The authors are grateful to E. Makeyev (Nanyang Technological University, Singapore) for the HeLa-Cre cells and pRD-RIPE and pCAGGS-Cre plasmids. We thank Edna Kimura, Carolina Purcell Goes, Gisela Ramos, Lucia Rossetti Lopes, and Anselmo Moriscot for their support.

An overview of the protocol described here is depicted in Figure 1.
1. Plasmid construction
<ol>
	<li>pCAGGS-Cre: This plasmid was provided by Dr. E. Makeyev21.</li>
	<li>pRD-miR-17-92:
	<ol>
		<li>Amplify pre-miR-17-92 by PCR using 0.5 &#181;M of each specific primer (Table of Materials), 150 ng of cDNA, 1 mM dNTPs, 1x Taq PCR buffer, and 5 U of high-fidelity Taq DNA polymerase. Perform a no-template control PCR reaction (use water instead of cDNA) to check for DNA contamination.</li>
		<li>Ligate the PCR product into pRD-RIPE (kindly provided by Dr. E. Makeyev, Nanyang Technological University, Singapore)21 inside the intron between the EcoRI and EcoRV restriction sites using DNA ligase, creating pRD-miR-17-92. Confirm sequence integrity by Sanger sequencing.</li>
	</ol>
	</li>
	<li>pmiRGLO-RAP-IB
	<ol>
		<li>Design forward and reverse primers flanked by XhoI/XbaI restriction sites and with one NotI restriction site inside. Mix equimolar amounts of forward and reverse primers and incubate the mixture at 90 &#176;C for 5 min, then transfer to 37 &#176;C for 15 min. As controls, use primers with scrambled target sequences (Table of Materials).</li>
		<li>Cleave the annealed fragments using XhoI/XbaI restriction enzymes and ligate them downstream of the luc2 sequence into pmiR-GLO, generating pmiRGLO-RAP-IB-3&#697;-UTR (Luc-RAP-1B) and pmiRGLO-scrambled-3&#697;-UTR (Luc-scrambled) reporter constructs. Confirm ligation with NotI cleavage. 
		&#8203;NOTE: Ensure that the overhangs created after primer annealing are complementary to the vector after cleavage reaction.</li>
	</ol>
	</li>
	<li>pFLAG-HuR
	<ol>
		<li>To generate a HuR over-expressing plasmid, amplify the HuR sequence with specific primers. Mix 300 ng of cDNA, 0.5 &#181;M of each specific primer, 1 mM dNTPs mix, 1x PCR buffer, and 5 U of high-fidelity Taq DNA polymerase.</li>
		<li>Ligate the PCR product into pGEM-T and confirm the DNA sequence integrity by Sanger sequencing. Remove the HuR fragment from pGEM-T and subclone it into pFLAG-CMV-3 mammalian expression vector to generate the pFLAG-HuR vector.</li>
	</ol>
	</li>
</ol>
2. Cell culture
NOTE: The HeLa-Cre cell line was a gift from Dr. E. Makeyev21, and the papillary thyroid cancer cell (BCPAP) was kindly provided by Dr. Massimo Santoro (University &#34;Federico II&#34;, Naples, Italy). HeLa cell, papillary thyroid cancer cell (BCPAP), and HEK-293T were used to overexpress HuR.
<ol>
	<li>Maintain the cells in DMEM/high-glucose supplemented with 10% fetal bovine serum, 1 mM sodium pyruvate, 200 mM L-glutamine, and 1x penicillin-streptomycin (100 U/mL penicillin, 100 &#181;g/mL streptomycin) in 100 mm Petri dishes, unless otherwise indicated. Incubate the cells at 37 &#176;C in a humidified, controlled-atmosphere incubator (5% CO2).</li>
	<li>Incubate adherent cells with trypsin/EDTA (0.5% solution mixture) at 37 &#176;C for 3-5 min. Let them detach from the plate (incubation period can vary according to the cell type).</li>
	<li>Perform transfections with a lipid-based transfection reagent following the manufacturer&#39;s instructions. Ensure that the cell cultures are approximately 70% confluent. Use similar amounts of DNA for all transfection combinations, as described below, by adding the appropriate DNAs. Perform transfection experiments in replicates.
	<ol>
		<li>Mix 200 ng of DNA and 1.25 &#181;L of transfection reagent in 100 &#181;L of the culture medium. Add the transfection mixture to the cells. Incubate the cells with the transfection mixtures for 4 h at 37 &#176;C. Then, replace the medium with medium containing 10% FBS, and incubate for another 24 h before adding the antibiotics for selection.</li>
	</ol>
	</li>
</ol>
3. HuR overexpression
<ol>
	<li>Transfect pFLAG-HuR and empty pFLAG into HeLa. Select cells by increasing the concentration of geneticin (G418) (1 &#181;g/mL) from 100 &#181;g/mL to 1000 &#181;g/mL, generating stable cell lines.</li>
	<li>Confirm overexpression with quantitative PCR using specific primers for HuR mRNA, as described in step 7.</li>
</ol>
4. Total RNA isolation
<ol>
	<li>Use freshly collected cells. Trypsinize 70% confluent cell cultures (for this assay, HeLa-Cre cells were used), as described in step 2.2.</li>
	<li>Collect the cell pellet by centrifugation for 5 min at 500 x g at 4 &#176;C and wash it with 1x PBS (phosphate-buffered saline); repeat the centrifugation.</li>
	<li>Resuspend the cell pellet in 1 mL of 1x PBS and transfer it to a 1.5 mL microcentrifuge tube.</li>
	<li>Centrifuge for 5 min at 500 x g at 4 &#176;C.</li>
	<li>Weigh the dry cell pellet, and adjust the volumes and size of tubes accordingly. 1 mg of cells yields approximately 1 &#181;g of total RNA.</li>
	<li>In a hood, add 500-1,000 &#181;L of phenol/chloroform to the cell pellet (ideally 750 &#181;L per 0.25 g of cells) and homogenize it by pipetting up and down and mixing with the vortex.</li>
	<li>Incubate the mixture for 5 min at room temperature (20 &#176;C to 25 &#176;C) to allow the complete dissociation of nucleoprotein complexes.</li>
	<li>Centrifuge the sample at 500 x g for 5 min at 4 &#176;C.</li>
	<li>Transfer the supernatant to a new 1.5 mL microcentrifuge tube and add 200 &#181;L of chloroform per 1 mL of phenol:chloroform used. Cap the sample tubes securely.</li>
	<li>Mix vigorously for 15 s (by hand or briefly vortexing at a lower speed) and incubate at room temperature (20 &#176;C to 25 &#176;C) for 2 min to 3 min.</li>
	<li>Centrifuge the samples at 12,000 x g for 15 min at 4 &#176;C.</li>
	<li>Check for the presence of a lower red phenol-chloroform phase, an intermediary phase, and a colorless upper aqueous phase. RNA remains in the upper aqueous phase. In a hood, collect the aqueous phase, avoiding contacting the intermediary phase, and transfer to a fresh tube.</li>
	<li>Precipitate RNA by mixing the aqueous phase with 400 &#181;L of molecular grade isopropanol (1:1 ratio to phenol/chloroform used) and 2 &#181;L of glycogen in each tube (it will help to visualize the presence of the pellet).</li>
	<li>Mix vigorously by hand or homogenize with the tip for ~10 s. Incubate for 15 min or overnight at &#8722;20 &#176;C.</li>
	<li>Centrifuge the sample at 12,000 x g for 20 min at 4 &#176;C and discard the supernatant.</li>
	<li>Wash the RNA pellet by adding 3 volumes of 100% ethanol (approximately 1 mL, diluted using DEPC water) and mix the sample by vortexing until the pellet is released and floats from the bottom.</li>
	<li>Centrifuge at 7,500 x g for 5 min at 4 &#176;C.</li>
	<li>Wash the RNA pellet 1x by adding 1 mL of 75% ethanol and mix the sample by vortexing until the pellet is released and floats from the bottom. Repeat the centrifugation as described in step 4.17.</li>
	<li>Perform an additional 5 s centrifugation spin to collect residual liquid from the side of the tube and remove any residual liquid with a pipette without disturbing the pellet.</li>
	<li>Briefly air-dry the RNA pellet by opening the cap of the tube at room temperature for 3-5 min and dissolve the RNA pellet in 20-50 &#181;L of RNase-free DEPC-treated water. Incubate the RNA for 10 min at 55-60 &#176;C to facilitate resuspension of the pellet.</li>
</ol>
5. Determination of total RNA concentration and quality
<ol>
	<li>Determine the RNA concentration by measuring the absorbance at 260 nm and 280 nm using a spectrophotometer. Obtain full-spectral data before using the samples in downstream applications.</li>
	<li>Control the RNA quality by resolving 800-1000 ng on a 1.5% agarose gel using 0.5X TBE buffer (45 mM Tris base, 45 mM boric acid, 1 mM EDTA). Total RNA separates into two bands referring to 28S and 18S rRNAs.
	<ol>
		<li>Make all reagents and wash all equipment used for running the gel with DEPC-treated water. DEPC-treated water is prepared in the hood by adding 1 mL of diethylpyrocarbonate to 1000 mL of ultra-pure water. Incubate for ~2 h at room temperature or at 37 &#176;C and autoclave. Store at room temperature for up to 10 months. 
		NOTE: Electrophoresis of mammalian total RNAs leads to the separation of 28S and 18S rRNAs at a ratio of approximately 2:1. The bands should be intact and visible as two sharp bands. Degraded RNA will result in blurry bands.</li>
	</ol>
	</li>
</ol>
6. Reverse transcription
<ol>
	<li>Set the reverse transcription reaction using 1 &#181;g of total RNA.</li>
	<li>Perform reverse transcription (RT) using reverse transcriptase enzyme (see Table of Materials) and 50 ng/&#181;L random decamer primers.
	<ol>
		<li>Mix RNA, random primers, and 1 mM dNTP mix (10 mM) in 10 &#181;L. Incubate at 65 &#176;C for 5 min and on ice for 1 min. Add the following reagents: 1x RT buffer, 5 mM MgCl2, 10 mM DTT, 40 U of RNase inhibitor, and 200 U of Reverse Transcriptase.</li>
		<li>Incubate for 10 min at 25 &#176;C and for 1 h at 50 &#176;C (temperatures may change if different enzymes are used). Terminate the reaction by incubating at 85 &#176;C for 5 min. cDNAs can be stored at &#8722;20 &#176;C.</li>
	</ol>
	</li>
</ol>
7. Quantitative PCR
<ol>
	<li>To assemble the reaction in a final volume of 15 &#181;L, mix 3 &#181;L of cDNA (100 ng/&#181;L), 3.2 pmol of each primer, 6 &#181;L of master mix containing the dNTPs and enzyme, and 2.8 &#181;L of ultrapure water. 
	NOTE: Use primers for endogenous constitutive genes as controls (housekeeping genes) to normalize the expression levels of HuR mRNA and miRNAs. &#946;-Actin and snRNA U6 (RNU6B) are available options for the normalization of mRNAs and miRNAs, respectively, but other genes might also be suitable depending on the case.</li>
	<li>Quantify the expression levels using the delta-delta Ct (2-&#916;&#916;Ct) method20.</li>
</ol>
8. The reporter assay
<ol>
	<li>Cells used for the assay
	<ol>
		<li>Transfect the plasmids in HeLa-Cre cells as follows. Transfect with pTK-Renilla (40 ng), then pRD-miR-17-92, generating HeLa-Cre-miR-17-92, and selecting with 1 &#181;g/mL puromycin.</li>
		<li>Transfect HeLa-Cre-miR-17-92-pTK-Renilla with pmiRGLO-RAP-IB-3&#697;-UTR or pmiRGLO-scrambled-3&#697;-UTR, separately. Select using penicillin (100 U/mL) and streptomycin (100 &#181;g/mL). These transfections generate Luc-RAP-1-B and Luc-scrambled.</li>
		<li>Transfect the cells with pFLAG-HuR or empty pFLAG (step 3).</li>
		<li>Proceed to cell culture, as detailed in step 2.2., with HeLa-Cre miR-17-92-luc, HeLa-Cre miR-17-92-scrambled, HeLa-Cre miR-17-92-HuR, and HeLa-Cre miR-17-92-HuR-luc until approximately 80% of confluence. Induce with 1 &#181;L of doxycycline (1 &#181;g/mL) for 30 min at 37 &#176;C. Also, keep all the cells without doxycycline as controls, for the same period. 
		NOTE: The final concentration of doxycycline depends on the cell line of choice. An excess of doxycycline can be toxic for mammalian cells.</li>
	</ol>
	</li>
	<li>Luminescent assay
	<ol>
		<li>To quantify and compare different luminescence intensities, use the Dual-luciferase reporter assay kit. Thaw luciferase assay solutions and leave them at room temperature before beginning the assay.</li>
		<li>Prepare the mix Stop and Glo (blue cap tubes) by mixing 200 &#181;L of the substrate in 10 mL of Luciferase Assay Buffer II. Prepare the mix LAR II (green cap tubes) by mixing 10 mL of Luciferase Assay Buffer II into the amber vial of Luciferase Assay Substrate II and shake well.</li>
		<li>Transfer the solutions to 15 mL centrifuge tubes previously identified and protected from light. 
		NOTE: As an alternative, the solutions can be previously prepared in 1-2 mL aliquots and frozen at &#8722;80 &#176;C protected from light in aluminum foil.</li>
		<li>Perform the luminescence readings using an equipment such as Synergy; measure expressed luciferase as relative light units (RLU).</li>
		<li>Export the results to a spreadsheet for further statistical analysis.</li>
		<li>Perform normalization of firefly-luciferase activity by the control Renilla (luciferase/Renilla) and plot that as relative light units (RLU) in a graphic. Repeat this for groups with and without doxycycline induction.</li>
		<li>Calculate the mean and standard error of the mean (SEM). Perform a Student&#39;s t-test or two-way ANOVA followed by Tukey&#39;s post-test to allow group comparison. These analyses are available in a package such as GraphPad Prism. Differences at p-values &#60; 0.05 are considered significant.</li>
	</ol>
	</li>
</ol>

<ol>
	<li>Wilkinson, M. E., Charenton, C., Nagai, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+splicing+by+the+spliceosome.">RNA splicing by the spliceosome.</a> Annual Review of Biochemistry. 89, 359-388 (2020).</li><li>Will, C. L., Luhrmann, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spliceosome+structure+and+function.">Spliceosome structure and function.</a> Cold Spring Harbor Perspectives in Biology. 3 (7), 003707 (2011).</li><li>Zhang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+atomic+structure+of+the+human+spliceosome.">An atomic structure of the human spliceosome.</a> Cell. 169 (5), 918-929 (2017).</li><li>Staley, J. P., Guthrie, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanical+devices+of+the+spliceosome:+Motors,+clocks,+springs,+and+things.">Mechanical devices of the spliceosome: Motors, clocks, springs, and things.</a> Cell. 92 (3), 315-326 (1998).</li><li>Kornblihtt, A. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+splicing:+a+pivotal+step+between+eukaryotic+transcription+and+translation.">Alternative splicing: a pivotal step between eukaryotic transcription and translation.</a> Nature Reviews Molecular Cell Biology. 14 (3), 153-165 (2013).</li><li>Wang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+complex+network+of+factors+with+overlapping+affinities+represses+splicing+through+intronic+elements.">A complex network of factors with overlapping affinities represses splicing through intronic elements.</a> Nature Structural &amp; Molecular Biology. 20 (1), 36-45 (2013).</li><li>Mukherjee, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+regulatory+mapping+indicates+that+the+RNA-binding+protein+HuR+couples+pre-mRNA+processing+and+mRNA+stability.">Integrative regulatory mapping indicates that the RNA-binding protein HuR couples pre-mRNA processing and mRNA stability.</a> Molecular Cell. 43 (3), 327-339 (2011).</li><li>Pandit, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+analysis+reveals+SR+protein+cooperation+and+competition+in+regulated+splicing.">Genome-wide analysis reveals SR protein cooperation and competition in regulated splicing.</a> Molecular Cell. 50 (2), 223-235 (2013).</li><li>Gatti da Silva, G. H., Dos Santos, M. G. P., Nagasse, H. Y., Coltri, P. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+antigen+R+(HuR)+facilitates+miR-19+synthesis+and+affects+cellular+kinetics+in+papillary+thyroid+cancer.">Human antigen R (HuR) facilitates miR-19 synthesis and affects cellular kinetics in papillary thyroid cancer.</a> Cellular Physiology and Biochemistry. 56, 105-119 (2022).</li><li>Westholm, J. O., Lai, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mirtrons:+MicroRNA+biogenesis+via+splicing.">Mirtrons: MicroRNA biogenesis via splicing.</a> Biochimie. 93 (11), 1897-1904 (2011).</li><li>Michlewski, G., C&#225;ceres, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Post-transcriptional+control+of+miRNA+biogenesis.">Post-transcriptional control of miRNA biogenesis.</a> RNA. 25 (1), 1-16 (2019).</li><li>Bartel, D. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNAs:+Target+recognition+and+regulatory+functions.">MicroRNAs: Target recognition and regulatory functions.</a> Cell. 136 (2), 215-233 (2009).</li><li>Esquela-Kerscher, A., Slack, F. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oncomirs+-+MicroRNAs+with+a+role+in+cancer.">Oncomirs - MicroRNAs with a role in cancer.</a> Nature Reviews Cancer. 6 (4), 259-269 (2006).</li><li>Lin, S., Gregory, R. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+biogenesis+pathways+in+cancer.">MicroRNA biogenesis pathways in cancer.</a> Nature Reviews Cancer. 15 (6), 321-333 (2015).</li><li>Curtis, H. J., Sibley, C. R., Wood, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mirtrons,+an+emerging+class+of+atypical+miRNA.">Mirtrons, an emerging class of atypical miRNA.</a> Wiley Interdisciplinary Reviews. RNA. 3 (5), 617-632 (2012).</li><li>Alarcon, C. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HNRNPA2B1+is+a+mediator+of+m(6)A-dependent+nuclear+RNA+processing+events.">HNRNPA2B1 is a mediator of m(6)A-dependent nuclear RNA processing events.</a> Cell. 162 (6), 1299-1308 (2015).</li><li>Paiva, M. M., Kimura, E. T., Coltri, P. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=miR18a+and+miR19a+recruit+specific+proteins+for+splicing+in+thyroid+cancer+cells.">miR18a and miR19a recruit specific proteins for splicing in thyroid cancer cells.</a> Cancer Genomics and Proteomics. 14 (5), 373-381 (2017).</li><li>He, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+microRNA+polycistron+as+a+potential+human+oncogene.">A microRNA polycistron as a potential human oncogene.</a> Nature. 435 (7043), 828-833 (2005).</li><li>Olive, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=miR-19+is+a+key+oncogenic+component+of+mir-17-92.">miR-19 is a key oncogenic component of mir-17-92.</a> Genes &amp; Development. 23 (24), 2839-2849 (2009).</li><li>Livak, K. J., Schmittgen, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+relative+gene+expression+data+using+real-time+quantitative+PCR+and+the+2(-Delta+Delta+C(T))+Method.">Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.</a> Methods. 25 (4), 402-408 (2001).</li><li>Khandelia, P., Yap, K., Makeyev, E. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Streamlined+platform+for+short+hairpin+RNA+interference+and+transgenesis+in+cultured+mammalian+cells.">Streamlined platform for short hairpin RNA interference and transgenesis in cultured mammalian cells.</a> Proceedings of the National Academy of Sciences of the United States of America. 108 (31), 12799-12804 (2011).</li><li>Huelga, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genome-wide+analysis+reveals+cooperative+regulation+of+alternative+splicing+by+hnRNP+proteins.">Integrative genome-wide analysis reveals cooperative regulation of alternative splicing by hnRNP proteins.</a> Cell Reports. 1 (2), 167-178 (2012).</li><li>Karni, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+gene+encoding+the+splicing+factor+SF2/ASF+is+a+proto-oncogene.">The gene encoding the splicing factor SF2/ASF is a proto-oncogene.</a> Nature Structural &amp; Molecular Biology. 14 (3), 185-193 (2007).</li><li>Franca, G. S., Vibranovski, M. D., Galante, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host+gene+constraints+and+genomic+context+impact+the+expression+and+evolution+of+human+microRNAs.">Host gene constraints and genomic context impact the expression and evolution of human microRNAs.</a> Nature Communications. 7, 11438 (2016).</li><li>Havens, M. A., Reich, A. A., Hastings, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drosha+promotes+splicing+of+a+pre-microRNA-like+alternative+exon.">Drosha promotes splicing of a pre-microRNA-like alternative exon.</a> PLoS Genetics. 10 (5), 1004312 (2014).</li><li>Grammatikakis, I., Abdelmohsen, K., Gorospe, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Posttranslational+control+of+HuR+function.">Posttranslational control of HuR function.</a> Wiley Interdisciplinary Reviews. RNA. 8 (1), (2017).</li><li>Chang, S. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ELAVL1+regulates+alternative+splicing+of+eIF4E+transporter+to+promote+postnatal+angiogenesis.">ELAVL1 regulates alternative splicing of eIF4E transporter to promote postnatal angiogenesis.</a> Proceedings of the National Academy of Sciences of the United States of America. 111 (51), 18309-18314 (2014).</li><li>Huang, Y. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delivery+of+therapeutics+targeting+the+mRNA-binding+protein+HuR+using+3DNA+nanocarriers+suppresses+ovarian+tumor+growth.">Delivery of therapeutics targeting the mRNA-binding protein HuR using 3DNA nanocarriers suppresses ovarian tumor growth.</a> Cancer Research. 76 (6), 1549-1559 (2016).</li><li>Wang, W., Caldwell, M. C., Lin, S., Furneaux, H., Gorospe, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HuR+regulates+cyclin+A+and+cyclin+B1+mRNA+stability+during+cell+proliferation.">HuR regulates cyclin A and cyclin B1 mRNA stability during cell proliferation.</a> The EMBO Journal. 19 (10), 2340-2350 (2000).</li><li>Guo, X., Connick, M. C., Vanderhoof, J., Ishak, M. A., Hartley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA-16+modulates+HuR+regulation+of+cyclin+E1+in+breast+cancer+cells.">MicroRNA-16 modulates HuR regulation of cyclin E1 in breast cancer cells.</a> International Journal of Molecular Sciences. 16 (4), 7112-7132 (2015).</li></ol>

The authors have no conflicts of interest.

Pre-mRNA splicing is an important process for gene expression regulation, and its control can trigger strong effects on cell phenotypic modifications22,23. More than 70% of miRNAs are transcribed from introns in humans, and we hypothesized that their processing and maturation could be facilitated by splicing regulatory proteins24,25. We developed a method to analyze intronic miRNA processing and function in cultured cells. Our assay uses four different plasmids and allows us to test the maturation of endogenous and exogenous or induced miRNAs. The method described here can be performed in 2-3 days and does not require expensive reagents.
Considering HuR is an RNA binding protein important for mRNA stability and is immune-precipitated with miR-18 and miR-19a miRNAs17, this assay tested if it could drive intronic miRNA biogenesis and maturation. HuR is not found in the core of spliceosomes but interacts with proteins involved with mRNA stabilization26. Consistently, overexpression of HuR has been associated with the development of ovary and bladder cancers27,28. In papillary thyroid cancer cells, we observed that HuR increases cell proliferation, migration, and invasion9. HuR also affects the mRNA stability of cell cycle regulators such as PTEN, cyclin A2, and cyclin D2, increasing cell proliferation and migration and leading to tumorigenic characteristics29,30. However, a significant part of these mRNAs also have target sequences for miR-19a and miR-19b. Notably, HuR can bind to the intronic region where these miRNAs are transcribed, leading to the notion that it can control the splicing and maturation of these miRNAs and, consequently, enhance tumorigenic features.
In order to test that, this assay was developed with four different plasmids. The first contains the miRNA cluster miR-17-92 inserted inside an intron, and its expression is controlled upon doxycycline addition. The second plasmid is the commercial pmiR-GLO carrying the target sequence next to the 3&#39; of the luc2 gene. Binding of the miRNA to this target sequence affects luc2 expression, which can be measured upon a luminescence assay. The third plasmid is pFLAG-HuR, which induces the overexpression of this regulatory protein. Finally, pTK-Renilla is also used to include the Renilla luciferase fluorescence. Our results indicated that HuR stimulates miR-17-92 expression and increases the association of its components with the target sequences, therefore resulting in mature and functional miRNA molecules. We describe the association of HuR with miRNA in another paper9. The target sequences used in this study were specific to miR-19a and miR-19b miRNAs. However, this method can also be adapted to the use of shorter or longer target sequences, including multiple target sites. In this case, unspecific binding of endogenous miRNAs to the target sequence or sequences nearby must be considered in the analysis. The sequences used might have other possible target sites, which might affect luciferase activity. The method described here could also be used to validate different targets of a miRNA or a group of miRNAs transcribed together, enabling functional studies of miRNAs and their specific phenotypic alterations. It should also be noted that it allows the results to be compared among different cell lines and genetic backgrounds.
The most critical steps for the broader use of this protocol in mammalian cells are the efficiency of the transfection and induction steps. Since different plasmids are transfected into the cells, adequate controls are also critical. These parameters change with the size of the plasmids and are affected by the extensive time in cell culture. Therefore, an important point to be considered before beginning the assay is the ease of transfection of the chosen cells. Additionally, the extensive use of different antibiotics to select for the different plasmids (gentamicin, puromycin, and doxycycline) and activate the expression can be harmful to cells and reduce the efficiency of the following experiments. It is important that this assay is first optimized with cells with known transfection efficiency.
The reporter successfully showed that increased HuR expression could induce miRNA biogenesis and confirmed its functional maturation. Importantly, overexpression of HuR did not affect the amount of intron produced since we did not observe reduced luciferase activity in this condition (Figure 4). Further experiments can be performed to characterize RBPs and miRNAs using this reporter system. For example, it would be important to create single mutations in miRNA sequences or in their flanking regions and analyze the impact of regulatory proteins in miRNA biogenesis. This would allow the specific characterization of the biogenesis of individual miRNAs and could also improve the knowledge on conserved sequences for miRNA processing and maturation.
We consider this is an important methodological contribution toward the study of miRNA biogenesis and maturation and the role of splicing regulatory proteins in these processes. It could also be applied to studies on the regulation and control of mRNAs and miRNAs in different types of cells.

Precursor mRNA splicing is an important process for gene expression regulation in eukaryotes1. The removal of introns and the union of exons in mature RNA is catalyzed by the spliceosome, a 2 megadalton ribonucleoprotein complex composed of 5 snRNAs (U1, U2, U4, U5, and U6) along with more than 100 proteins2,3. The splicing reaction occurs co-transcriptionally, and the spliceosome is assembled at each new intron guided by the recognition of conserved splice sites at exon-intron boundaries and within the intron4. Different introns might have different splicing rates despite the remarkable conservation of the spliceosome complex and its components. In addition to the differences in splice site conservation, regulatory sequences distributed on introns and exons can guide RNA-binding proteins (RBP) and stimulate or repress splicing5,6. HuR is a ubiquitously expressed RBP and is an important factor to control mRNA stability7. Previous results from our group showed that HuR can bind to introns containing miRNAs, indicating this protein might be an important factor to facilitate miRNA processing and maturation, also leading to the generation of alternative splicing isoforms6,8,9.
Many microRNAs (miRNAs) are coded from intronic sequences. Whereas some are part of the intron, others are known as "mirtrons" and are formed by the entire intron10,11. miRNAs are short non-coding RNAs, ranging from 18 to 24 nucleotides in length12. Their mature sequence shows partial or total complementarity with target sequences in mRNAs, therefore affecting translation and/or mRNA decay rates. The combinations of miRNAs and targets drive the cell to different outcomes. Several miRNAs can drive cells to pro- or anti-tumoral phenotypes13. Oncogenic miRNAs usually target mRNAs that trigger a suppressive characteristic, leading to increased cellular proliferation, migration, and invasion14. On the other hand, tumor-suppressive miRNAs might target oncogenic mRNAs or mRNAs related to increased cell proliferation. 
The processing and maturation of miRNAs are also dependent on their origin. Most intronic miRNAs are processed with the participation of the microprocessor, formed by the ribonuclease Drosha and protein co-factors12. Mirtrons are processed with the activity of the spliceosome independently of Drosha15. Considering the high frequency of miRNAs found within introns, we hypothesized that RNA-binding proteins involved with splicing could also facilitate the processing and maturation of these miRNAs. Notably, the RBP hnRNP A2/B1 has already been associated with the microprocessor and miRNA biogenesis16. 
We have previously reported that several RNA-binding proteins, such as hnRNPs and HuR, are associated with intronic miRNAs by mass spectrometry17. HuR's (ELAVL1) association with miRNAs from the miR-17-92 intronic cluster was confirmed using immunoprecipitation and in silico analysis9. miR-17-92 is an intronic miRNA cluster composed of six miRNAs with increased expression in different cancers18,19. This cluster is also known as "oncomiR-1" and is composed of miR-17, miR-18a, miR-19a, miR-20, miR-19b, and miR-92a. miR-19a and miR-19b are among the most oncogenic miRNAs of this cluster19. The increased expression of HuR stimulates miR-19a and miR-19b synthesis9. Since intronic regions flanking this cluster are associated with HuR, we developed a method to investigate if this protein could regulate miR-19a and miR-19b expression and maturation. One important prediction of our hypothesis was that, as a regulatory protein, HuR could facilitate miRNA biogenesis, leading to phenotypic alterations. One possibility was that miRNAs were processed by the stimulation of HuR but would not be mature and functional and, therefore, the effects of the protein would not directly impact the phenotype. Therefore, we developed a splicing reporter assay to investigate whether an RBP such as HuR could affect the biogenesis and maturation of an intronic miRNA. By confirming miRNA processing and maturation, our assay shows the interaction with the target sequence and the generation of a mature and functional miRNA. In our assay, we couple the expression of an intronic miRNA cluster with a luciferase plasmid to check for miRNA target-binding in cultured cells.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Recombinant DNA</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>pCAGGS-Cre (Cre- encoding plasmid)</td>
			<td></td>
			<td></td>
			<td>A kind gift from E. Makeyev from Khandelia et al., 2011</td>
		</tr>
		<tr>
			<td>pFLAG-HuR</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>pmiRGLO-RAP-IB</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>pmiRGLO-scrambled</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>pRD-miR-17-92</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>pRD-RIPE-donor</td>
			<td></td>
			<td></td>
			<td>A kind gift from E. Makeyev from Khandelia et al., 2011</td>
		</tr>
		<tr>
			<td>pTK-Renilla</td>
			<td>Promega</td>
			<td>E2241</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibodies</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>anti-B-actin</td>
			<td>Sigma Aldrich</td>
			<td>A5316</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-HuR</td>
			<td>Cell Signaling</td>
			<td>mAb&#160;12582</td>
			<td></td>
		</tr>
		<tr>
			<td>IRDye 680CW Goat anti-mouse IgG</td>
			<td>Li-Cor Biosciences</td>
			<td>926-68070</td>
			<td></td>
		</tr>
		<tr>
			<td>IRDye 800CW Goat anti-rabbit IgG</td>
			<td>Li-Cor Biosciences</td>
			<td>929-70020</td>
			<td></td>
		</tr>
		<tr>
			<td>Experimental Models: Cell Lines</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>HeLa-Cre</td>
			<td></td>
			<td></td>
			<td>A kind gift from E. Makeyev from Khandelia et al., 2011</td>
		</tr>
		<tr>
			<td>HeLa-Cre miR17-92</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>HeLa-Cre miR17-92-HuR</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>HeLa-Cre miR17-92-HuR-luc</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>HeLa-Cre miR17-92-luc</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>HeLa-Cre miR17-92-scrambled</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>Chemicals and Peptides</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM/high-glucose</td>
			<td>Thermo Fisher Scientific</td>
			<td>12800-017</td>
			<td></td>
		</tr>
		<tr>
			<td>Doxycycline</td>
			<td>BioBasic</td>
			<td>MB719150</td>
			<td></td>
		</tr>
		<tr>
			<td>Dual-Glo Luciferase Assay System</td>
			<td>Promega</td>
			<td>E2940</td>
			<td></td>
		</tr>
		<tr>
			<td>EcoRI</td>
			<td>Thermo Fisher Scientific</td>
			<td>ER0271</td>
			<td></td>
		</tr>
		<tr>
			<td>EcoRV</td>
			<td>Thermo Fisher Scientific</td>
			<td>ER0301</td>
			<td></td>
		</tr>
		<tr>
			<td>Geneticin</td>
			<td>Thermo Fisher Scientific</td>
			<td>E859-EG</td>
			<td></td>
		</tr>
		<tr>
			<td>L-glutamine</td>
			<td>Life Technologies</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Opti-MEM I</td>
			<td>Life Technologies</td>
			<td>31985-070</td>
			<td></td>
		</tr>
		<tr>
			<td>pFLAG-CMV&#8482;-3 Expression Vector</td>
			<td>Sigma Aldrich</td>
			<td>E6783</td>
			<td></td>
		</tr>
		<tr>
			<td>pGEM-T</td>
			<td>Promega</td>
			<td>A3600</td>
			<td></td>
		</tr>
		<tr>
			<td>Platinum Taq DNA polymerase</td>
			<td>Thermo Fisher Scientific</td>
			<td>10966-030</td>
			<td></td>
		</tr>
		<tr>
			<td>pmiR-GLO</td>
			<td>Promega</td>
			<td>E1330</td>
			<td></td>
		</tr>
		<tr>
			<td>Puromycin</td>
			<td>Sigma Aldrich</td>
			<td>P8833</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAse OUT</td>
			<td>Thermo Fisher Scientific</td>
			<td>752899</td>
			<td></td>
		</tr>
		<tr>
			<td>SuperScript IV kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>18091050</td>
			<td></td>
		</tr>
		<tr>
			<td>Trizol-LS reagent</td>
			<td>Thermo Fisher</td>
			<td>10296-028</td>
			<td></td>
		</tr>
		<tr>
			<td>trypsin/EDTA 10X</td>
			<td>Life Technologies</td>
			<td>15400-054</td>
			<td></td>
		</tr>
		<tr>
			<td>XbaI</td>
			<td>Thermo Fisher Scientific</td>
			<td>10131035</td>
			<td></td>
		</tr>
		<tr>
			<td>XhoI</td>
			<td>Promega</td>
			<td>R616A</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotides</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>forward RAP-1B pmiRGLO</td>
			<td>Exxtend</td>
			<td>TCGAGTAGCGGCCGCTAGTAAG 
			CTACTATATCAGTTTGCACAT</td>
			<td></td>
		</tr>
		<tr>
			<td>reverse RAP-1B pmiRGLO</td>
			<td>Exxtend</td>
			<td>CTAGATGTGCAAACTGATATAGT 
			AGCTTACTAGCGGCCGCTAC</td>
			<td></td>
		</tr>
		<tr>
			<td>forward scrambled pmiRGLO</td>
			<td>Exxtend</td>
			<td>TCGAGTAGCGGCCGCTAGTAA 
			GCTACTATATCAGGGGTAAAAT</td>
			<td></td>
		</tr>
		<tr>
			<td>reverse scrambled pmiRGLO</td>
			<td>Exxtend</td>
			<td>CTAGATTTTACCCCTGATATAGT 
			AGCTTACTAGCGGCCGCTAC</td>
			<td></td>
		</tr>
		<tr>
			<td>forward HuR pFLAG</td>
			<td>Exxtend</td>
			<td>GCCGCGAATTCAATGTCTAAT 
			GGTTATGAAGAC</td>
			<td></td>
		</tr>
		<tr>
			<td>reverse HuR pFLAG</td>
			<td>Exxtend</td>
			<td>GCGCTGATATCGTTATTTGTG 
			GGACTTGTTGG</td>
			<td></td>
		</tr>
		<tr>
			<td>forward pre-miR-1792 pRD-RIPE</td>
			<td>Exxtend</td>
			<td>ATCCTCGAGAATTCCCATTAG 
			GGATTATGCTGAG</td>
			<td></td>
		</tr>
		<tr>
			<td>reverse pre-miR-1792 pRD-RIPE</td>
			<td>Exxtend</td>
			<td>ACTAAGCTTGATATCATCTTG 
			TACATTTAACAGTG</td>
			<td></td>
		</tr>
		<tr>
			<td>forward snRNA U6 (RNU6B)</td>
			<td>Exxtend</td>
			<td>CTCGCTTCGGCAGCACATATAC</td>
			<td></td>
		</tr>
		<tr>
			<td>reverse snRNA U6 (RNU6B)</td>
			<td>Exxtend</td>
			<td>GGAACGCTTCACGAATTTGCGTG</td>
			<td></td>
		</tr>
		<tr>
			<td>forward B-Actin qPCR</td>
			<td>Exxtend</td>
			<td>ACCTTCTACAATGAGCTGCG</td>
			<td></td>
		</tr>
		<tr>
			<td>reverse B-Actin qPCR</td>
			<td>Exxtend</td>
			<td>CCTGGATAGCAACGTACATGG</td>
			<td></td>
		</tr>
		<tr>
			<td>forward HuR qPCR</td>
			<td>Exxtend</td>
			<td>ATCCTCTGGCAGATGTTTGG</td>
			<td></td>
		</tr>
		<tr>
			<td>reverse HuR qPCR</td>
			<td>Exxtend</td>
			<td>CATCGCGGCTTCTTCATAGT</td>
			<td></td>
		</tr>
		<tr>
			<td>forward pre-miR-1792 qPCR</td>
			<td>Exxtend</td>
			<td>GTGCTCGAGACGAATTCGTCA 
			GAATAATGTCAAAGTG</td>
			<td></td>
		</tr>
		<tr>
			<td>reverse pre-miR-1792 qPCR</td>
			<td>Exxtend</td>
			<td>TCCAAGCTTAAGATATCCCAAAC 
			TCAACAGGCCG</td>
			<td></td>
		</tr>
		<tr>
			<td>Software and Algorithms</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Prism 8 for Mac OS X</td>
			<td>Graphpad</td>
			<td>https://www.graphpad.com</td>
			<td></td>
		</tr>
		<tr>
			<td>ImageJ</td>
			<td>National Institutes of Health</td>
			<td>http://imagej.nih.gov/ij</td>
			<td></td>
		</tr>
	</tbody>
</table>

a reporter assay to analyze intronic microrna maturation in mammalian cells

MicroRNAs (miRNAs) are short RNA molecules that are widespread in eukaryotes. Most miRNAs are transcribed from introns, and their maturation involves different RNA-binding proteins in the nucleus. Mature miRNAs frequently mediate gene silencing, and this has become an important tool for comprehending post-transcriptional events. Besides that, it can be explored as a promising methodology for gene therapies. However, there is currently a lack of direct methods for assessing miRNA expression in mammalian cell cultures. Here, we describe an efficient and simple method that aids in determining miRNA biogenesis and maturation through confirmation of its interaction with target sequences. Also, this system allows the separation of exogenous miRNA maturation from its endogenous activity using a doxycycline-inducible promoter capable of controlling primary miRNA (pri-miRNA) transcription with high efficiency and low cost. This tool also allows modulation with RNA-binding proteins in a separate plasmid. In addition to its use with a variety of different miRNAs and their respective targets, it can be adapted to different cell lines, provided these are amenable to transfection.

Our initial hypothesis was that HuR could facilitate intronic miRNA biogenesis by binding to its pre-miRNA sequence. Thus, the connection of HuR expression and miR-17-92 cluster biogenesis could point to a new mechanism governing the maturation of these miRNAs. Overexpression of HuR upon transfection of pFLAG-HuR was confirmed in three different cell lines: HeLa, BCPAP, and HEK-293T (Figure 2). As controls, untransfected cells and cells transfected with empty pFLAG vectors were used. Importantly, we observed that HuR overexpression in these cells stimulates the expression of miR-19a (Supplementary Table 1 results reported in Gatti da Silva et al.9).
To confirm that the induced miRNAs were genuinely functional, an in vitro reporter system was designed, as described here. The artificial intron in pRD-RIPE separates two coding regions of eGFP. This cassette is under the control of a tetracycline responsive element (TRE). The expression of eGFP is, thus, controlled by the presence of the antibiotic doxycycline (DOX) in the cell medium (Figure 3).
An in silico search using miRbase and TargetScan revealed possible mRNA targets for miR-19a and miR-19b (components of the miR-17-92 cluster). As a potential target for both miRNAs, the sequence 5&#39; TTTGCACA 3&#39;, found on the RAP-IB 3&#39; UTR region, was chosen (Supplementary Table 2). RAP-IB is a GTPase member of the Ras-associated protein family (RAS). The induced miRNAs were correctly processed and functional in our assay as it hybridized to the target sequence cloned next to luciferase (see Figure 3, pmiR-GLO target). Therefore, it blocked luciferase translation, which was reflected in reduced luciferase activity (Figure 3). As a control for this assay, we scrambled the target sequence, replacing it for 5&#39; GGGTAAA 3&#39; in Luc-scrambled plasmid (target and scrambled sequences are underlined in the oligos sequences in the Table of Materials).
In regular conditions and without induction of the pRD-miR-17-92 plasmid, endogenous miR-19a and/ or miR-19b found the target on pmiR-GLO, which led to reduced luciferase activity (data not shown). After DOX supplementation, a slight and not statistically significant reduction in luciferase activity was observed in cells with a scrambled target sequence. This might be due to the presence of target sequences for other miRNAs in this sequence. A strong reduction in luciferase activity was observed with RAP-IB 3&#39;UTR upon increased miR-19a and miR-19b expression from pRD-miR-17-92 in comparison to HeLa-Cre cells (see Figure 4, compare orange and black bars). The transfection of pFLAG-HuR in these cells by itself did not change the luciferase activity (see Figure 4, compare gray and black bars). However, overexpression of HuR coupled with doxycycline supplementation, stimulating expression of the miR-17-92 cluster, further reduced luciferase activity (see Figure 4, compare gray and red bars). This indicates a positive regulation of HuR over miR-19a and miR-19b, coupled with correct processing and maturation of these miRNAs, which were able to successfully find their targets (HeLa-Cre miR-17-92-HuR-luc) (see Figure 4).
The use of this reporter system confirmed that HuR induces expression and proper maturation of miR-19a and miR-19b in HeLa cells.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/63498/63498fig01.jpg" /> 
Figure 1: A conceptual overview of the protocol described here. Plasmids containing the miRNA, target sequence, regulatory protein, and pTK-Renilla were transfected in cultured cells. After antibiotic selection, these cells were used for inducing miRNA expression (with doxycycline), with subsequent quantification of luciferase activity, and for RNA analysis to confirm HuR overexpression. <a href="https://www.jove.com/files/ftp_upload/63498/63498fig01large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/63498/63498fig02.jpg" /> 
Figure 2: Confirmation of FLAG-HuR over-expression in (A) HeLa, (B) BCPAP, and (C) HEK293T cells by qPCR. Transfection with empty pFLAG was used as a control (white bars). &#946;-actin was used to normalize Ct values. The y-axis represents the fold change of expression calculated after normalization. The error bars represent standard errors calculated from three independent measurements. **P &#60;0.005, ****P &#60; 0.0005 (figure adapted from Gatti da Silva et al.9). <a href="https://www.jove.com/files/ftp_upload/63498/63498fig02large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/63498/63498fig03.jpg" /> 
Figure 3: Intronic miRNA reporter system. (A) Schematic representation of the pRD-RIPE plasmid that generated pRD-miR-17-92. pre-miR-17-92 was inserted inside the intron and was under the control of a dox-inducible promoter; on the right, the pmiR-GLO plasmid with RAP-IB 3&#39;UTR target sequence (pmiRGLO-RAP-IB); the control had the scrambled target sequence (pmiRGLO-scrambled). (B) Detail on the sequence of pmiRGLO-RAP-IB, focusing on the target sequence complementary to miR-19a and miR-19b. Luciferase activity is reduced upon the interaction of miRNA and the target (figure adapted from Gatti da Silva et al.9). <a href="https://www.jove.com/files/ftp_upload/63498/63498fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/63498/63498fig04.jpg" /> 
Figure 4: HeLa-Cre cells were co-transfected with reporter plasmids pTK-Renilla, pmiRGLO-RAP-IB, pmiRGLO-scrambled, pRD-miR-17-92, and pFLAG-HuR. Luciferase activity on untransfected HeLa-Cre cells (black), HeLa-Cre miR-17-92-scrambled (white), HeLa-Cre-HuR (gray), HeLa-Cre miR-17-92-luc (orange), and HeLa-Cre miR-17-92-HuR-luc (red). Luciferase activity was quantified as described in the protocol as the relative activity of firefly luciferase to Renilla luciferase (observed with pTK-Renilla) and normalized after doxycycline addition. It is shown as &#34;relative light units&#34; (RLU) on the y-axis. **P &#60; 0.005; ****P &#60; 0.0005 (figure adapted from Gatti da Silva et al.9). <a href="https://www.jove.com/files/ftp_upload/63498/63498fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Supplementary Table 1: Raw Ct values observed for qPCR to analyze miR-19 expression. <a href="https://www.jove.com/files/ftp_upload/63498/Supplementary table1_R2.zip" target="_blank">Please click here to download this Table.</a>
Supplementary Table 2: RAP-IB 3&#39;UTR sequence and miR-19 target sequence. <a href="https://www.jove.com/files/ftp_upload/63498/Supplementary table 2_R2.zip" target="_blank">Please click here to download this Table.</a>

Watch this Scientific Journal Video about A Reporter Assay to Analyze Intronic microRNA Maturation in Mammalian Cells at JoVE.com

A Reporter Assay to Analyze Intronic microRNA Maturation in Mammalian Cells

We developed an intronic microRNA biogenesis reporter assay to be used in cells in vitro with four plasmids: one with intronic miRNA, one with the target, one to overexpress a regulatory protein, and one for Renilla luciferase. The miRNA was processed and could control luciferase expression by binding to the target sequence.

MicroRNAs (miRNAs) are short RNA molecules that are widespread in eukaryotes. Most miRNAs are transcribed from introns, and their maturation involves ...

a-reporter-assay-to-analyze-intronic-microrna-maturation-mammalian

Nanyang Technological University

Research

JoVE Journal

Cancer Research

1.9K Views.  Universidade de São Paulo. We developed an intronic microRNA biogenesis reporter assay to be used in cells in vitro with four plasmids: one with intronic miRNA, one with the target, one to overexpress a regulatory protein, and one for Renilla luciferase. The miRNA was processed and could control luciferase expression by binding to the target sequence. 

Video: A Reporter Assay to Analyze Intronic microRNA Maturation in Mammalian Cells

Application of Laser Micro-irradiation for Examination of Single and Double Strand Break Repair in Mammalian Cells

Highly coordinated DNA repair pathways exist to detect, excise and replace damaged DNA bases, and coordinate repair of DNA strand breaks. While molecular biology techniques have clarified structure, enzymatic functions, and kinetics of repair proteins, there is still a need to understand how repair is coordinated within the nucleus. Laser micro-irradiation offers a powerful tool for inducing DNA damage and monitoring the recruitment of repair proteins. Induction of DNA damage by laser micro-irradiation can occur with a range of wavelengths, and users can reliably induce single strand breaks, base lesions and double strand breaks with a range of doses. Here, laser micro-irradiation is used to examine repair of single and double strand breaks induced by two common confocal laser wavelengths, 355 nm and 405 nm. Further, proper characterization of the applied laser dose for inducing specific damage mixtures is described, so users can reproducibly perform laser micro-irradiation data acquisition and analysis.

Confocal fluorescence microscopy and laser micro-irradiation offer tools for inducing DNA damage and monitoring the response of DNA repair proteins in selected sub-nuclear areas. This technique has significantly advanced our knowledge of damage detection, signaling, and recruitment. This manuscript demonstrates these technologies to examine single and double strand break repair.

Highly coordinated DNA repair pathways exist to detect, excise and replace damaged DNA bases, and coordinate repair of DNA strand breaks. While molecular ...

Using the Dot Assay to Analyze Migration of Cell Sheets

Although complex organisms appear static, their tissues are under a continuous turnover. As cells age, die, and are replaced by new cells, cells move within tissues in a tightly orchestrated manner. During tumor development, this equilibrium is disturbed, and tumor cells leave the epithelium of origin to invade the local microenvironment, to travel to distant sites, and to ultimately form metastatic tumors at distant sites. The dot assay is a simple, two-dimensional unconstrained migration assay, to assess the net movement of cell sheets into a cell-free area, and to analyze parameters of cell migration using time-lapse imaging. Here, the dot assay is demonstrated using a human invasive, lung colony forming breast cancer cell line, MCF10CA1a, to analyze the cells' migratory response to epidermal growth factor (EGF), which is known to increase malignant potential of breast cancer cells and to alter the migratory phenotype of cells.

Cell migration is essential for development, tissue maintenance and repair, and tumorigenesis, and is regulated by growth factors, chemokines, and cytokines. This protocol describes the dot assay, a two-dimensional, unconstrained migration assay to assess the migratory phenotype of attached, cohesive cell sheets in response to microenvironmental cues.

Although complex organisms appear static, their tissues are under a continuous turnover. As cells age, die, and are replaced by new cells, cells move ...

Moving Upwards: A Simple and Flexible In Vitro Three-dimensional Invasion Assay Protocol

Although 3D invasion assays have been developed, the challenge remains to study cells without affecting the integrity of their microenvironment. Traditional 3D assays such as the Boyden Chamber require that cells are displaced from the original culture location and moved to a new environment. Not only does this disrupt the cellular processes that are intrinsic to the microenvironment, but it often results in a loss of cells. These problems are especially challenging when dealing with cells that are either rare, or extremely sensitive to their microenvironment. Here, we describe the development of a 3D invasion assay that avoids both concerns. In this assay, cells are plated within a small well and an ECM matrix containing a chemoattractant is laid atop the cells. This requires no cell displacement, and allows the cells to invade upwards into the matrix. In this assay, cell invasion as well as cell morphology can be assessed within the collagen gel. Using this assay, we characterize the invasive capacity of rare and sensitive cells; the hybrid cells resulting from fusion between breast cancer cells MCF7 and mesenchymal/multipotent stem/stroma cells (MSCs).

Moving Upwards: A Simple and Flexible In Vitro Three-dimensional Invasion Assay Protocol

This protocol describes an inverted vertical invasion assay that could be used to quantify the migration and invasion capabilities of cells in a three-dimensional setting while preserving the cell microenvironment. This assay is suitable for rare and/or sensitive cells.

Although 3D invasion assays have been developed, the challenge remains to study cells without affecting the integrity of their microenvironment. ...

Radionuclide-fluorescence Reporter Gene Imaging to Track Tumor Progression in Rodent Tumor Models

Metastasis is responsible for most cancer deaths. Despite extensive research, the mechanistic understanding of the complex processes governing metastasis remains incomplete. In vivo models are paramount for metastasis research, but require refinement. Tracking spontaneous metastasis by non-invasive in vivo imaging is now possible, but remains challenging as it requires long-time observation and high sensitivity. We describe a longitudinal combined radionuclide and fluorescence whole-body in vivo imaging approach for tracking tumor progression and spontaneous metastasis. This reporter gene methodology employs the sodium iodide symporter (NIS) fused to a fluorescent protein (FP). Cancer cells are engineered to stably express NIS-FP followed by selection based on fluorescence-activated cell sorting. Corresponding tumor models are established in mice. NIS-FP expressing cancer cells are tracked non-invasively in vivo at the whole-body level by positron emission tomography (PET) using the NIS radiotracer [18F]BF4-. PET is currently the most sensitive in vivo imaging technology available at this scale and enables reliable and absolute quantification. Current methods either rely on large cohorts of animals that are euthanized for metastasis assessment at varying time points, or rely on barely quantifiable 2D imaging. The advantages of the described method are: (i) highly sensitive non-invasive in vivo 3D PET imaging and quantification, (ii) automated PET tracer production, (iii) a significant reduction in required animal numbers due to repeat imaging options, (iv) the acquisition of paired data from subsequent imaging sessions providing better statistical data, and (v) the intrinsic option for ex vivo confirmation of cancer cells in tissues by fluorescence microscopy or cytometry. In this protocol, we describe all steps required for routine NIS-FP-afforded non-invasive in vivo cancer cell tracking using PET/CT and ex vivo confirmation of in vivo results. This protocol has applications beyond cancer research whenever in vivo localization, expansion and long-time monitoring of a cell population is of interest.

We describe a protocol for preclinical in vivo tracking of cancer metastasis. It is based on a radionuclide-fluorescence reporter combining the sodium iodide symporter, detected by non-invasive [18F]tetrafluoroborate-PET, and a fluorescent protein for streamlined ex vivo confirmation. The method is applicable for preclinical in vivo cell tracking beyond tumor biology.

Metastasis is responsible for most cancer deaths. Despite extensive research, the mechanistic understanding of the complex processes governing metastasis ...

Detection of a Circulating MicroRNA Custom Panel in Patients with Metastatic Colorectal Cancer

There is increasing interest in liquid biopsy for cancer diagnosis, prognosis and therapeutic monitoring, creating the need for reliable and useful biomarkers for clinical practice. Here, we present a protocol to extract, reverse transcribe and evaluate the expression levels of circulating miRNAs from plasma samples of patients with colorectal cancer (CRC). microRNAs (miRNAs) are a class of non-coding RNAs of 18-25 nucleotides in length that regulate the expression of target genes at the translational level and play an important role, including that of pro- and anti-angiogenic function, in the physiopathology of various organs. miRNAs are stable in biological fluids such as serum and plasma, which renders them ideal circulating biomarkers for cancer diagnosis, prognosis and treatment decision-making and monitoring. Circulating miRNA extraction was performed using a rapid and effective method that involves both organic and column-based methodologies. For miRNA retrotranscription, we used a multi-step procedure that considers polyadenylation at 3&#39; and the ligation of an adapter at 5&#39; of the mature miRNAs, followed by random miRNA pre-amplification. We selected a 24-miRNA custom panel to be tested by quantitative real-time polymerase chain reaction (qRT-PCR) and spotted the miRNA probes on array custom plates. We performed qRT-PCR plate runs on a real-time PCR System. Housekeeping miRNAs for normalization were selected using GeNorm software (v. 3.2). Data were analyzed using Expression suite software (v 1.1) and statistical analyses were performed. The method proved to be reliable and technically robust and could be useful to evaluate biomarker levels in liquid samples such as plasma and/or serum.

We present a protocol to evaluate the expression levels of circulating microRNA (miRNAs) in plasma samples from cancer patients. In particular, we used a commercially available kit for circulating miRNA extraction and reverse transcription. Finally, we analyzed a panel of 24 selected miRNAs using real-time pre-spotted probe custom plates.

There is increasing interest in liquid biopsy for cancer diagnosis, prognosis and therapeutic monitoring, creating the need for reliable and useful ...

Detecting the Ligand-binding Domain Dimerization Activity of Estrogen Receptor Alpha Using the Mammalian Two-Hybrid Assay

Estrogen receptor alpha (ER&#945;) is an estrogenic ligand-dependent transcription regulator. The sequence of ER&#945; protein is highly conserved among species. It has been thought that the function of human and mouse ER&#945;s is identical. We demonstrate the differential 4-hydroxy-tamoxifen (4OHT) effect on mouse and human ER&#945; ligand-binding domain (LBD) dimerization activity using the mammalian two-hybrid (M2H) assay. The M2H assay can demonstrate the efficiency of LBD homodimerization activity in mammalian cells, utilizing the transfection of two protein expression plasmids (GAL4 DNA-binding domain [DBD] fusion LBD and VP16 transactivation domain [VP16AD] fusion LBD) and a GAL4-responsive element (GAL4RE) fused luciferase reporter plasmid. When the GAL4DBD fusion LBD and the VP16AD fusion LBD make a dimer in the cells, this protein complex binds to the GAL4RE and, then, activates a luciferase gene expression through the VP16AD dependent transcription activity. The 4OHT-mediated luciferase activation is higher in the HepG2 cells that were transfected with the mouse ER&#945; LBD fusion protein expression plasmids than in the human ER&#945; LBD fusion protein expression plasmid transfected cells. This result suggests that the efficacy of the 4OHT-dependent mouse ER&#945; LBD homodimerization activity is higher than human ER&#945; LBD. In general, the utilization of the M2H assay is not ideal for the evaluation of nuclear receptor LBD dimerization activity, because agonistic ligands enhance the basal level of the LBD activity and that impedes the detection of LBD dimerization activity. We found that 4OHT does not enhance ER&#945; LBD basal activity. That is a key factor for being able to determine and detect the 4OHT-dependent LBD dimerization activity for successfully using the M2H assay. ER&#945; LBD-based M2H assays may be applied to study the partial agonist activity of selective estrogen receptor modulators (e.g., 4OHT) in various mammalian cell types.

We present a method for analyzing the 4-hydroxy-tamoxifen-dependent estrogen receptor alpha ligand-binding domain dimerization activity using the mammalian two-hybrid assay.

Estrogen receptor alpha (ER&#945;) is an estrogenic ligand-dependent transcription regulator. The sequence of ER&#945; protein is highly conserved among ...

A Spheroid Killing Assay by CAR T Cells

Immunotherapy has become a field of growing interest in the fight against cancer otherwise untreatable. Among all immunotherapeutic methods, chimeric antigen receptor (CAR) redirected T cells obtained the most spectacular results, in particular with pediatric B-acute lymphoblastic leukemia (B-ALL). Classical validation methods of CAR T cells rely on the use of specificity and functionality assays of the CAR T cells against target cells in suspension and in xenograft models. Unfortunately, observations made in vitro are often decoupled from results obtained in vivo and a lot of effort and animals could be spared by adding another step: the use of 3D culture. The production of spheroids out of potential target cells that mimic the 3D structure of the tumor cells when they are engrafted into the animal model represents an ideal alternative. Here, we report an affordable, reliable and easy method to produce spheroids from a transduced colorectal cell line as a validation tool for adoptive cell therapy (exemplified here by CD19 CAR T cells). This method is coupled with an advanced live imaging system that can follow spheroid growth, effector cells cytotoxicity and tumor cell apoptosis.

This protocol is designed to assess immunotherapeutic redirected T-cell (CAR T-cell) cytotoxicity against 3D structured cancerous cells (spheroids) in real time.

Immunotherapy has become a field of growing interest in the fight against cancer otherwise untreatable. Among all immunotherapeutic methods, chimeric ...

Real Time Detection of In Vitro Tumor Cell Apoptosis Induced by CD8+ T Cells to Study Immune Suppressive Functions of Tumor-infiltrating Myeloid Cells

Potentiation of the tumor-killing ability of CD8+ T cells in tumors, along with their efficient tumor infiltration, is a key element of successful immunotherapies. Several studies have indicated that tumor infiltrating myeloid cells (e.g., myeloid-derived suppressor cells (MDSCs) and tumor-associated macrophages (TAMs)) suppress cytotoxicity of CD8+ T cells in the tumor microenvironment, and that targeting these regulatory myeloid cells can improve immunotherapies. Here, we present an in vitro assay system to evaluate immune suppressive effects of monocytic-MDSCs and TAMs on the tumor-killing ability of CD8+ T cells. To this end, we first cultured na&#239;ve splenic CD8+ T cells with anti-CD3/CD28 activating antibodies in the presence or absence of suppressor cells, and then co-cultured the pre-activated T cells with target cancer cells in the presence of a fluorogenic caspase-3 substrate. Fluorescence from the substrate in cancer cells was detected by real-time fluorescence microscopy as an indicator of T-cell induced tumor cell apoptosis. In this assay, we can successfully detect the increase of tumor cell apoptosis by CD8+ T cells and its suppression by pre-culture with TAMs or MDSCs. This functional assay is useful for investigating CD8+ T cell suppression mechanisms by regulatory myeloid cells and identifying druggable targets to overcome it via high throughput screening.

Real Time Detection of In Vitro Tumor Cell Apoptosis Induced by CD8+ T Cells to Study Immune Suppressive Functions of Tumor-infiltrating Myeloid Cells

We describe here a protocol to investigate cytotoxicity of pre-activated CD8+ T cells against cancer cells by detecting apoptotic cancer cells via real-time microscopy. This protocol can investigate mechanisms behind myeloid cell-induced T cell suppression and evaluate compounds aimed at replenishing T cells via blockade of immune suppressive myeloid cells.

Potentiation of the tumor-killing ability of CD8+ T cells in tumors, along with their efficient tumor infiltration, is a key element of successful ...

In Vivo Inhibition of MicroRNA to Decrease Tumor Growth in Mice

MicroRNAs (miRNAs) are important regulators of gene expression through their ability to destabilize mRNA and inhibit translation of target mRNAs. An ever-increasing number of studies have identified miRNAs as potential biomarkers for cancer diagnosis and prognosis, and also as therapeutic targets, adding an extra dimension to cancer evaluation and treatment. In the context of thyroid cancer, tumorigenesis results not only from mutations in important genes, but also from the overexpression of many miRNAs. Accordingly, the role of miRNAs in the control of thyroid gene expression is evolving as an important mechanism in cancer. Herein, we present a protocol to examine the effects of miRNA-inhibitor delivery as a therapeutic modality in thyroid cancer using human tumor xenograft and orthotopic mouse models. After engineering stable thyroid tumoral cells expressing GFP and luciferase, cells are injected into nude mice to develop tumors, which can be followed by bioluminescence. The in vivo inhibition of a miRNA can reduce tumor growth and upregulate miRNA gene targets. This method can be used to assess the importance of a determined miRNA in vivo, in addition to identifying new therapeutic targets.

This protocol describes xenograft and orthotopic mouse models of human thyroid tumorigenesis as a platform to test microRNA-based inhibitor treatments. This approach is ideal to study the function of non-coding RNAs and their potential as new therapeutic targets.

MicroRNAs (miRNAs) are important regulators of gene expression through their ability to destabilize mRNA and inhibit translation of target mRNAs. An ...

In Vitro Assay to Study Tumor-macrophage Interaction

Tumor associated macrophages (TAMs) account for a large percentage of cells in the tumor mass for different types of cancers. Glioblastoma (GBM), a malignant brain tumor with no cure, has up to a half the tumor mass TAMs. TAMs can be pro-tumoral or anti-tumoral, depending on the activation of specific genes in the cells. Genetic mutations in the tumors, through regulating cytokine expression, can affect recruitment of TAMs to the tumor microenvironment. Here, we describe a quantitative cell-based assay to assess macrophage recruitment by the conditioned medium from the tumor cells. This assay uses the human macrophage cell line MV-4-11 to study macrophage attraction by the conditioned medium from glioblastoma, allowing for high reproducibility and low variability. Data generated with this assay can contribute to a better understanding of the interaction between the tumor and the tumor microenvironment. Similar assay can be used to assess interaction between the tumor cells and other immune cells, including T cells and natural killer (NK) cells.

This article represents a useful in vitro assay to evaluate the capability of conditioned medium from tumor cells to attract macrophages.

Tumor associated macrophages (TAMs) account for a large percentage of cells in the tumor mass for different types of cancers. Glioblastoma (GBM), a ...