><td></td></tr><tr><td>reverse scrambled pmiRGLO</td><td>Exxtend</td><td>CTAGATTTTACCCCTGATATAGT&lt;br/&gt; AGCTTACTAGCGGCCGCTAC</td><td></td></tr><tr><td>forward HuR pFLAG</td><td>Exxtend</td><td>GCCGCGAATTCAATGTCTAAT&lt;br/&gt; GGTTATGAAGAC</td><td></td></tr><tr><td>reverse HuR pFLAG</td><td>Exxtend</td><td>GCGCTGATATCGTTATTTGTG&lt;br/&gt; GGACTTGTTGG</td><td></td></tr><tr><td>forward pre-miR-1792 pRD-RIPE</td><td>Exxtend</td><td>ATCCTCGAGAATTCCCATTAG&lt;br/&gt; GGATTATGCTGAG</td><td></td></tr><tr><td>reverse pre-miR-1792 pRD-RIPE</td><td>Exxtend</td><td>ACTAAGCTTGATATCATCTTG&lt;br/&gt; TACATTTAACAGTG</td><td></td></tr><tr><td>forward snRNA U6 (RNU6B)</td><td>Exxtend</td><td>CTCGCTTCGGCAGCACATATAC</td><td></td></tr><tr><td>reverse snRNA U6 (RNU6B)</td><td>Exxtend</td><td>GGAACGCTTCACGAATTTGCGTG</td><td></td></tr><tr><td>forward B-Actin qPCR</td><td>Exxtend</td><td>ACCTTCTACAATGAGCTGCG</td><td></td></tr><tr><td>reverse B-Actin qPCR</td><td>Exxtend</td><td>CCTGGATAGCAACGTACATGG</td><td></td></tr><tr><td>forward HuR qPCR</td><td>Exxtend</td><td>ATCCTCTGGCAGATGTTTGG</td><td></td></tr><tr><td>reverse HuR qPCR</td><td>Exxtend</td><td>CATCGCGGCTTCTTCATAGT</td><td></td></tr><tr><td>forward pre-miR-1792 qPCR</td><td>Exxtend</td><td>GTGCTCGAGACGAATTCGTCA&lt;br/&gt; GAATAATGTCAAAGTG</td><td></td></tr><tr><td>reverse pre-miR-1792 qPCR</td><td>Exxtend</td><td>TCCAAGCTTAAGATATCCCAAAC&lt;br/&gt; TCAACAGGCCG</td><td></td></tr><tr><td>&lt;strong&gt;Software and Algorithms&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>Prism 8 for Mac OS X</td><td>Graphpad</td><td>https://www.graphpad.com</td><td></td></tr><tr><td>ImageJ</td><td>National Institutes of Health</td><td>http://imagej.nih.gov/ij</td><td></td></tr></tbody></table>

a reporter assay to analyze intronic microrna maturation in mammalian cells

MicroRNAs (miRNAs) are short RNA molecules that are widespread in eukaryotes. Most miRNAs are transcribed from introns, and their maturation involves different RNA-binding proteins in the nucleus. Mature miRNAs frequently mediate gene silencing, and this has become an important tool for comprehending post-transcriptional events. Besides that, it can be explored as a promising methodology for gene therapies. However, there is currently a lack of direct methods for assessing miRNA expression in mammalian cell cultures. Here, we describe an efficient and simple method that aids in determining miRNA biogenesis and maturation through confirmation of its interaction with target sequences. Also, this system allows the separation of exogenous miRNA maturation from its endogenous activity using a doxycycline-inducible promoter capable of controlling primary miRNA (pri-miRNA) transcription with high efficiency and low cost. This tool also allows modulation with RNA-binding proteins in a separate plasmid. In addition to its use with a variety of different miRNAs and their respective targets, it can be adapted to different cell lines, provided these are amenable to transfection.

Our initial hypothesis was that HuR could facilitate intronic miRNA biogenesis by binding to its pre-miRNA sequence. Thus, the connection of HuR expression and miR-17-92 cluster biogenesis could point to a new mechanism governing the maturation of these miRNAs. Overexpression of HuR upon transfection of pFLAG-HuR was confirmed in three different cell lines: HeLa, BCPAP, and HEK-293T (Figure 2). As controls, untransfected cells and cells transfected with empty pFLAG vectors were used...

Watch this Scientific Journal Video about A Reporter Assay to Analyze Intronic microRNA Maturation in Mammalian Cells at JoVE.com

A Reporter Assay to Analyze Intronic microRNA Maturation in Mammalian Cells

We developed an intronic microRNA biogenesis reporter assay to be used in cells in vitro with four plasmids: one with intronic miRNA, one with the target, one to overexpress a regulatory protein, and one for Renilla luciferase. The miRNA was processed and could control luciferase expression by binding to the target sequence.

MicroRNAs (miRNAs) are short RNA molecules that are widespread in eukaryotes. Most miRNAs are transcribed from introns, and their maturation involves ...

a-reporter-assay-to-analyze-intronic-microrna-maturation-mammalian

Research

JoVE Journal

Cancer Research

1.9K Views.  Universidade de São Paulo. Ons protocol richt zich op de effecten van regulerende RNA-bindende eiwitten op microRNA-biogenese en rijping, rechtstreeks uit celculturen. De methode die we beschrijven kan worden uitgevoerd met gemeenschappelijke celkweekreagentia en is relatief snel. Deze methode kan belangrijk zijn om de fenotypische effecten van microRNA's en hun doelwitten in verschillende soorten eukaryote cellen te bestuderen.Normale of ziekte-achtige cellen kunnen worden gebruikt. Het is belangrijk om cellijn...

Video: A Reporter Assay to Analyze Intronic microRNA Maturation in Mammalian Cells

Differentiation of a Human Neural Stem Cell Line on Three Dimensional Cultures, Analysis of MicroRNA and Putative Target Genes

Neural stem cells (NSCs) are capable of self-renewal and differentiation into neurons, astrocytes and oligodendrocytes under specific local microenvironments. In here, we present a set of methods used for three dimensional (3D) differentiation and miRNA analysis of a clonal human neural stem cell (hNSC) line, currently in clinical trials for stroke disability (NCT01151124 and NCT02117635, Clinicaltrials.gov). HNSCs were derived from an ethical approved first trimester human fetal cortex and conditionally immortalized using retroviral integration of a single copy of the c-mycERTAMconstruct. We describe how to measure axon process outgrowth of hNSCs differentiated on 3D scaffolds and how to quantify associated changes in miRNA expression using PCR array. Furthermore we exemplify computational analysis with the aim of selecting miRNA putative targets. SOX5 and NR4A3 were identified as suitable miRNA putative target of selected significantly down-regulated miRNAs in differentiated hNSC. MiRNA target validation was performed on SOX5 and NR4A3 3&#8217;UTRs by dual reporter plasmid transfection and dual luciferase assay.

With the intent of characterizing changes in miRNAs on differentiated human neural stem cells (hNSCs) we describe hNSC differentiation on a three dimensional system,the evaluation of changes in microRNA expression by miRNA PCR array, and computational analysis for miRNA target prediction and its validation by dual luciferase assay.

Neural stem cells (NSCs) are capable of self-renewal and differentiation into neurons, astrocytes and oligodendrocytes under specific local ...

Developmental Biology

Biotin-based Pulldown Assay to Validate mRNA Targets of Cellular miRNAs

MicroRNAs (miRNAs) are a class of small noncoding RNAs that post-transcriptionally regulate cellular gene expression. MiRNAs bind to the 3&#39; untranslated region (UTR) of target mRNA to inhibit protein translation or in some instances cause mRNA degradation. The binding of the miRNA to the 3&#39; UTR of the target mRNA is mediated by a 2&#8211;8 nucleotide seed sequence at the 5&#39; end of miRNA. While the role of miRNAs as cellular regulatory molecules is well established, identification of the target mRNAs with functional relevance remains a challenge. Bioinformatic tools have been employed to predict sequences within the 3&#39; UTR of mRNAs as potential targets for miRNA binding. These tools have also been utilized to determine the evolutionary conservation of such sequences among related species in an attempt to predict functional role. However, these computational methods often generate false positive results and are limited to predicting canonical interaction between miRNA and mRNA. Therefore, experimental procedures that measure direct binding of miRNA to its mRNA target are necessary to establish functional interaction. In this report, we describe a sensitive method for validating direct interaction between the cellular miRNA miR-125b and the 3&#39; UTR of PARP-1 mRNA. We elaborate a protocol in which synthetic biotinylated-miRNA mimics were transfected into mammalian cells and the miRNA-mRNA complex in the cellular lysate was pulled down with streptavidin-coated magnetic beads. Finally, the target mRNA in the pulled-down nucleic acid complex was quantified using a qPCR-based strategy.

This report describes a fast and reliable method for validating mRNA targets of cellular miRNAs. The method uses synthetic biotinylated Locked Nucleic Acid (LNA)-based miRNA mimics to capture target mRNA. Subsequently, streptavidin-coated magnetic beads are employed to pulldown the target mRNA for quantification by qPCR polymerase chain reaction.

MicroRNAs (miRNAs) are a class of small noncoding RNAs that post-transcriptionally regulate cellular gene expression. MiRNAs bind to the 3&#39; ...

Genetics

Tissue-specific miRNA Expression Profiling in Mouse Heart Sections Using In Situ Hybridization

micro-RNAs (miRNAs) are single-stranded RNA transcripts that bind to messenger RNAs (mRNAs) and inhibit their translation or promote their degradation. To date, miRNAs have been implicated in a large number of biological and disease processes, which has signified the need for the reliable detection methods of miRNA transcripts. Here, we describe a detailed protocol for digoxigenin-labeled (DIG) Locked Nucleic Acid (LNA) probe-based miRNA detection, combined with protein immunostaining on mouse heart sections. First, we performed an in situ hybridization technique using the probe to identify miRNA-182 expression in heart sections from control and cardiac hypertrophy mice. Next, we performed immunostaining for cardiac Troponin T (cTnT) protein, on the same sections, to co-localize miRNA-182 with the cardiomyocyte cells. Using this protocol, we were able to detect miRNA-182 through an alkaline phosphatase based colorimetric assay, and cTnT through fluorescent staining. This protocol can be used to detect the expression of any miRNA of interest through DIG-labeled LNA probes, and relevant protein expression on mouse heart tissue sections.

Tissue-specific miRNA Expression Profiling in Mouse Heart Sections Using In Situ Hybridization

micro-RNAs (miRNAs) are short and highly homologous RNA sequences, serving as post-transcriptional regulators of messenger RNAs (mRNAs). Current miRNA detection methods vary in sensitivity and specificity. We describe a protocol that combines in situ hybridization and immunostaining for concurrent detection of miRNA and protein molecules on mouse heart tissue sections.

micro-RNAs (miRNAs) are single-stranded RNA transcripts that bind to messenger RNAs (mRNAs) and inhibit their translation or promote their degradation. To ...

An In Vitro Protocol for Evaluating MicroRNA Levels, Functions, and Associated Target Genes in Tumor Cells

MicroRNAs (miRNAs) are small regulatory RNAs which are recognized to modulate numerous intracellular signaling pathways in several diseases including cancers. These small regulatory RNAs mainly interact with the 3&#8217; untranslated regions (3&#8217; UTR) of their target messenger RNAs (mRNAs) ultimately resulting in the inhibition of decoding processes of mRNAs and the augmentation of target mRNA degradations. Based on the expression levels and intracellular functions, miRNAs are able to serve as regulatory factors of oncogenic and tumor-suppressive mRNAs. Identification of bona fide target genes of a miRNA among hundreds or even thousands of computationally predicted targets is a crucial step to discern the roles and basic molecular mechanisms of a miRNA of interest. Various miRNA target prediction programs are available to search possible miRNA-mRNA interactions. However, the most challenging question is how to validate direct target genes of a miRNA of interest. This protocol describes a reproducible strategy of key methods on how to identify miRNA targets related to the function of a miRNA. This protocol presents a practical guide on step-by-step procedures to uncover miRNA levels, functions, and related target mRNAs using the probe-based real-time polymerase chain reaction (PCR), sulforhodamine B (SRB) assay following a miRNA mimic transfection, dose-response curve generation, and luciferase assay along with the cloning of 3&#8217; UTR of a gene, which is necessary for proper understanding of the roles of individual miRNAs.

This protocol uses a probe-based real-time polymerase chain reaction (PCR), a sulforhodamine B (SRB) assay, 3&#8217; untranslated regions (3&#8217; UTR) cloning, and a luciferase assay to verify the target genes of a miRNA of interest and to understand the functions of miRNAs.

MicroRNAs (miRNAs) are small regulatory RNAs which are recognized to modulate numerous intracellular signaling pathways in several diseases including ...

A Reporter Based Cellular Assay for Monitoring Splicing Efficiency

During gene expression, the vital step of pre-mRNA splicing involves accurate recognition of splice sites and efficient assembly of spliceosomal complexes to join exons and remove introns prior to cytoplasmic export of the mature mRNA. Splicing efficiency can be altered by the presence of mutations at splice sites, the influence of trans-acting splicing factors, or the activity of therapeutics. Here, we describe the protocol for a cellular assay that can be applied for monitoring the splicing efficiency of any given exon. The assay uses an adaptable plasmid encoded 3-exon/2-intron minigene reporter, which can be expressed in mammalian cells by transient transfection. Post-transfection, total cellular RNA is isolated, and the efficiency of exon splicing in the reporter mRNA is determined by either primer extension or semi-quantitative reverse transcriptase-polymerase chain reaction (RT-PCR). We describe how the impact of disease associated 5&#8242; splice-site mutations can be determined by introducing them in the reporter; and how the suppression of these mutations can be achieved by co-transfection with U1 small nuclear RNA (snRNA) construct carrying compensatory mutations in its 5&#8242; region that basepairs with the 5&#8242;-splice sites at exon-intron junctions in pre-mRNAs. Thus, the reporter can be used for the design of therapeutic U1 particles to improve recognition of mutant 5&#8242; splice-sites. Insertion of cis-acting&#160;regulatory sites, such as splicing enhancer or silencer sequences, into the reporter can also be used to examine the role of U1 snRNP in regulation mediated by a specific alternative splicing factor. Finally, reporter expressing cells can be incubated with small molecules to determine the effect of potential therapeutics on constitutive pre-mRNA splicing or on exons carrying mutant 5&#8242; splice sites. Overall, the reporter assay can be applied to monitor splicing efficiency in a variety of conditions to study fundamental splicing mechanisms and splicing-associated diseases.

This protocol describes a minigene reporter assay to monitor the impact of 5&#180;-splice site mutations on splicing and develops suppressor U1 snRNA for the rescue of mutation-induced splicing inhibition. The reporter and suppressor U1 snRNA constructs are expressed in HeLa cells, and splicing is analyzed by primer extension or RT-PCR.

During gene expression, the vital step of pre-mRNA splicing involves accurate recognition of splice sites and efficient assembly of spliceosomal complexes ...

Biochemistry

Defining the Program of Maternal mRNA Translation during In vitro Maturation using a Single Oocyte Reporter Assay

Events associated with oocyte nuclear maturation have been well described. However, much less is known about the molecular pathways and processes that take place in the cytoplasm in preparation for fertilization and acquisition of totipotency. During oocyte maturation, changes in gene expression depend exclusively on the translation and degradation of maternal messenger RNAs (mRNAs) rather than on transcription. Execution of the translational program, therefore, plays a key role in establishing oocyte developmental competence to sustain embryo development. This paper is part of a focus on defining the program of maternal mRNA translation that takes place during meiotic maturation and at the oocyte-to-zygote transition. In this method paper, a strategy is presented to study the regulation of translation of target mRNAs during in vitro oocyte maturation. Here, a Ypet reporter is fused to the 3&#39; untranslated region (UTR) of the gene of interest and then micro-injected into oocytes together with polyadenylated mRNA encoding for mCherry to control for injected volume. By using time-lapse microscopy to measure reporter accumulation, translation rates are calculated at different transitions during oocyte meiotic maturation. Here, the protocols for oocyte isolation and injection, time-lapse recording, and data analysis have been described, using the Ypet/interleukin-7 (IL-7)-3&#39; UTR reporter as an example.

This protocol describes a reporter assay to study the regulation of mRNA translation in single oocytes during in vitro maturation.

Events associated with oocyte nuclear maturation have been well described. However, much less is known about the molecular pathways and processes that ...

Profiling of Pre-micro RNAs and microRNAs using Quantitative Real-time PCR (qPCR) Arrays

Quantitative real-time PCR (QPCR) has emerged as an accurate and valuable tool in profiling gene expression levels.  One of its many advantages is a lower detection limit compared to other methods of gene expression profiling while using smaller amounts of input for each assay.  Automated qPCR setup has improved this field by allowing for greater reproducibility.  Its convenient and rapid setup allows for high-throughput experiments, enabling the profiling of many different genes simultaneously in each experiment.  This method along with internal plate controls also reduces experimental variables common to other techniques.  
We recently developed a qPCR assay for profiling of pre-microRNAs  (pre-miRNAs) using a set of 186 primer pairs.  MicroRNAs have emerged as a novel class of small, non-coding RNAs with the ability to regulate many mRNA targets at the post-transcriptional level.  These small RNAs are first transcribed by RNA polymerase II as a primary miRNA (pri-miRNA) transcript, which is then cleaved into the precursor miRNA (pre-miRNA).  Pre-miRNAs are exported to the cytoplasm where Dicer cleaves the hairpin loop to yield mature miRNAs.  Increases in miRNA levels can be observed at both the precursor and mature miRNA levels and profiling of both of these forms can be useful.  There are several commercially available assays for mature miRNAs; however, their high cost may deter researchers from this profiling technique.  Here, we discuss a cost-effective, reliable, SYBR-based qPCR method of profiling pre-miRNAs.  Changes in pre-miRNA levels often reflect mature miRNA changes and can be a useful indicator of mature miRNA expression.  However, simultaneous profiling of both pre-miRNAs and mature miRNAs may be optimal as they can contribute nonredundant information and provide insight into microRNA processing.  Furthermore, the technique described here can be expanded to encompass the profiling of other library sets for specific pathways or pathogens.

Profiling of Pre-micro RNAs and microRNAs using Quantitative Real-time PCR qPCR Arrays

We will demonstrate the setup and analysis of pre-microRNA 96-well arrays for QPCR using a robot as well as by hand with a Thermo Scientific Matrix multichannel pipette.

Quantitative real-time PCR (QPCR) has emerged as an accurate and valuable tool in profiling gene expression levels.  One of its many advantages is a lower ...

Biology

Analysis of mRNA Nuclear Export Kinetics in Mammalian Cells by Microinjection

In eukaryotes, messenger RNA (mRNA) is transcribed in the nucleus and must be exported into the cytoplasm to access the translation machinery. Although the nuclear export of mRNA has been studied extensively in Xenopus oocytes1 and genetically tractable organisms such as yeast2 and the Drosophila derived S2 cell line3, few studies had been conducted in mammalian cells. Furthermore the kinetics of mRNA export in mammalian somatic cells could only be inferred indirectly4,5. In order to measure the nuclear export kinetics of mRNA in mammalian tissue culture cells, we have developed an assay that employs the power of microinjection coupled with fluorescent in situ hybridization (FISH). These assays have been used to demonstrate that in mammalian cells, the majority of mRNAs are exported in a splicing dependent manner6,7, or in manner that requires specific RNA sequences such as the signal sequence coding region (SSCR) 6. In this assay, cells are microinjected with either in vitro synthesized mRNA or plasmid DNA containing the gene of interest. The microinjected cells are incubated for various time points then fixed and the sub-cellular localization of RNA is assessed using FISH. In contrast to transfection, where transcription occurs several hours after the addition of nucleic acids, microinjection of DNA or mRNA allows for rapid expression and allows for the generation of precise kinetic data.

Here we describe an assay that employs the power of microinjection coupled with fluorescent in situ hybridization in order to accurately measure the nuclear export kinetics of mRNA in mammalian somatic cells.

In eukaryotes, messenger RNA (mRNA) is transcribed in the nucleus and must be exported into the cytoplasm to access the translation machinery. Although ...

Identifying Targets of Human microRNAs with the LightSwitch Luciferase Assay System using 3'UTR-reporter Constructs and a microRNA Mimic in Adherent Cells

MicroRNAs (miRNAs) are important regulators of gene expression and play a role in many biological processes. More than 700 human miRNAs have been identified so far with each having up to hundreds of unique target mRNAs. Computational tools, expression and proteomics assays, and chromatin-immunoprecipitation-based techniques provide important clues for identifying mRNAs that are direct targets of a particular miRNA. In addition, 3'UTR-reporter assays have become an important component of thorough miRNA target studies because they provide functional evidence for and quantitate the effects of specific miRNA-3'UTR interactions in a cell-based system. To enable more researchers to leverage 3'UTR-reporter assays and to support the scale-up of such assays to high-throughput levels, we have created a genome-wide collection of human 3'UTR luciferase reporters in the highly-optimized LightSwitch Luciferase Assay System. The system also includes synthetic miRNA target reporter constructs for use as positive controls, various endogenous 3'UTR reporter constructs, and a series of standardized experimental protocols.
Here we describe a method for co-transfection of individual 3'UTR-reporter constructs along with a miRNA mimic that is efficient, reproducible, and amenable to high-throughput analysis.

MicroRNAs (miRNAs) are important regulators of gene expression and have been shown to play a role in numerous biological processes. To better understand miRNA-UTR interactions, we have created a genome-wide collection of 3 UTR luciferase reporters paired with a novel luciferase gene and assay reagent, the LightSwitch system.

MicroRNAs (miRNAs) are important regulators of gene expression and play a role in many biological processes.  More than 700 human miRNAs have been ...

Oct4GiP Reporter Assay to Study Genes that Regulate Mouse Embryonic Stem Cell Maintenance and Self-renewal

Pluripotency and self-renewal are two defining characteristics of embryonic stem cells (ES cells). Understanding the underlying molecular mechanism will greatly facilitate the use of ES cells for developmental biology studies, disease modeling, drug discovery, and regenerative medicine (reviewed in 1,2).
To expedite the identification and characterization of novel regulators of ES cell maintenance and self-renewal, we developed a fluorescence reporter-based assay to quantitatively measure the self-renewal status in mouse ES cells using the Oct4GiP cells 3. The Oct4GiP cells express the green fluorescent protein (GFP) under the control of the Oct4 gene promoter region 4,5. Oct4 is required for ES cell self-renewal, and is highly expressed in ES cells and quickly down-regulated during differentiation 6,7. As a result, GFP expression and fluorescence in the reporter cells correlates faithfully with the ES cell identity 5, and fluorescence-activated cell sorting (FACS) analysis can be used to closely monitor the self-renewal status of the cells at the single cell level 3,8.
Coupled with RNAi, the Oct4GiP reporter assay can be used to quickly identify and study regulators of ES cell maintenance and self-renewal 3,8. Compared to other methods for assaying self-renewal, it is more convenient, sensitive, quantitative, and of lower cost. It can be carried out in 96- or 384-well plates for large-scale studies such as high-throughput screens or genetic epistasis analysis. Finally, by using other lineage-specific reporter ES cell lines, the assay we describe here can also be modified to study fate specification during ES cell differentiation.

We describe a fluorescence reporter assay to quickly identify and characterize genes that regulate mouse embryonic stem cell maintenance and self-renewal.

Pluripotency and self-renewal are two defining characteristics of embryonic stem cells (ES cells). Understanding the underlying molecular mechanism will ...

A Reporter Assay to Analyze Intronic microRNA Maturation in Mammalian Cells

Samenvatting

Meer video's verkennen