The authors are grateful to E. Makeyev (Nanyang Technological University, Singapore) for the HeLa-Cre cells and pRD-RIPE and pCAGGS-Cre plasmids. We thank Edna Kimura, Carolina Purcell Goes, Gisela Ramos, Lucia Rossetti Lopes, and Anselmo Moriscot for their support.

An overview of the protocol described here is depicted in Figure 1.
1. Plasmid construction
<ol>
	<li>pCAGGS-Cre: This plasmid was provided by Dr. E. Makeyev21.</li>
	<li>pRD-miR-17-92:
	<ol>
		<li>Amplify pre-miR-17-92 by PCR using 0.5 &#181;M of each specific primer (Table of Materials), 150 ng of cDNA, 1 mM dNTPs, 1x Taq PCR buffer, and 5 U of high-fidelity Taq DNA polymerase. Perform a no-tem...

<ol>
	<li>Wilkinson, M. E., Charenton, C., Nagai, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNA+splicing+by+the+spliceosome.">RNA splicing by the spliceosome.</a> Annual Review of Biochemistry. 89, 359-388 (2020).</li><li>Will, C. L., Luhrmann, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spliceosome+structure+and+function.">Spliceosome structure and function.</a> Cold Spring Harbor Perspectives in Biology. 3 (7), 003707 (2011).</li><li>Zhang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+atomic+structure+of+the+human+spliceosome.">An atomic structure of the human spliceosome.</a> Cell. 169 (5), 918-929 (2017).</li><li>Staley, J. P., Guthrie, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mechanical+devices+of+the+spliceosome:+Motors,+clocks,+springs,+and+things.">Mechanical devices of the spliceosome: Motors, clocks, springs, and things.</a> Cell. 92 (3), 315-326 (1998).</li><li>Kornblihtt, A. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Alternative+splicing:+a+pivotal+step+between+eukaryotic+transcription+and+translation.">Alternative splicing: a pivotal step between eukaryotic transcription and translation.</a> Nature Reviews Molecular Cell Biology. 14 (3), 153-165 (2013).</li><li>Wang, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+complex+network+of+factors+with+overlapping+affinities+represses+splicing+through+intronic+elements.">A complex network of factors with overlapping affinities represses splicing through intronic elements.</a> Nature Structural &amp; Molecular Biology. 20 (1), 36-45 (2013).</li><li>Mukherjee, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+regulatory+mapping+indicates+that+the+RNA-binding+protein+HuR+couples+pre-mRNA+processing+and+mRNA+stability.">Integrative regulatory mapping indicates that the RNA-binding protein HuR couples pre-mRNA processing and mRNA stability.</a> Molecular Cell. 43 (3), 327-339 (2011).</li><li>Pandit, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+analysis+reveals+SR+protein+cooperation+and+competition+in+regulated+splicing.">Genome-wide analysis reveals SR protein cooperation and competition in regulated splicing.</a> Molecular Cell. 50 (2), 223-235 (2013).</li><li>Gatti da Silva, G. H., Dos Santos, M. G. P., Nagasse, H. Y., Coltri, P. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+antigen+R+(HuR)+facilitates+miR-19+synthesis+and+affects+cellular+kinetics+in+papillary+thyroid+cancer.">Human antigen R (HuR) facilitates miR-19 synthesis and affects cellular kinetics in papillary thyroid cancer.</a> Cellular Physiology and Biochemistry. 56, 105-119 (2022).</li><li>Westholm, J. O., Lai, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mirtrons:+MicroRNA+biogenesis+via+splicing.">Mirtrons: MicroRNA biogenesis via splicing.</a> Biochimie. 93 (11), 1897-1904 (2011).</li><li>Michlewski, G., C&#225;ceres, J. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Post-transcriptional+control+of+miRNA+biogenesis.">Post-transcriptional control of miRNA biogenesis.</a> RNA. 25 (1), 1-16 (2019).</li><li>Bartel, D. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNAs:+Target+recognition+and+regulatory+functions.">MicroRNAs: Target recognition and regulatory functions.</a> Cell. 136 (2), 215-233 (2009).</li><li>Esquela-Kerscher, A., Slack, F. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oncomirs+-+MicroRNAs+with+a+role+in+cancer.">Oncomirs - MicroRNAs with a role in cancer.</a> Nature Reviews Cancer. 6 (4), 259-269 (2006).</li><li>Lin, S., Gregory, R. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+biogenesis+pathways+in+cancer.">MicroRNA biogenesis pathways in cancer.</a> Nature Reviews Cancer. 15 (6), 321-333 (2015).</li><li>Curtis, H. J., Sibley, C. R., Wood, M. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mirtrons,+an+emerging+class+of+atypical+miRNA.">Mirtrons, an emerging class of atypical miRNA.</a> Wiley Interdisciplinary Reviews. RNA. 3 (5), 617-632 (2012).</li><li>Alarcon, C. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HNRNPA2B1+is+a+mediator+of+m(6)A-dependent+nuclear+RNA+processing+events.">HNRNPA2B1 is a mediator of m(6)A-dependent nuclear RNA processing events.</a> Cell. 162 (6), 1299-1308 (2015).</li><li>Paiva, M. M., Kimura, E. T., Coltri, P. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=miR18a+and+miR19a+recruit+specific+proteins+for+splicing+in+thyroid+cancer+cells.">miR18a and miR19a recruit specific proteins for splicing in thyroid cancer cells.</a> Cancer Genomics and Proteomics. 14 (5), 373-381 (2017).</li><li>He, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+microRNA+polycistron+as+a+potential+human+oncogene.">A microRNA polycistron as a potential human oncogene.</a> Nature. 435 (7043), 828-833 (2005).</li><li>Olive, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=miR-19+is+a+key+oncogenic+component+of+mir-17-92.">miR-19 is a key oncogenic component of mir-17-92.</a> Genes &amp; Development. 23 (24), 2839-2849 (2009).</li><li>Livak, K. J., Schmittgen, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+relative+gene+expression+data+using+real-time+quantitative+PCR+and+the+2(-Delta+Delta+C(T))+Method.">Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method.</a> Methods. 25 (4), 402-408 (2001).</li><li>Khandelia, P., Yap, K., Makeyev, E. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Streamlined+platform+for+short+hairpin+RNA+interference+and+transgenesis+in+cultured+mammalian+cells.">Streamlined platform for short hairpin RNA interference and transgenesis in cultured mammalian cells.</a> Proceedings of the National Academy of Sciences of the United States of America. 108 (31), 12799-12804 (2011).</li><li>Huelga, S. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Integrative+genome-wide+analysis+reveals+cooperative+regulation+of+alternative+splicing+by+hnRNP+proteins.">Integrative genome-wide analysis reveals cooperative regulation of alternative splicing by hnRNP proteins.</a> Cell Reports. 1 (2), 167-178 (2012).</li><li>Karni, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+gene+encoding+the+splicing+factor+SF2/ASF+is+a+proto-oncogene.">The gene encoding the splicing factor SF2/ASF is a proto-oncogene.</a> Nature Structural &amp; Molecular Biology. 14 (3), 185-193 (2007).</li><li>Franca, G. S., Vibranovski, M. D., Galante, P. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host+gene+constraints+and+genomic+context+impact+the+expression+and+evolution+of+human+microRNAs.">Host gene constraints and genomic context impact the expression and evolution of human microRNAs.</a> Nature Communications. 7, 11438 (2016).</li><li>Havens, M. A., Reich, A. A., Hastings, M. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drosha+promotes+splicing+of+a+pre-microRNA-like+alternative+exon.">Drosha promotes splicing of a pre-microRNA-like alternative exon.</a> PLoS Genetics. 10 (5), 1004312 (2014).</li><li>Grammatikakis, I., Abdelmohsen, K., Gorospe, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Posttranslational+control+of+HuR+function.">Posttranslational control of HuR function.</a> Wiley Interdisciplinary Reviews. RNA. 8 (1), (2017).</li><li>Chang, S. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ELAVL1+regulates+alternative+splicing+of+eIF4E+transporter+to+promote+postnatal+angiogenesis.">ELAVL1 regulates alternative splicing of eIF4E transporter to promote postnatal angiogenesis.</a> Proceedings of the National Academy of Sciences of the United States of America. 111 (51), 18309-18314 (2014).</li><li>Huang, Y. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Delivery+of+therapeutics+targeting+the+mRNA-binding+protein+HuR+using+3DNA+nanocarriers+suppresses+ovarian+tumor+growth.">Delivery of therapeutics targeting the mRNA-binding protein HuR using 3DNA nanocarriers suppresses ovarian tumor growth.</a> Cancer Research. 76 (6), 1549-1559 (2016).</li><li>Wang, W., Caldwell, M. C., Lin, S., Furneaux, H., Gorospe, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=HuR+regulates+cyclin+A+and+cyclin+B1+mRNA+stability+during+cell+proliferation.">HuR regulates cyclin A and cyclin B1 mRNA stability during cell proliferation.</a> The EMBO Journal. 19 (10), 2340-2350 (2000).</li><li>Guo, X., Connick, M. C., Vanderhoof, J., Ishak, M. A., Hartley, R. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA-16+modulates+HuR+regulation+of+cyclin+E1+in+breast+cancer+cells.">MicroRNA-16 modulates HuR regulation of cyclin E1 in breast cancer cells.</a> International Journal of Molecular Sciences. 16 (4), 7112-7132 (2015).</li></ol>

The authors have no conflicts of interest.

Pre-mRNA splicing is an important process for gene expression regulation, and its control can trigger strong effects on cell phenotypic modifications22,23. More than 70% of miRNAs are transcribed from introns in humans, and we hypothesized that their processing and maturation could be facilitated by splicing regulatory proteins24,25. We developed a method to analyze intronic miRNA processing and function ...

Precursor mRNA splicing is an important process for gene expression regulation in eukaryotes1. The removal of introns and the union of exons in mature RNA is catalyzed by the spliceosome, a 2 megadalton ribonucleoprotein complex composed of 5 snRNAs (U1, U2, U4, U5, and U6) along with more than 100 proteins2,3. The splicing reaction occurs co-transcriptionally, and the spliceosome is assembled at each new intron guided by the recognition of conserved splice sites at exon-intron boundaries and within the intron4. Different introns might have different splicing rates despite the remarkable conservation of the spliceosome complex and its components. In addition to the differences in splice site conservation, regulatory sequences distributed on introns and exons can guide RNA-binding proteins (RBP) and stimulate or repress splicing5,6. HuR is a ubiquitously expressed RBP and is an important factor to control mRNA stability7. Previous results from our group showed that HuR can bind to introns containing miRNAs, indicating this protein might be an important factor to facilitate miRNA processing and maturation, also leading to the generation of alternative splicing isoforms6,8,9.
Many microRNAs (miRNAs) are coded from intronic sequences. Whereas some are part of the intron, others are known as "mirtrons" and are formed by the entire intron10,11. miRNAs are short non-coding RNAs, ranging from 18 to 24 nucleotides in length12. Their mature sequence shows partial or total complementarity with target sequences in mRNAs, therefore affecting translation and/or mRNA decay rates. The combinations of miRNAs and targets drive the cell to different outcomes. Several miRNAs can drive cells to pro- or anti-tumoral phenotypes13. Oncogenic miRNAs usually target mRNAs that trigger a suppressive characteristic, leading to increased cellular proliferation, migration, and invasion14. On the other hand, tumor-suppressive miRNAs might target oncogenic mRNAs or mRNAs related to increased cell proliferation. 
The processing and maturation of miRNAs are also dependent on their origin. Most intronic miRNAs are processed with the participation of the microprocessor, formed by the ribonuclease Drosha and protein co-factors12. Mirtrons are processed with the activity of the spliceosome independently of Drosha15. Considering the high frequency of miRNAs found within introns, we hypothesized that RNA-binding proteins involved with splicing could also facilitate the processing and maturation of these miRNAs. Notably, the RBP hnRNP A2/B1 has already been associated with the microprocessor and miRNA biogenesis16. 
We have previously reported that several RNA-binding proteins, such as hnRNPs and HuR, are associated with intronic miRNAs by mass spectrometry17. HuR's (ELAVL1) association with miRNAs from the miR-17-92 intronic cluster was confirmed using immunoprecipitation and in silico analysis9. miR-17-92 is an intronic miRNA cluster composed of six miRNAs with increased expression in different cancers18,19. This cluster is also known as "oncomiR-1" and is composed of miR-17, miR-18a, miR-19a, miR-20, miR-19b, and miR-92a. miR-19a and miR-19b are among the most oncogenic miRNAs of this cluster19. The increased expression of HuR stimulates miR-19a and miR-19b synthesis9. Since intronic regions flanking this cluster are associated with HuR, we developed a method to investigate if this protein could regulate miR-19a and miR-19b expression and maturation. One important prediction of our hypothesis was that, as a regulatory protein, HuR could facilitate miRNA biogenesis, leading to phenotypic alterations. One possibility was that miRNAs were processed by the stimulation of HuR but would not be mature and functional and, therefore, the effects of the protein would not directly impact the phenotype. Therefore, we developed a splicing reporter assay to investigate whether an RBP such as HuR could affect the biogenesis and maturation of an intronic miRNA. By confirming miRNA processing and maturation, our assay shows the interaction with the target sequence and the generation of a mature and functional miRNA. In our assay, we couple the expression of an intronic miRNA cluster with a luciferase plasmid to check for miRNA target-binding in cultured cells.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Recombinant DNA</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>pCAGGS-Cre (Cre- encoding plasmid)</td>
			<td></td>
			<td></td>
			<td>A kind gift from E. Makeyev from Khandelia et al., 2011</td>
		</tr>
		<tr>
			<td>pFLAG-HuR</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>pmiRGLO-RAP-IB</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>pmiRGLO-scrambled</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>pRD-miR-17-92</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>pRD-RIPE-donor</td>
			<td></td>
			<td></td>
			<td>A kind gift from E. Makeyev from Khandelia et al., 2011</td>
		</tr>
		<tr>
			<td>pTK-Renilla</td>
			<td>Promega</td>
			<td>E2241</td>
			<td></td>
		</tr>
		<tr>
			<td>Antibodies</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>anti-B-actin</td>
			<td>Sigma Aldrich</td>
			<td>A5316</td>
			<td></td>
		</tr>
		<tr>
			<td>anti-HuR</td>
			<td>Cell Signaling</td>
			<td>mAb&#160;12582</td>
			<td></td>
		</tr>
		<tr>
			<td>IRDye 680CW Goat anti-mouse IgG</td>
			<td>Li-Cor Biosciences</td>
			<td>926-68070</td>
			<td></td>
		</tr>
		<tr>
			<td>IRDye 800CW Goat anti-rabbit IgG</td>
			<td>Li-Cor Biosciences</td>
			<td>929-70020</td>
			<td></td>
		</tr>
		<tr>
			<td>Experimental Models: Cell Lines</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>HeLa-Cre</td>
			<td></td>
			<td></td>
			<td>A kind gift from E. Makeyev from Khandelia et al., 2011</td>
		</tr>
		<tr>
			<td>HeLa-Cre miR17-92</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>HeLa-Cre miR17-92-HuR</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>HeLa-Cre miR17-92-HuR-luc</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>HeLa-Cre miR17-92-luc</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>HeLa-Cre miR17-92-scrambled</td>
			<td></td>
			<td></td>
			<td>Generated during this work</td>
		</tr>
		<tr>
			<td>Chemicals and Peptides</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM/high-glucose</td>
			<td>Thermo Fisher Scientific</td>
			<td>12800-017</td>
			<td></td>
		</tr>
		<tr>
			<td>Doxycycline</td>
			<td>BioBasic</td>
			<td>MB719150</td>
			<td></td>
		</tr>
		<tr>
			<td>Dual-Glo Luciferase Assay System</td>
			<td>Promega</td>
			<td>E2940</td>
			<td></td>
		</tr>
		<tr>
			<td>EcoRI</td>
			<td>Thermo Fisher Scientific</td>
			<td>ER0271</td>
			<td></td>
		</tr>
		<tr>
			<td>EcoRV</td>
			<td>Thermo Fisher Scientific</td>
			<td>ER0301</td>
			<td></td>
		</tr>
		<tr>
			<td>Geneticin</td>
			<td>Thermo Fisher Scientific</td>
			<td>E859-EG</td>
			<td></td>
		</tr>
		<tr>
			<td>L-glutamine</td>
			<td>Life Technologies</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Opti-MEM I</td>
			<td>Life Technologies</td>
			<td>31985-070</td>
			<td></td>
		</tr>
		<tr>
			<td>pFLAG-CMV&#8482;-3 Expression Vector</td>
			<td>Sigma Aldrich</td>
			<td>E6783</td>
			<td></td>
		</tr>
		<tr>
			<td>pGEM-T</td>
			<td>Promega</td>
			<td>A3600</td>
			<td></td>
		</tr>
		<tr>
			<td>Platinum Taq DNA polymerase</td>
			<td>Thermo Fisher Scientific</td>
			<td>10966-030</td>
			<td></td>
		</tr>
		<tr>
			<td>pmiR-GLO</td>
			<td>Promega</td>
			<td>E1330</td>
			<td></td>
		</tr>
		<tr>
			<td>Puromycin</td>
			<td>Sigma Aldrich</td>
			<td>P8833</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAse OUT</td>
			<td>Thermo Fisher Scientific</td>
			<td>752899</td>
			<td></td>
		</tr>
		<tr>
			<td>SuperScript IV kit</td>
			<td>Thermo Fisher Scientific</td>
			<td>18091050</td>
			<td></td>
		</tr>
		<tr>
			<td>Trizol-LS reagent</td>
			<td>Thermo Fisher</td>
			<td>10296-028</td>
			<td></td>
		</tr>
		<tr>
			<td>trypsin/EDTA 10X</td>
			<td>Life Technologies</td>
			<td>15400-054</td>
			<td></td>
		</tr>
		<tr>
			<td>XbaI</td>
			<td>Thermo Fisher Scientific</td>
			<td>10131035</td>
			<td></td>
		</tr>
		<tr>
			<td>XhoI</td>
			<td>Promega</td>
			<td>R616A</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligonucleotides</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>forward RAP-1B pmiRGLO</td>
			<td>Exxtend</td>
			<td>TCGAGTAGCGGCCGCTAGTAAG 
			CTACTATATCAGTTTGCACAT</td>
			<td></td>
		</tr>
		<tr>
			<td>reverse RAP-1B pmiRGLO</td>
			<td>Exxtend</td>
			<td>CTAGATGTGCAAACTGATATAGT 
			AGCTTACTAGCGGCCGCTAC</td>
			<td></td>
		</tr>
		<tr>
			<td>forward scrambled pmiRGLO</td>
			<td>Exxtend</td>
			<td>TCGAGTAGCGGCCGCTAGTAA 
			GCTACTATATCAGGGGTAAAAT</td>
			<td></td>
		</tr>
		<tr>
			<td>reverse scrambled pmiRGLO</td>
			<td>Exxtend</td>
			<td>CTAGATTTTACCCCTGATATAGT 
			AGCTTACTAGCGGCCGCTAC</td>
			<td></td>
		</tr>
		<tr>
			<td>forward HuR pFLAG</td>
			<td>Exxtend</td>
			<td>GCCGCGAATTCAATGTCTAAT 
			GGTTATGAAGAC</td>
			<td></td>
		</tr>
		<tr>
			<td>reverse HuR pFLAG</td>
			<td>Exxtend</td>
			<td>GCGCTGATATCGTTATTTGTG 
			GGACTTGTTGG</td>
			<td></td>
		</tr>
		<tr>
			<td>forward pre-miR-1792 pRD-RIPE</td>
			<td>Exxtend</td>
			<td>ATCCTCGAGAATTCCCATTAG 
			GGATTATGCTGAG</td>
			<td></td>
		</tr>
		<tr>
			<td>reverse pre-miR-1792 pRD-RIPE</td>
			<td>Exxtend</td>
			<td>ACTAAGCTTGATATCATCTTG 
			TACATTTAACAGTG</td>
			<td></td>
		</tr>
		<tr>
			<td>forward snRNA U6 (RNU6B)</td>
			<td>Exxtend</td>
			<td>CTCGCTTCGGCAGCACATATAC</td>
			<td></td>
		</tr>
		<tr>
			<td>reverse snRNA U6 (RNU6B)</td>
			<td>Exxtend</td>
			<td>GGAACGCTTCACGAATTTGCGTG</td>
			<td></td>
		</tr>
		<tr>
			<td>forward B-Actin qPCR</td>
			<td>Exxtend</td>
			<td>ACCTTCTACAATGAGCTGCG</td>
			<td></td>
		</tr>
		<tr>
			<td>reverse B-Actin qPCR</td>
			<td>Exxtend</td>
			<td>CCTGGATAGCAACGTACATGG</td>
			<td></td>
		</tr>
		<tr>
			<td>forward HuR qPCR</td>
			<td>Exxtend</td>
			<td>ATCCTCTGGCAGATGTTTGG</td>
			<td></td>
		</tr>
		<tr>
			<td>reverse HuR qPCR</td>
			<td>Exxtend</td>
			<td>CATCGCGGCTTCTTCATAGT</td>
			<td></td>
		</tr>
		<tr>
			<td>forward pre-miR-1792 qPCR</td>
			<td>Exxtend</td>
			<td>GTGCTCGAGACGAATTCGTCA 
			GAATAATGTCAAAGTG</td>
			<td></td>
		</tr>
		<tr>
			<td>reverse pre-miR-1792 qPCR</td>
			<td>Exxtend</td>
			<td>TCCAAGCTTAAGATATCCCAAAC 
			TCAACAGGCCG</td>
			<td></td>
		</tr>
		<tr>
			<td>Software and Algorithms</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Prism 8 for Mac OS X</td>
			<td>Graphpad</td>
			<td>https://www.graphpad.com</td>
			<td></td>
		</tr>
		<tr>
			<td>ImageJ</td>
			<td>National Institutes of Health</td>
			<td>http://imagej.nih.gov/ij</td>
			<td></td>
		</tr>
	</tbody>
</table>

a reporter assay to analyze intronic microrna maturation in mammalian cells

MicroRNAs (miRNAs) are short RNA molecules that are widespread in eukaryotes. Most miRNAs are transcribed from introns, and their maturation involves different RNA-binding proteins in the nucleus. Mature miRNAs frequently mediate gene silencing, and this has become an important tool for comprehending post-transcriptional events. Besides that, it can be explored as a promising methodology for gene therapies. However, there is currently a lack of direct methods for assessing miRNA expression in mammalian cell cultures. Here, we describe an efficient and simple method that aids in determining miRNA biogenesis and maturation through confirmation of its interaction with target sequences. Also, this system allows the separation of exogenous miRNA maturation from its endogenous activity using a doxycycline-inducible promoter capable of controlling primary miRNA (pri-miRNA) transcription with high efficiency and low cost. This tool also allows modulation with RNA-binding proteins in a separate plasmid. In addition to its use with a variety of different miRNAs and their respective targets, it can be adapted to different cell lines, provided these are amenable to transfection.

Our initial hypothesis was that HuR could facilitate intronic miRNA biogenesis by binding to its pre-miRNA sequence. Thus, the connection of HuR expression and miR-17-92 cluster biogenesis could point to a new mechanism governing the maturation of these miRNAs. Overexpression of HuR upon transfection of pFLAG-HuR was confirmed in three different cell lines: HeLa, BCPAP, and HEK-293T (Figure 2). As controls, untransfected cells and cells transfected with empty pFLAG vectors were used...

Watch this Scientific Journal Video about A Reporter Assay to Analyze Intronic microRNA Maturation in Mammalian Cells at JoVE.com

A Reporter Assay to Analyze Intronic microRNA Maturation in Mammalian Cells

We developed an intronic microRNA biogenesis reporter assay to be used in cells in vitro with four plasmids: one with intronic miRNA, one with the target, one to overexpress a regulatory protein, and one for Renilla luciferase. The miRNA was processed and could control luciferase expression by binding to the target sequence.

MicroRNAs (miRNAs) are short RNA molecules that are widespread in eukaryotes. Most miRNAs are transcribed from introns, and their maturation involves ...

Our protocol addresses the effects of regulatory RNA-binding proteins on microRNA biogenesis and maturation, straight from cell cultures. The method we describe can be performed with common cell culture reagents and is relatively fast. This method can be important to study the phenotypic effects of microRNAs and their targets in different types of eukaryotic cells.Normal or disease-like cells can be used. It is important to choose cell lines amenable to transfection, perform adequate transfection and induction controls in order to observe the changes in target affinity through luciferase activity. To begin, maintain the cells in DMEM, high glucose supplement in 100 millimeters Petri dishes and incubate the cells at 37 degrees Celsius in a humidified, controlled atmosphere incubator with 5%carbon dioxide.To detach adherent cells, incubate it with trypsin-EDTA solution at 37 degrees Celsius for three to five minutes. To perform transfections, mix 200 nanograms of DNA and 1.25 microliters of transfection reagent in 100 microliters of the culture medium and add the transfection mixture to the cells. Then, incubate the cells with the transfection mixtures for four hours at 37 degrees Celsius.Then replace the medium with medium containing 10%FBS and incubate for another 24 hours before adding the antibiotics for selection. To transfect pFLAG-HuR and MT-pFLAG into HeLa, select cells by increasing the concentration of Geneticin from 100 microgram per milliliter to 1000 microgram per milliliter, generating stable cell lines. Then, confirm overexpression with quantitative PCR using specific primers for HuR mRNA.Transfect the plasmids in HeLa-Cre cells with 40 nanograms pTK-Renilla, then pRD miR 17-92, generating HeLa-Cre miR 17-92, and selecting with one microgram per milliliter puromycin. Then, transfect HeLa-Cre miR 17-92 with pTK-Renilla and pmirGLO RAB1B 3'UTR or pmirGLO scrambled 1B 3'UTR separately. Next, select using penicillin and streptomycin, resulting in generation of luc RAB1B and luc scrambled.Next, transfect the cells with pFLAG-HuR or MT-PFLAG as them demonstrated previously. Proceed to cell culture with HeLa-Cre miR 17-92 luc, HeLa-Cre miR 17-92 scrambled, HeLa-Cre miR 17-92 HuR, and HeLa-Cre miR 1792 HuR lock until approximately 80%of confluency is reached. Then, induce with one microliter of doxycycline for 30 minutes at 37 degrees Celsius and also keep all the cells without doxycycline as controls for the same period.To quantify and compare different luminescence intensities, use the dual luciferase reporter assay kit. Before beginning the assay, thaw luciferase assay solutions and leave them at room temperature. Next, prepare the mix Stop and Glo by mixing 200 microliters of the substrate in 10 milliliters of luciferase assay buffer two.Then mix 10 milliliters of luciferase assay buffer two into the amber vile of luciferase assay substrate two to prepare the mix, LAR II, and shake well. Afterward, transfer the solutions to 15 milliliter centrifuge tubes previously identified and protected from light. Next, perform the luminescence readings using equipment such as Synergy and measure expressed luciferase as relative light units, and then export the results to a spreadsheet for further statistical analysis.Perform normalization of firefly luciferase activity by the control Renilla and plot that as relative light units in a graphic while repeating for groups with and without doxycycline induction. Overexpression of HuR upon transfection of pFLAG-HuR was confirmed in HeLa, BCPAP, and HEK293T cell line, and it was observed that HuR overexpression in these cells stimulates the expression of miR19A. A strong reduction in luciferase activity was observed with RAB1B 3'UTR upon increased miR19A and miR19B expression from pRD miR 17-92, in comparison to HeLa-Cre cells.The transfection of pFLAG-HuR in HeLa cells did not change the luciferase activity. However, overexpression of HuR, coupled with doxycycline supplementation stimulating expression of the miR 17-92 cluster, further reduced luciferase activity. After confirming the role of the RNA-binding protein in microRNA maturation, cell kinetics and cell cycle analysis will be important to understand the major changes promoted by the protein in microRNAs.

a-reporter-assay-to-analyze-intronic-microrna-maturation-mammalian

Research

JoVE Journal

Cancer Research

1.9K 조회수.  Universidade de São Paulo. 당사의 프로토콜은 세포 배양에서 직접 microRNA 생물 발생 및 성숙에 대한 조절 RNA 결합 단백질의 영향을 다룹니다. 우리가 설명하는 방법은 일반적인 세포 배양 시약으로 수행 할 수 있으며 비교적 빠릅니다. 이 방법은 다양한 유형의 진핵 세포에서 microRNA와 그 표적의 표현형 효과를 연구하는 데 중요 할 수 있습니다.정상 또는 질병-유사 세포가 사용될 수 있다. 루시퍼?...