Name: a reporter assay to analyze intronic microrna maturation in mammalian cells
Uploaded: 2022-06-16T12:50:00
Description: Watch this Scientific Journal Video about A Reporter Assay to Analyze Intronic microRNA Maturation in Mammalian Cells at JoVE.com

The authors are grateful to E. Makeyev (Nanyang Technological University, Singapore) for the HeLa-Cre cells and pRD-RIPE and pCAGGS-Cre plasmids. We thank Edna Kimura, Carolina Purcell Goes, Gisela Ramos, Lucia Rossetti Lopes, and Anselmo Moriscot for their support.

An overview of the protocol described here is depicted in Figure 1.
1. Plasmid construction
<ol>
	<li>pCAGGS-Cre: This plasmid was provided by Dr. E. Makeyev21.</li>
	<li>pRD-miR-17-92:
	<ol>
		<li>Amplify pre-miR-17-92 by PCR using 0.5 &#181;M of each specific primer (Table of Materials), 150 ng of cDNA, 1 mM dNTPs, 1x Taq PCR buffer, and 5 U of high-fidelity Taq DNA polymerase. Perform a no-tem...

<ol>
	<li>Wilkinson, M. E., Charenton, C., Nagai, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+splicing+by+the+spliceosome.">RNA splicing by the spliceosome.</a> Annual Review of Biochemistry. 89, 359-388 (2020).</li><li>Will, C. L., Luhrmann, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spliceosome+structure+and+function.">Spliceosome structure and function.</a> Cold Spring Harbor Perspectives in Biology. 3 (7), 003707 (2011).</li><li>Zhang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+atomic+structure+of+the+human+spliceosome.">An atomic structure of the human spliceosome.</a> Cell. 169 (5), 918-929 (2017).</li><li>Staley, J. P., Guthrie, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanical+devices+of+the+spliceosome:+Motors,+clocks,+springs,+and+things.">Mechanical devices of the spliceosome: Motors, clocks, springs, and things.</a> Cell. 92 (3), 315-326 (1998).</li><li>Kornblihtt, A. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+splicing:+a+pivotal+step+between+eukaryotic+transcription+and+translation.">Alternative splicing: a pivotal step between eukaryotic transcription and translation.</a> Nature Reviews Molecular Cell Biology. 14 (3), 153-165 (2013).</li><li>Wang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+complex+network+of+factors+with+overlapping+affinities+represses+splicing+through+intronic+elements.">A complex network of factors with overlapping affinities represses splicing through intronic elements.</a> Nature Structural &amp; Molecular Biology. 20 (1), 36-45 (2013).</li><li>Mukherjee, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+regulatory+mapping+indicates+that+the+RNA-binding+protein+HuR+couples+pre-mRNA+processing+and+mRNA+stability.">Integrative regulatory mapping indicates that the RNA-binding protein HuR couples pre-mRNA processing and mRNA stability.</a> Molecular Cell. 43 (3), 327-339 (2011).</li><li>Pandit, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+analysis+reveals+SR+protein+cooperation+and+competition+in+regulated+splicing.">Genome-wide analysis reveals SR protein cooperation and competition in regulated splicing.</a> Molecular Cell. 50 (2), 223-235 (2013).</li><li>Gatti da Silva, G. H., Dos Santos, M. G. P., Nagasse, H. Y., Coltri, P. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+antigen+R+(HuR)+facilitates+miR-19+synthesis+and+affects+cellular+kinetics+in+papillary+thyroid+cancer.">Human antigen R (HuR) facilitates miR-19 synthesis and affects cellular kinetics in papillary thyroid cancer.</a> Cellular Physiology and Biochemistry. 56, 105-119 (2022).</li><li>Westholm, J. O., Lai, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mirtrons:+MicroRNA+biogenesis+via+splicing.">Mirtrons: MicroRNA biogenesis via splicing.</a> Biochimie. 93 (11), 1897-1904 (2011).</li><li>Michlewski, G., C&#225;ceres, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Post-transcriptional+control+of+miRNA+biogenesis.">Post-transcriptional control of miRNA biogenesis.</a> RNA. 25 (1), 1-16 (2019).</li><li>Bartel, D. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNAs:+Target+recognition+and+regulatory+functions.">MicroRNAs: Target recognition and regulatory functions.</a> Cell. 136 (2), 215-233 (2009).</li><li>Esquela-Kerscher, A., Slack, F. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oncomirs+-+MicroRNAs+with+a+role+in+cancer.">Oncomirs - MicroRNAs with a role in cancer.</a> Nature Reviews Cancer. 6 (4), 259-269 (2006).</li><li>Lin, S., Gregory, R. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+biogenesis+pathways+in+cancer.">MicroRNA biogenesis pathways in cancer.</a> Nature Reviews Cancer. 15 (6), 321-333 (2015).</li><li>Curtis, H. J., Sibley, C. R., Wood, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mirtrons,+an+emerging+class+of+atypical+miRNA.">Mirtrons, an emerging class of atypical miRNA.</a> Wiley Interdisciplinary Reviews. RNA. 3 (5), 617-632 (2012).</li><li>Alarcon, C. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HNRNPA2B1+is+a+mediator+of+m(6)A-dependent+nuclear+RNA+processing+events.">HNRNPA2B1 is a mediator of m(6)A-dependent nuclear RNA processing events.</a> Cell. 162 (6), 1299-1308 (2015).</li><li>Paiva, M. M., Kimura, E. T., Coltri, P. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=miR18a+and+miR19a+recruit+specific+proteins+for+splicing+in+thyroid+cancer+cells.">miR18a and miR19a recruit specific proteins for splicing in thyroid cancer cells.</a> Cancer Genomics and Proteomics. 14 (5), 373-381 (2017).</li><li>He, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+microRNA+polycistron+as+a+potential+human+oncogene.">A microRNA polycistron as a potential human oncogene.</a> Nature. 435 (7043), 828-833 (2005).</li><li>Olive, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=miR-19+is+a+key+oncogenic+component+of+mir-17-92.">miR-19 is a key oncogenic component of mir-17-92.</a> Genes &amp; Development. 23 (24), 2839-2849 (2009).</li><li>Livak, K. J., Schmittgen, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+relative+gene+expression+data+using+real-time+quantitative+PCR+and+the+2(-Delta+Delta+C(T))+Method.">Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.</a> Methods. 25 (4), 402-408 (2001).</li><li>Khandelia, P., Yap, K., Makeyev, E. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Streamlined+platform+for+short+hairpin+RNA+interference+and+transgenesis+in+cultured+mammalian+cells.">Streamlined platform for short hairpin RNA interference and transgenesis in cultured mammalian cells.</a> Proceedings of the National Academy of Sciences of the United States of America. 108 (31), 12799-12804 (2011).</li><li>Huelga, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genome-wide+analysis+reveals+cooperative+regulation+of+alternative+splicing+by+hnRNP+proteins.">Integrative genome-wide analysis reveals cooperative regulation of alternative splicing by hnRNP proteins.</a> Cell Reports. 1 (2), 167-178 (2012).</li><li>Karni, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+gene+encoding+the+splicing+factor+SF2/ASF+is+a+proto-oncogene.">The gene encoding the splicing factor SF2/ASF is a proto-oncogene.</a> Nature Structural &amp; Molecular Biology. 14 (3), 185-193 (2007).</li><li>Franca, G. S., Vibranovski, M. D., Galante, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host+gene+constraints+and+genomic+context+impact+the+expression+and+evolution+of+human+microRNAs.">Host gene constraints and genomic context impact the expression and evolution of human microRNAs.</a> Nature Communications. 7, 11438 (2016).</li><li>Havens, M. A., Reich, A. A., Hastings, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drosha+promotes+splicing+of+a+pre-microRNA-like+alternative+exon.">Drosha promotes splicing of a pre-microRNA-like alternative exon.</a> PLoS Genetics. 10 (5), 1004312 (2014).</li><li>Grammatikakis, I., Abdelmohsen, K., Gorospe, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Posttranslational+control+of+HuR+function.">Posttranslational control of HuR function.</a> Wiley Interdisciplinary Reviews. RNA. 8 (1), (2017).</li><li>Chang, S. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ELAVL1+regulates+alternative+splicing+of+eIF4E+transporter+to+promote+postnatal+angiogenesis.">ELAVL1 regulates alternative splicing of eIF4E transporter to promote postnatal angiogenesis.</a> Proceedings of the National Academy of Sciences of the United States of America. 111 (51), 18309-18314 (2014).</li><li>Huang, Y. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delivery+of+therapeutics+targeting+the+mRNA-binding+protein+HuR+using+3DNA+nanocarriers+suppresses+ovarian+tumor+growth.">Delivery of therapeutics targeting the mRNA-binding protein HuR using 3DNA nanocarriers suppresses ovarian tumor growth.</a> Cancer Research. 76 (6), 1549-1559 (2016).</li><li>Wang, W., Caldwell, M. C., Lin, S., Furneaux, H., Gorospe, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HuR+regulates+cyclin+A+and+cyclin+B1+mRNA+stability+during+cell+proliferation.">HuR regulates cyclin A and cyclin B1 mRNA stability during cell proliferation.</a> The EMBO Journal. 19 (10), 2340-2350 (2000).</li><li>Guo, X., Connick, M. C., Vanderhoof, J., Ishak, M. A., Hartley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA-16+modulates+HuR+regulation+of+cyclin+E1+in+breast+cancer+cells.">MicroRNA-16 modulates HuR regulation of cyclin E1 in breast cancer cells.</a> International Journal of Molecular Sciences. 16 (4), 7112-7132 (2015).</li></ol>

Pre-mRNA splicing is an important process for gene expression regulation, and its control can trigger strong effects on cell phenotypic modifications22,23. More than 70% of miRNAs are transcribed from introns in humans, and we hypothesized that their processing and maturation could be facilitated by splicing regulatory proteins24,25. We developed a method to analyze intronic miRNA processing and function ...

Precursor mRNA splicing is an important process for gene expression regulation in eukaryotes1. The removal of introns and the union of exons in mature RNA is catalyzed by the spliceosome, a 2 megadalton ribonucleoprotein complex composed of 5 snRNAs (U1, U2, U4, U5, and U6) along with more than 100 proteins2,3. The splicing reaction occurs co-transcriptionally, and the spliceosome is assembled at each new intron guided by the recognition of conserved splice sites at exon-intron boundaries and within the intron4. Different introns might have different splicing rates despite the remarkable conservation of the spliceosome complex and its components. In addition to the differences in splice site conservation, regulatory sequences distributed on introns and exons can guide RNA-binding proteins (RBP) and stimulate or repress splicing5,6. HuR is a ubiquitously expressed RBP and is an important factor to control mRNA stability7. Previous results from our group showed that HuR can bind to introns containing miRNAs, indicating this protein might be an important factor to facilitate miRNA processing and maturation, also leading to the generation of alternative splicing isoforms6,8,9.
Many microRNAs (miRNAs) are coded from intronic sequences. Whereas some are part of the intron, others are known as "mirtrons" and are formed by the entire intron10,11. miRNAs are short non-coding RNAs, ranging from 18 to 24 nucleotides in length12. Their mature sequence shows partial or total complementarity with target sequences in mRNAs, therefore affecting translation and/or mRNA decay rates. The combinations of miRNAs and targets drive the cell to different outcomes. Several miRNAs can drive cells to pro- or anti-tumoral phenotypes13. Oncogenic miRNAs usually target mRNAs that trigger a suppressive characteristic, leading to increased cellular proliferation, migration, and invasion14. On the other hand, tumor-suppressive miRNAs might target oncogenic mRNAs or mRNAs related to increased cell proliferation. 
The processing and maturation of miRNAs are also dependent on their origin. Most intronic miRNAs are processed with the participation of the microprocessor, formed by the ribonuclease Drosha and protein co-factors12. Mirtrons are processed with the activity of the spliceosome independently of Drosha15. Considering the high frequency of miRNAs found within introns, we hypothesized that RNA-binding proteins involved with splicing could also facilitate the processing and maturation of these miRNAs. Notably, the RBP hnRNP A2/B1 has already been associated with the microprocessor and miRNA biogenesis16. 
We have previously reported that several RNA-binding proteins, such as hnRNPs and HuR, are associated with intronic miRNAs by mass spectrometry17. HuR's (ELAVL1) association with miRNAs from the miR-17-92 intronic cluster was confirmed using immunoprecipitation and in silico analysis9. miR-17-92 is an intronic miRNA cluster composed of six miRNAs with increased expression in different cancers18,19. This cluster is also known as "oncomiR-1" and is composed of miR-17, miR-18a, miR-19a, miR-20, miR-19b, and miR-92a. miR-19a and miR-19b are among the most oncogenic miRNAs of this cluster19. The increased expression of HuR stimulates miR-19a and miR-19b synthesis9. Since intronic regions flanking this cluster are associated with HuR, we developed a method to investigate if this protein could regulate miR-19a and miR-19b expression and maturation. One important prediction of our hypothesis was that, as a regulatory protein, HuR could facilitate miRNA biogenesis, leading to phenotypic alterations. One possibility was that miRNAs were processed by the stimulation of HuR but would not be mature and functional and, therefore, the effects of the protein would not directly impact the phenotype. Therefore, we developed a splicing reporter assay to investigate whether an RBP such as HuR could affect the biogenesis and maturation of an intronic miRNA. By confirming miRNA processing and maturation, our assay shows the interaction with the target sequence and the generation of a mature and functional miRNA. In our assay, we couple the expression of an intronic miRNA cluster with a luciferase plasmid to check for miRNA target-binding in cultured cells.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Recombinant DNA</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>pCAGGS-Cre (Cre- encoding plasmid)</td>
			<td></td>
			<td></td>
			<td>A kind gift from E. Makeyev from Khandelia et al., 2011</td>
		</tr>
		<tr>
			<td>pFLAG-HuR</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>pmiRGLO-RAP-IB</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>pmiRGLO-scrambled</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>pRD-miR-17-92</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>pRD-RIPE-donor</td>
			<td></td>
			<td></td>
			<td>A kind gift from E. Makeyev from Khandelia et al., 2011</td>
		</tr>
		<tr>
			<td>pTK-Renilla</td>
			<td>Promega</td>
			<td>E2241</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibodies</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>anti-B-actin</td>
			<td>Sigma Aldrich</td>
			<td>A5316</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-HuR</td>
			<td>Cell Signaling</td>
			<td>mAb&#160;12582</td>
			<td></td>
		</tr>
		<tr>
			<td>IRDye 680CW Goat anti-mouse IgG</td>
			<td>Li-Cor Biosciences</td>
			<td>926-68070</td>
			<td></td>
		</tr>
		<tr>
			<td>IRDye 800CW Goat anti-rabbit IgG</td>
			<td>Li-Cor Biosciences</td>
			<td>929-70020</td>
			<td></td>
		</tr>
		<tr>
			<td>Experimental Models: Cell Lines</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>HeLa-Cre</td>
			<td></td>
			<td></td>
			<td>A kind gift from E. Makeyev from Khandelia et al., 2011</td>
		</tr>
		<tr>
			<td>HeLa-Cre miR17-92</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>HeLa-Cre miR17-92-HuR</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>HeLa-Cre miR17-92-HuR-luc</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>HeLa-Cre miR17-92-luc</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>HeLa-Cre miR17-92-scrambled</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>Chemicals and Peptides</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM/high-glucose</td>
			<td>Thermo Fisher Scientific</td>
			<td>12800-017</td>
			<td></td>
		</tr>
		<tr>
			<td>Doxycycline</td>
			<td>BioBasic</td>
			<td>MB719150</td>
			<td></td>
		</tr>
		<tr>
			<td>Dual-Glo Luciferase Assay System</td>
			<td>Promega</td>
			<td>E2940</td>
			<td></td>
		</tr>
		<tr>
			<td>EcoRI</td>
			<td>Thermo Fisher Scientific</td>
			<td>ER0271</td>
			<td></td>
		</tr>
		<tr>
			<td>EcoRV</td>
			<td>Thermo Fisher Scientific</td>
			<td>ER0301</td>
			<td></td>
		</tr>
		<tr>
			<td>Geneticin</td>
			<td>Thermo Fisher Scientific</td>
			<td>E859-EG</td>
			<td></td>
		</tr>
		<tr>
			<td>L-glutamine</td>
			<td>Life Technologies</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Opti-MEM I</td>
			<td>Life Technologies</td>
			<td>31985-070</td>
			<td></td>
		</tr>
		<tr>
			<td>pFLAG-CMV&#8482;-3 Expression Vector</td>
			<td>Sigma Aldrich</td>
			<td>E6783</td>
			<td></td>
		</tr>
		<tr>
			<td>pGEM-T</td>
			<td>Promega</td>
			<td>A3600</td>
			<td></td>
		</tr>
		<tr>
			<td>Platinum Taq DNA polymerase</td>
			<td>Thermo Fisher Scientific</td>
			<td>10966-030</td>
			<td></td>
		</tr>
		<tr>
			<td>pmiR-GLO</td>
			<td>Promega</td>
			<td>E1330</td>
			<td></td>
		</tr>
		<tr>
			<td>Puromycin</td>
			<td>Sigma Aldrich</td>
			<td>P8833</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAse OUT</td>
			<td>Thermo Fisher Scientific</td>
			<td>752899</td>
			<td></td>
		</tr>
		<tr>
			<td>SuperScript IV kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>18091050</td>
			<td></td>
		</tr>
		<tr>
			<td>Trizol-LS reagent</td>
			<td>Thermo Fisher</td>
			<td>10296-028</td>
			<td></td>
		</tr>
		<tr>
			<td>trypsin/EDTA 10X</td>
			<td>Life Technologies</td>
			<td>15400-054</td>
			<td></td>
		</tr>
		<tr>
			<td>XbaI</td>
			<td>Thermo Fisher Scientific</td>
			<td>10131035</td>
			<td></td>
		</tr>
		<tr>
			<td>XhoI</td>
			<td>Promega</td>
			<td>R616A</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotides</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>forward RAP-1B pmiRGLO</td>
			<td>Exxtend</td>
			<td>TCGAGTAGCGGCCGCTAGTAAG 
			CTACTATATCAGTTTGCACAT</td>
			<td></td>
		</tr>
		<tr>
			<td>reverse RAP-1B pmiRGLO</td>
			<td>Exxtend</td>
			<td>CTAGATGTGCAAACTGATATAGT 
			AGCTTACTAGCGGCCGCTAC</td>
			<td></td>
		</tr>
		<tr>
			<td>forward scrambled pmiRGLO</td>
			<td>Exxtend</td>
			<td>TCGAGTAGCGGCCGCTAGTAA 
			GCTACTATATCAGGGGTAAAAT</td>
			<td></td>
		</tr>
		<tr>
			<td>reverse scrambled pmiRGLO</td>
			<td>Exxtend</td>
			<td>CTAGATTTTACCCCTGATATAGT 
			AGCTTACTAGCGGCCGCTAC</td>
			<td></td>
		</tr>
		<tr>
			<td>forward HuR pFLAG</td>
			<td>Exxtend</td>
			<td>GCCGCGAATTCAATGTCTAAT 
			GGTTATGAAGAC</td>
			<td></td>
		</tr>
		<tr>
			<td>reverse HuR pFLAG</td>
			<td>Exxtend</td>
			<td>GCGCTGATATCGTTATTTGTG 
			GGACTTGTTGG</td>
			<td></td>
		</tr>
		<tr>
			<td>forward pre-miR-1792 pRD-RIPE</td>
			<td>Exxtend</td>
			<td>ATCCTCGAGAATTCCCATTAG 
			GGATTATGCTGAG</td>
			<td></td>
		</tr>
		<tr>
			<td>reverse pre-miR-1792 pRD-RIPE</td>
			<td>Exxtend</td>
			<td>ACTAAGCTTGATATCATCTTG 
			TACATTTAACAGTG</td>
			<td></td>
		</tr>
		<tr>
			<td>forward snRNA U6 (RNU6B)</td>
			<td>Exxtend</td>
			<td>CTCGCTTCGGCAGCACATATAC</td>
			<td></td>
		</tr>
		<tr>
			<td>reverse snRNA U6 (RNU6B)</td>
			<td>Exxtend</td>
			<td>GGAACGCTTCACGAATTTGCGTG</td>
			<td></td>
		</tr>
		<tr>
			<td>forward B-Actin qPCR</td>
			<td>Exxtend</td>
			<td>ACCTTCTACAATGAGCTGCG</td>
			<td></td>
		</tr>
		<tr>
			<td>reverse B-Actin qPCR</td>
			<td>Exxtend</td>
			<td>CCTGGATAGCAACGTACATGG</td>
			<td></td>
		</tr>
		<tr>
			<td>forward HuR qPCR</td>
			<td>Exxtend</td>
			<td>ATCCTCTGGCAGATGTTTGG</td>
			<td></td>
		</tr>
		<tr>
			<td>reverse HuR qPCR</td>
			<td>Exxtend</td>
			<td>CATCGCGGCTTCTTCATAGT</td>
			<td></td>
		</tr>
		<tr>
			<td>forward pre-miR-1792 qPCR</td>
			<td>Exxtend</td>
			<td>GTGCTCGAGACGAATTCGTCA 
			GAATAATGTCAAAGTG</td>
			<td></td>
		</tr>
		<tr>
			<td>reverse pre-miR-1792 qPCR</td>
			<td>Exxtend</td>
			<td>TCCAAGCTTAAGATATCCCAAAC 
			TCAACAGGCCG</td>
			<td></td>
		</tr>
		<tr>
			<td>Software and Algorithms</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Prism 8 for Mac OS X</td>
			<td>Graphpad</td>
			<td>https://www.graphpad.com</td>
			<td></td>
		</tr>
		<tr>
			<td>ImageJ</td>
			<td>National Institutes of Health</td>
			<td>http://imagej.nih.gov/ij</td>
			<td></td>
		</tr>
	</tbody>
</table>

a reporter assay to analyze intronic microrna maturation in mammalian cells

MicroRNAs (miRNAs) are short RNA molecules that are widespread in eukaryotes. Most miRNAs are transcribed from introns, and their maturation involves different RNA-binding proteins in the nucleus. Mature miRNAs frequently mediate gene silencing, and this has become an important tool for comprehending post-transcriptional events. Besides that, it can be explored as a promising methodology for gene therapies. However, there is currently a lack of direct methods for assessing miRNA expression in mammalian cell cultures. Here, we describe an efficient and simple method that aids in determining miRNA biogenesis and maturation through confirmation of its interaction with target sequences. Also, this system allows the separation of exogenous miRNA maturation from its endogenous activity using a doxycycline-inducible promoter capable of controlling primary miRNA (pri-miRNA) transcription with high efficiency and low cost. This tool also allows modulation with RNA-binding proteins in a separate plasmid. In addition to its use with a variety of different miRNAs and their respective targets, it can be adapted to different cell lines, provided these are amenable to transfection.

Our initial hypothesis was that HuR could facilitate intronic miRNA biogenesis by binding to its pre-miRNA sequence. Thus, the connection of HuR expression and miR-17-92 cluster biogenesis could point to a new mechanism governing the maturation of these miRNAs. Overexpression of HuR upon transfection of pFLAG-HuR was confirmed in three different cell lines: HeLa, BCPAP, and HEK-293T (Figure 2). As controls, untransfected cells and cells transfected with empty pFLAG vectors were used...

Watch this Scientific Journal Video about A Reporter Assay to Analyze Intronic microRNA Maturation in Mammalian Cells at JoVE.com

A Reporter Assay to Analyze Intronic microRNA Maturation in Mammalian Cells

We developed an intronic microRNA biogenesis reporter assay to be used in cells in vitro with four plasmids: one with intronic miRNA, one with the target, one to overexpress a regulatory protein, and one for Renilla luciferase. The miRNA was processed and could control luciferase expression by binding to the target sequence.

MicroRNAs (miRNAs) are short RNA molecules that are widespread in eukaryotes. Most miRNAs are transcribed from introns, and their maturation involves ...

Our protocol addresses the effects of regulatory RNA-binding proteins on microRNA biogenesis and maturation, straight from cell cultures. The method we describe can be performed with common cell culture reagents and is relatively fast. This method can be important to study the phenotypic effects of microRNAs and their targets in different types of eukaryotic cells.Normal or disease-like cells can be used. It is important to choose cell lines amenable to transfection, perform adequate transfection and induction controls in order to observe the changes in target affinity through luciferase activity. To begin, maintain the cells in DMEM, high glucose supplement in 100 millimeters Petri dishes and incubate the cells at 37 degrees Celsius in a humidified, controlled atmosphere incubator with 5%carbon dioxide.To detach adherent cells, incubate it with trypsin-EDTA solution at 37 degrees Celsius for three to five minutes. To perform transfections, mix 200 nanograms of DNA and 1.25 microliters of transfection reagent in 100 microliters of the culture medium and add the transfection mixture to the cells. Then, incubate the cells with the transfection mixtures for four hours at 37 degrees Celsius.Then replace the medium with medium containing 10%FBS and incubate for another 24 hours before adding the antibiotics for selection. To transfect pFLAG-HuR and MT-pFLAG into HeLa, select cells by increasing the concentration of Geneticin from 100 microgram per milliliter to 1000 microgram per milliliter, generating stable cell lines. Then, confirm overexpression with quantitative PCR using specific primers for HuR mRNA.Transfect the plasmids in HeLa-Cre cells with 40 nanograms pTK-Renilla, then pRD miR 17-92, generating HeLa-Cre miR 17-92, and selecting with one microgram per milliliter puromycin. Then, transfect HeLa-Cre miR 17-92 with pTK-Renilla and pmirGLO RAB1B 3'UTR or pmirGLO scrambled 1B 3'UTR separately. Next, select using penicillin and streptomycin, resulting in generation of luc RAB1B and luc scrambled.Next, transfect the cells with pFLAG-HuR or MT-PFLAG as them demonstrated previously. Proceed to cell culture with HeLa-Cre miR 17-92 luc, HeLa-Cre miR 17-92 scrambled, HeLa-Cre miR 17-92 HuR, and HeLa-Cre miR 1792 HuR lock until approximately 80%of confluency is reached. Then, induce with one microliter of doxycycline for 30 minutes at 37 degrees Celsius and also keep all the cells without doxycycline as controls for the same period.To quantify and compare different luminescence intensities, use the dual luciferase reporter assay kit. Before beginning the assay, thaw luciferase assay solutions and leave them at room temperature. Next, prepare the mix Stop and Glo by mixing 200 microliters of the substrate in 10 milliliters of luciferase assay buffer two.Then mix 10 milliliters of luciferase assay buffer two into the amber vile of luciferase assay substrate two to prepare the mix, LAR II, and shake well. Afterward, transfer the solutions to 15 milliliter centrifuge tubes previously identified and protected from light. Next, perform the luminescence readings using equipment such as Synergy and measure expressed luciferase as relative light units, and then export the results to a spreadsheet for further statistical analysis.Perform normalization of firefly luciferase activity by the control Renilla and plot that as relative light units in a graphic while repeating for groups with and without doxycycline induction. Overexpression of HuR upon transfection of pFLAG-HuR was confirmed in HeLa, BCPAP, and HEK293T cell line, and it was observed that HuR overexpression in these cells stimulates the expression of miR19A. A strong reduction in luciferase activity was observed with RAB1B 3'UTR upon increased miR19A and miR19B expression from pRD miR 17-92, in comparison to HeLa-Cre cells.The transfection of pFLAG-HuR in HeLa cells did not change the luciferase activity. However, overexpression of HuR, coupled with doxycycline supplementation stimulating expression of the miR 17-92 cluster, further reduced luciferase activity. After confirming the role of the RNA-binding protein in microRNA maturation, cell kinetics and cell cycle analysis will be important to understand the major changes promoted by the protein in microRNAs.

a-reporter-assay-to-analyze-intronic-microrna-maturation-mammalian

Research

JoVE Journal

Cancer Research

Application of Laser Micro-irradiation for Examination of Single and Double Strand Break Repair in Mammalian Cells

Highly coordinated DNA repair pathways exist to detect, excise and replace damaged DNA bases, and coordinate repair of DNA strand breaks. While molecular biology techniques have clarified structure, enzymatic functions, and kinetics of repair proteins, there is still a need to understand how repair is coordinated within the nucleus. Laser micro-irradiation offers a powerful tool for inducing DNA damage and monitoring the recruitment of repair proteins. Induction of DNA damage by laser micro-irradiation can occur with a range of wavelengths, and users can reliably induce single strand breaks, base lesions and double strand breaks with a range of doses. Here, laser micro-irradiation is used to examine repair of single and double strand breaks induced by two common confocal laser wavelengths, 355 nm and 405 nm. Further, proper characterization of the applied laser dose for inducing specific damage mixtures is described, so users can reproducibly perform laser micro-irradiation data acquisition and analysis.

Confocal fluorescence microscopy and laser micro-irradiation offer tools for inducing DNA damage and monitoring the response of DNA repair proteins in selected sub-nuclear areas. This technique has significantly advanced our knowledge of damage detection, signaling, and recruitment. This manuscript demonstrates these technologies to examine single and double strand break repair.

Highly coordinated DNA repair pathways exist to detect, excise and replace damaged DNA bases, and coordinate repair of DNA strand breaks. While molecular ...

Using the Dot Assay to Analyze Migration of Cell Sheets

Although complex organisms appear static, their tissues are under a continuous turnover. As cells age, die, and are replaced by new cells, cells move within tissues in a tightly orchestrated manner. During tumor development, this equilibrium is disturbed, and tumor cells leave the epithelium of origin to invade the local microenvironment, to travel to distant sites, and to ultimately form metastatic tumors at distant sites. The dot assay is a simple, two-dimensional unconstrained migration assay, to assess the net movement of cell sheets into a cell-free area, and to analyze parameters of cell migration using time-lapse imaging. Here, the dot assay is demonstrated using a human invasive, lung colony forming breast cancer cell line, MCF10CA1a, to analyze the cells' migratory response to epidermal growth factor (EGF), which is known to increase malignant potential of breast cancer cells and to alter the migratory phenotype of cells.

Cell migration is essential for development, tissue maintenance and repair, and tumorigenesis, and is regulated by growth factors, chemokines, and cytokines. This protocol describes the dot assay, a two-dimensional, unconstrained migration assay to assess the migratory phenotype of attached, cohesive cell sheets in response to microenvironmental cues.

Although complex organisms appear static, their tissues are under a continuous turnover. As cells age, die, and are replaced by new cells, cells move ...

Radionuclide-fluorescence Reporter Gene Imaging to Track Tumor Progression in Rodent Tumor Models

Metastasis is responsible for most cancer deaths. Despite extensive research, the mechanistic understanding of the complex processes governing metastasis remains incomplete. In vivo models are paramount for metastasis research, but require refinement. Tracking spontaneous metastasis by non-invasive in vivo imaging is now possible, but remains challenging as it requires long-time observation and high sensitivity. We describe a longitudinal combined radionuclide and fluorescence whole-body in vivo imaging approach for tracking tumor progression and spontaneous metastasis. This reporter gene methodology employs the sodium iodide symporter (NIS) fused to a fluorescent protein (FP). Cancer cells are engineered to stably express NIS-FP followed by selection based on fluorescence-activated cell sorting. Corresponding tumor models are established in mice. NIS-FP expressing cancer cells are tracked non-invasively in vivo at the whole-body level by positron emission tomography (PET) using the NIS radiotracer [18F]BF4-. PET is currently the most sensitive in vivo imaging technology available at this scale and enables reliable and absolute quantification. Current methods either rely on large cohorts of animals that are euthanized for metastasis assessment at varying time points, or rely on barely quantifiable 2D imaging. The advantages of the described method are: (i) highly sensitive non-invasive in vivo 3D PET imaging and quantification, (ii) automated PET tracer production, (iii) a significant reduction in required animal numbers due to repeat imaging options, (iv) the acquisition of paired data from subsequent imaging sessions providing better statistical data, and (v) the intrinsic option for ex vivo confirmation of cancer cells in tissues by fluorescence microscopy or cytometry. In this protocol, we describe all steps required for routine NIS-FP-afforded non-invasive in vivo cancer cell tracking using PET/CT and ex vivo confirmation of in vivo results. This protocol has applications beyond cancer research whenever in vivo localization, expansion and long-time monitoring of a cell population is of interest.

We describe a protocol for preclinical in vivo tracking of cancer metastasis. It is based on a radionuclide-fluorescence reporter combining the sodium iodide symporter, detected by non-invasive [18F]tetrafluoroborate-PET, and a fluorescent protein for streamlined ex vivo confirmation. The method is applicable for preclinical in vivo cell tracking beyond tumor biology.

Metastasis is responsible for most cancer deaths. Despite extensive research, the mechanistic understanding of the complex processes governing metastasis ...

Detection of a Circulating MicroRNA Custom Panel in Patients with Metastatic Colorectal Cancer

There is increasing interest in liquid biopsy for cancer diagnosis, prognosis and therapeutic monitoring, creating the need for reliable and useful biomarkers for clinical practice. Here, we present a protocol to extract, reverse transcribe and evaluate the expression levels of circulating miRNAs from plasma samples of patients with colorectal cancer (CRC). microRNAs (miRNAs) are a class of non-coding RNAs of 18-25 nucleotides in length that regulate the expression of target genes at the translational level and play an important role, including that of pro- and anti-angiogenic function, in the physiopathology of various organs. miRNAs are stable in biological fluids such as serum and plasma, which renders them ideal circulating biomarkers for cancer diagnosis, prognosis and treatment decision-making and monitoring. Circulating miRNA extraction was performed using a rapid and effective method that involves both organic and column-based methodologies. For miRNA retrotranscription, we used a multi-step procedure that considers polyadenylation at 3&#39; and the ligation of an adapter at 5&#39; of the mature miRNAs, followed by random miRNA pre-amplification. We selected a 24-miRNA custom panel to be tested by quantitative real-time polymerase chain reaction (qRT-PCR) and spotted the miRNA probes on array custom plates. We performed qRT-PCR plate runs on a real-time PCR System. Housekeeping miRNAs for normalization were selected using GeNorm software (v. 3.2). Data were analyzed using Expression suite software (v 1.1) and statistical analyses were performed. The method proved to be reliable and technically robust and could be useful to evaluate biomarker levels in liquid samples such as plasma and/or serum.

We present a protocol to evaluate the expression levels of circulating microRNA (miRNAs) in plasma samples from cancer patients. In particular, we used a commercially available kit for circulating miRNA extraction and reverse transcription. Finally, we analyzed a panel of 24 selected miRNAs using real-time pre-spotted probe custom plates.

There is increasing interest in liquid biopsy for cancer diagnosis, prognosis and therapeutic monitoring, creating the need for reliable and useful ...

A Spheroid Killing Assay by CAR T Cells

Immunotherapy has become a field of growing interest in the fight against cancer otherwise untreatable. Among all immunotherapeutic methods, chimeric antigen receptor (CAR) redirected T cells obtained the most spectacular results, in particular with pediatric B-acute lymphoblastic leukemia (B-ALL). Classical validation methods of CAR T cells rely on the use of specificity and functionality assays of the CAR T cells against target cells in suspension and in xenograft models. Unfortunately, observations made in vitro are often decoupled from results obtained in vivo and a lot of effort and animals could be spared by adding another step: the use of 3D culture. The production of spheroids out of potential target cells that mimic the 3D structure of the tumor cells when they are engrafted into the animal model represents an ideal alternative. Here, we report an affordable, reliable and easy method to produce spheroids from a transduced colorectal cell line as a validation tool for adoptive cell therapy (exemplified here by CD19 CAR T cells). This method is coupled with an advanced live imaging system that can follow spheroid growth, effector cells cytotoxicity and tumor cell apoptosis.

This protocol is designed to assess immunotherapeutic redirected T-cell (CAR T-cell) cytotoxicity against 3D structured cancerous cells (spheroids) in real time.

Immunotherapy has become a field of growing interest in the fight against cancer otherwise untreatable. Among all immunotherapeutic methods, chimeric ...

Real Time Detection of In Vitro Tumor Cell Apoptosis Induced by CD8+ T Cells to Study Immune Suppressive Functions of Tumor-infiltrating Myeloid Cells

Potentiation of the tumor-killing ability of CD8+ T cells in tumors, along with their efficient tumor infiltration, is a key element of successful immunotherapies. Several studies have indicated that tumor infiltrating myeloid cells (e.g., myeloid-derived suppressor cells (MDSCs) and tumor-associated macrophages (TAMs)) suppress cytotoxicity of CD8+ T cells in the tumor microenvironment, and that targeting these regulatory myeloid cells can improve immunotherapies. Here, we present an in vitro assay system to evaluate immune suppressive effects of monocytic-MDSCs and TAMs on the tumor-killing ability of CD8+ T cells. To this end, we first cultured na&#239;ve splenic CD8+ T cells with anti-CD3/CD28 activating antibodies in the presence or absence of suppressor cells, and then co-cultured the pre-activated T cells with target cancer cells in the presence of a fluorogenic caspase-3 substrate. Fluorescence from the substrate in cancer cells was detected by real-time fluorescence microscopy as an indicator of T-cell induced tumor cell apoptosis. In this assay, we can successfully detect the increase of tumor cell apoptosis by CD8+ T cells and its suppression by pre-culture with TAMs or MDSCs. This functional assay is useful for investigating CD8+ T cell suppression mechanisms by regulatory myeloid cells and identifying druggable targets to overcome it via high throughput screening.

Real Time Detection of In Vitro Tumor Cell Apoptosis Induced by CD8+ T Cells to Study Immune Suppressive Functions of Tumor-infiltrating Myeloid Cells

We describe here a protocol to investigate cytotoxicity of pre-activated CD8+ T cells against cancer cells by detecting apoptotic cancer cells via real-time microscopy. This protocol can investigate mechanisms behind myeloid cell-induced T cell suppression and evaluate compounds aimed at replenishing T cells via blockade of immune suppressive myeloid cells.

Potentiation of the tumor-killing ability of CD8+ T cells in tumors, along with their efficient tumor infiltration, is a key element of successful ...

In Vivo Inhibition of MicroRNA to Decrease Tumor Growth in Mice

MicroRNAs (miRNAs) are important regulators of gene expression through their ability to destabilize mRNA and inhibit translation of target mRNAs. An ever-increasing number of studies have identified miRNAs as potential biomarkers for cancer diagnosis and prognosis, and also as therapeutic targets, adding an extra dimension to cancer evaluation and treatment. In the context of thyroid cancer, tumorigenesis results not only from mutations in important genes, but also from the overexpression of many miRNAs. Accordingly, the role of miRNAs in the control of thyroid gene expression is evolving as an important mechanism in cancer. Herein, we present a protocol to examine the effects of miRNA-inhibitor delivery as a therapeutic modality in thyroid cancer using human tumor xenograft and orthotopic mouse models. After engineering stable thyroid tumoral cells expressing GFP and luciferase, cells are injected into nude mice to develop tumors, which can be followed by bioluminescence. The in vivo inhibition of a miRNA can reduce tumor growth and upregulate miRNA gene targets. This method can be used to assess the importance of a determined miRNA in vivo, in addition to identifying new therapeutic targets.

This protocol describes xenograft and orthotopic mouse models of human thyroid tumorigenesis as a platform to test microRNA-based inhibitor treatments. This approach is ideal to study the function of non-coding RNAs and their potential as new therapeutic targets.

MicroRNAs (miRNAs) are important regulators of gene expression through their ability to destabilize mRNA and inhibit translation of target mRNAs. An ...

In Vitro Assay to Study Tumor-macrophage Interaction

Tumor associated macrophages (TAMs) account for a large percentage of cells in the tumor mass for different types of cancers. Glioblastoma (GBM), a malignant brain tumor with no cure, has up to a half the tumor mass TAMs. TAMs can be pro-tumoral or anti-tumoral, depending on the activation of specific genes in the cells. Genetic mutations in the tumors, through regulating cytokine expression, can affect recruitment of TAMs to the tumor microenvironment. Here, we describe a quantitative cell-based assay to assess macrophage recruitment by the conditioned medium from the tumor cells. This assay uses the human macrophage cell line MV-4-11 to study macrophage attraction by the conditioned medium from glioblastoma, allowing for high reproducibility and low variability. Data generated with this assay can contribute to a better understanding of the interaction between the tumor and the tumor microenvironment. Similar assay can be used to assess interaction between the tumor cells and other immune cells, including T cells and natural killer (NK) cells.

This article represents a useful in vitro assay to evaluate the capability of conditioned medium from tumor cells to attract macrophages.

Tumor associated macrophages (TAMs) account for a large percentage of cells in the tumor mass for different types of cancers. Glioblastoma (GBM), a ...

Quantifying Telomere Length Using Non-Radioactive Chemiluminescence Detection

Optimization of Performance Parameters of the TAGGG Telomere Length Assay

Telomeres are repetitive sequences which are present at chromosomal ends; their shortening is a characteristic feature of human somatic cells. Shortening occurs due to a problem with end replication and the absence of the telomerase enzyme, which is responsible for maintaining telomere length. Interestingly, telomeres also shorten in response to various internal physiological processes, like oxidative stress and inflammation, which may be impacted due to extracellular agents like pollutants, infectious agents, nutrients, or radiation. Thus, telomere length serves as an excellent biomarker of aging and various physiological health parameters. The TAGGG telomere length assay kit is used to quantify average telomere lengths using the telomere restriction fragment (TRF) assay and is highly reproducible. However, it is an expensive method, and because of this, it is not employed routinely for large sample numbers. Here, we describe a detailed protocol for an optimized and cost-effective measurement of telomere length using Southern blots or TRF analysis and non-radioactive chemiluminescence-based detection.

Author Spotlight: Optimization of Performance Parameters of the TAGGG Telomere Length Assay  

Here, we describe in detail the protocol for quantifying telomere length using non-radioactive chemiluminescent detection, with a focus on the optimization of various performance parameters of the TAGGG telomere length assay kit, such as buffer quantities and probe concentrations.

Telomeres are repetitive sequences which are present at chromosomal ends; their shortening is a characteristic feature of human somatic cells. Shortening ...

https://cloudfront.jove.com/CDNSource/teasers/65288.jpg

Pharmacological Targeting of Ion Channels to Treat Solid Tumors

Screening Ion Channels in Cancer Cells

Ion channels are critical for cell development and maintaining cell homeostasis. The perturbation of ion channel function contributes to the development of a broad range of disorders or channelopathies. Cancer cells utilize ion channels to drive their own development, as well as to improve as a tumor and to assimilate in a microenvironment that includes various non-cancerous cells. Furthermore, increases in levels of growth factors and hormones within the tumor microenvironment can result in enhanced ion channel expression, which contributes to cancer cell proliferation and survival. Thus, the pharmacological targeting of ion channels is potentially a promising approach to treating solid malignancies, including primary and metastatic brain cancers. Herein, protocols to characterize the function of ion channels in cancerous cells and approaches to analyze modulators of ion channels to determine their impact on cancer viability are described. These include staining a cell(s) for an ion channel(s), testing the polarized state of mitochondria, establishing ion channel function using electrophysiology, and performing viability assays to assess drug potency.

Author Spotlight: Exploring the Role of Ion Channels in Cancer: Characterization and Potential Treatment Approaches 

The pharmacological targeting of ion channels is a promising approach to treating solid tumors. Detailed protocols are provided for characterizing ion channel function in cancer cells and assaying the effects of ion channel modulators on cancer viability.

Ion channels are critical for cell development and maintaining cell homeostasis. The perturbation of ion channel function contributes to the development ...