We thank Dr. Zaffar Haque for careful reading of the manuscript. We thank Drs. Masaharu Kataoka and Gengze Wu for discussions and help. Work in the Wang lab is supported by the American Heart Association, Muscular Dystrophy Association, and NIH (HL085635, HL116919, HL125925).

Tüm açıklanan adımlar Biyogüvenlik Komitesi ve Boston Çocuk Hastanesi Kurumsal Hayvan Bakım ve Kullanım Kurulu tarafından onaylanan protokoller altında yapıldı. Boston Çocuk Hastanesi düzenlenmiş aydınlık / karanlık döngüsü ve iklim kontrolü ile patojen içermeyen fare olanakları bulunmaktadır. Veterinerlik ve hayvan bakım personeli değişim kafesleri farelerin sağlığını sağlamak ve. tesisler AAALAC belgeli ve aktif Hayvan Refahı Güvencesi sertifikası (AAALAC Akreditasyon 1992/02/24 Hayvan Refahı Güvencesi numarası üzerinde Verilen.: A3303-01) var. Fareler, bir basınçlı gaz kaynağı teslim CO2 ile ötenazi uygulandı. Doku örnekleri durdurduğunu hayvanların kalp hızı, hareketi ve nefes onayladıktan sonra toplandı. Yenidoğan kemirgenler 2 ötenazi CO dayanıklı ve keskin bir makas kullanarak kafaları kesilmek suretiyle kurban edilmiştir. Bu yöntemler Amerikan Veteriner Medica Ötanazi Paneli tavsiyeleri ile uyumludurl Derneği. Plazmid omurgasına bir cDNA veya shRNA ekspresyon kaseti klonlanmasıyla rAAV9 Yapılar 1. Üretim Not: rAAV9 plazmid, gen aşırı ekspresyonu için kullanılan ters çevrilmiş terminal tekrarlarıdır AAV2 (ITRler), ihtiva eden tavuk TNNT2 liman için modifiye edilmiştir kalıt gen 25,26,29 ve kardiyomiyosit özel dışavurumunu sağlayan yükseltici (rAAV9.cTNT). Benzersiz Nhel ve KpnI sahalarına promotörün aşağı plazmid içine edilmiştir. Ilgi genleri kodlayan cDNA fragmanları, her iki sınırlandırma bölgeleri 25,26,29 kullanılarak rAAV9 omurgasına klonlanabilir. Burada bir örnek olarak, fare kalplerinde, GFP geninin aşırı ifadesi için rAAV9 vektörü oluşturuldu. Elde edilen plazmid, iki ITR sitelerinin (Şekil 1) tarafından sınırlanan cTnT :: GFP kasetini içermektedir. rAAV9.U6 :: shRNA yapıları 25 demonte gen için kullanılmıştır. kullanarak Tasarım shRNAsOnline ShRNA tasarım sunucuları. rAAV9.U6 :: ShRNA tavlama ve U6 promotör barındıran sınırlama enzimi sindirilmiş rAAV9 vektörlere ShRNA dizileri DNA içeren oligos bağlanması, ya da uzun menzilli PCR ve intra-moleküler Gibson montaj tabanlı &quot;kesintisiz&quot; ya oluşturulabilir inşaat 30. Elde edilen plazmid, iki ITR sitelerinin (Şekil 2) tarafından sınırlanan U6-shRNA kaseti içermelidir. Burada bir örnek olarak, rAAV9.U6 :: shRNA vektörü Trbp mRNA (: GCAGTGATGGATATGCATCTTCTCGAGAAGATGCATATCCATCACTCG Trbp shRNA sekansı) demonte inşa edilmiştir. Bir mücadele shRNA, bir negatif kontrol (CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG) olarak kullanılmıştır. <ol><li> rAAV9 plazmid omurgasına cDNA ya da shRNA sentezleme kaseti klonlama. Yetkili, E. Coli hücrelerine 25 içine DNA Dönüşümü. Not: rAAV9 DNA transformasyonu için kullanımı stbl2 ya stbl3 E. coli hücreleri, istenmeyen ITR rekombinasyonu azaltmak için. </li><li> I almaktransforme edilen E. coli hücrelerinden Pozitif bir klon. Lilly-Barnett ortamı, 500 ml kültür yükseltmek ve bakteri hücreleri 25-30 arasında rAAV9 plazmid ekstrakte edin. NOT: Midi / Maxi DNA (&gt; 100 ug) yüksek miktarda elde etmek için rAAV9 plazmid hazırlık. Daha önce tarif edildiği gibi virüsün üretimini önce, her zaman, sınır sindirimi ve agaroz jel elektroforezi ile AAV plasmidlerin sekansı bütünlüğünü analiz (http://www.vvf.uzh.ch/cloningservice/11bpdeletion/itrintegrity.html). </li></ol> rAAV9 plazmid ile HEK293 hücrelerinin transfeksiyonu 2. <ol><li> doğrusal polietilenimin (PEI) çözeltisi 1 ug / ul hazırlayın. Endotoksin içermeyen dH 70-80 ° C&#39;ye kadar ısıtılmış olan 2 O PEI toz eritilir. Oda sıcaklığına kadar soğutulması, 1 M HCI ile pH 7.0&#39;a Çözeltinin nötralize edilmesi. Filtre sterilize (0.22 mikron) çözümüdür. 1 mcg / ml PEI stok solüsyonu (1.400 ul / tüp) alikotu ve solut saklamak-20 ° C&#39;de iyonu. </li><li> % 10 fetal sığır serumu (FBS) ve% 1 penisilin / streptomisin içeren Dulbecco Modifiye Eagle Ortamı (DMEM) içinde kültür HEK293 hücreleri. Kültür 5 ±% 0.5 karbon dioksit ile 37 ° C kuluçka makinesi içinde hücreleri (CO2). </li><li> 2 seyreltme: 0. günde, on 150 mm&#39;lik tabaklar içerisinde bir 1 bölme&gt;% 90 konfluent hücreler tarafından transfeksiyon önce 18-20 saat HEK293 hücreleri plaka. Not: 1. günde, hücreler,% 90 izdiham ulaşmalıdır. </li><li> Gün 1 &#39;de, rAAV9 plasmid (ör rAAV9.cTNT :: GFP veya rAAV6.U6 :: shRNA oluşturur), Ad-yardımcı plazmit ve PEI 25,26,29 kullanarak AAV Rep / Kapak plazmidi ile transfekte edilmiş HEK293 hücreleri. <ol><li> % 90 izdiham hücre 10 yemekler için, 50-ml santrifüj tüpü içinde Ad-yardımcı plazmit 70 AAV Rep / Cap plazmidi ug rAAV9 plazmid PF 70 ug ve 200 ug karıştırın. </li><li> Hücreler daha az konfluent iseniz, orantılı DNA miktarını ayarlamak. Hücreler% 75 konfluent altındadır Örneğin, azaltmakorantılı DNA miktarı (adım 2.4.1 gösterilen miktarın 75/90): 70 x 75/90 = AAV-Rep / Cap plazmid 58.3 mikrogram, rAAV9 plazmid x 75/90 = 58.3 mikrogram 70 ve 200 x mix 50 ml&#39;lik bir santrifüj tüpü içinde Reklam-yardımcı plazmidin 75/90 = 166.7 ug. </li><li> 50 ml&#39;lik bir tüpe (FBS&#39;siz) RT DMEM 49 ml ilave edilir ve iyice karıştırılır. </li><li> PEI yapmak için PEI solüsyonu 1.360 ul ekleyin: DNA oranının (h / a) 4 olması: 1 arasındadır. İyice karıştırın. 30 dakika - 15, oda sıcaklığında inkübe edilir. </li><li> (On 150 mm&#39;lik tabaklar karışımın 50 mi), her 150 mm tabak için adım 2.4.4 hazırlanan karışım, 5 ml. </li></ol></li><li> Kültür 60-72 saat 5 ±% 0.5 CO2 ile 37 ° C kuluçka makinesi içinde hücreleri. </li></ol> 3. Hasat transfekte HEK293 hücreleri ve rAAV9 Vektörler saflaştırılması <ol><li> Hücreler, transfeksiyondan sonra, 60-72 saat hasat edilir. Çıkarmak ve yukarı pipetleme ve kültür ortamı ile aşağı yemekleri hücreleri askıya. steril tüm hücre süspansiyonları aktarın50 ml tüpler. </li><li> 5 dakika boyunca 500 xg&#39;de hücreleri Santrifüj. Her bir tüp içinde 5 ml PBS ile hücre pelletini ve bir 50 ml tüp içine tüm hücre süspansiyonları birleştirir. </li><li> 5 dakika boyunca 500 xg&#39;de hücreleri Santrifüj. süpernatant atın. Bu adımda, -80 ° C de hücre pelletini depolamak ya da hemen adımda 3,4-3,15 tarif edildiği gibi, pelet AAV saflaştırılması. </li><li> 150 mM NaCl ve 20 mM Tris-HCl, pH 8.0: lizis tamponu hazırlayın. Filtre sterilize (0.22 uM). 4 ° C&#39;de tampon saklayın. </li><li> liziz tamponu 10 ml pelletini. </li><li> daha sonra bunun çözülme 37 ° C&#39;de, 80 ° C&#39;de ya da kuru buz / etanol banyosu içinde lizat dondurun. 1 dakika vorteksleyin. Freeze ve lizat 3 kez Çözülme. </li><li> Çözülmüş lizat MgCI2 solüsyonu (1 mm lizatında MgCl2 nihai konsantrasyon olun). 250 U / ml bir son konsantrasyona kadar nükleaz ekleyin. DNA / Protein AGGR çözünmesi için 15 dakika boyunca 37 ° C&#39;de inkübe edinegation. NOT: DNA / protein agregasyonu, nükleaz veya endonükleaz tedaviden sonra çözülmüş olsun yoksa Dounce Lizatlar 20 kez homojenize. </li><li> 4 ° C&#39;de 20 dakika boyunca 4,800 x g&#39;de santrifüjleyin. süpernatant toplayın. </li><li> Bu arada, iyodiksanol gradyan çözeltisi hazırlayın: <ol><li> 10x 5 ml PBS, 1 M MgCl2, 0.05 mi, 1 M KCI, 0.125 mi, 5 M NaCI, 10 ml ve gradyan ortam ofdensity 12,5 ml karıştırma gradyan çözeltisi% 17 hazırlayın. H2O ile 50 ml toplam hacmini ayarlamak </li><li> 10x 5 ml PBS, 1 M MgCl2, 0.05 mi, 1 M KCI, 0.125 mi, yoğunluk gradyanlı ortam 20 ml ve% 0.5, 0.2 ml (a / h) Fenol Kırmızısı karıştırılarak% 25 çözelti hazırlayın. H2O ile 50 ml toplam hacmini ayarlamak </li><li> 10x 5 ml PBS, 0.05, 1 M MgCl2 mL, 1 M KCI, 0.125 mi, ve yoğunluk dereceli ortamının 33.3 mi karıştırılarak% 40 çözelti hazırlayın. kullanılarak 50 ml toplam hacmini ayarlamakH2O </li><li> Karıştırılarak% 60 çözelti hazırlayın 0.05 ml 1 M MgCl2, 1 M KCI, 0.125 ml, yoğunluk gradyanlı ortam, 50 ml ve 0.1 ml% 0.5 (ağırlık / hacim) Fenol Kırmızısı. </li></ol></li><li> Bir enjektör ile, alttan başlayarak,% 60 5% 17 mi,% 25, ​​5 ml,% 40, 5 ml ve 5 ml için polipropilen tüp içine iyodiksanol gradyan çözeltisi yükleyin. gradyanın tepesinde Aşama 3,8 (14-16 mi) içinde elde edilen tüm lizat yükleyin. alttan üste doğru listelenmiş gradyan,% 60,% 40,% 25,% 17, ve lizat tabakasıdır. lizis tamponu ile tüp doldurun ve mantar ile örtün. </li><li> 16 ° C&#39;de 90 dakika boyunca 185,000 x g&#39;de santrifüjleyin. </li><li> bir şırınga ile viral kısmını (% 40 katman) Hasat. sadece% 40 katman aspire,% 40 ve% 60 fraksiyonları arasındaki kesişme içine iğne (21 gauge) yerleştirin. NOT:% 25 tabakasının HERHANGİ aspirasyon kaçının. </li><li> Sterilize polioksietilen-polyoxypro viral kısmını karıştırın15 ml&#39;lik bir toplam hacme kadar: pylene blok kopolimeri PBS solüsyonu (10,000 PBS içinde seyreltilmiş,% 10 polioksietilen-polioksipropilen blok kopolimeri hazır 1). Filtre tüp (cut-off MW = 100 kD) içine karışımı yerleştirin. 4 ° C&#39;de 30 dakika boyunca 2,000 x g&#39;de santrifüjleyin. </li><li> altta çözüm atın. 15 ml&#39;lik toplam hacme kadar polioksietilen-polioksipropilen blok kopolimeri, PBS çözeltisi ile filtre tüp doldurun. 4 ° C&#39;de 20 dakika boyunca 2,000 x g&#39;de santrifüjleyin. Bu adımı iki kez daha tekrarlayın. saflaştırılmış rAAV9 virüsü (filtresinin üzerine fraksiyonu) toplayın. </li><li> 1.7 ml tüpler filtre tüpünde saflaştırılmıştır rAAV9 aktarın. Saflaştırılmış rAAV9 bölüm (100 - AAV hacmi ve titre bağlı olarak 400 ul / tüp), ve -80 ° C &#39;de virüs saklayın. NOT: tekrarlanan donma-çözülür kaçının. </li></ol> rAAV9 titresi 4. Ölçüm <ol><li> Standart DNA örnekleri hazırlayın. <ol><li> özel ve etkili bir PCR TasarımrAAV9 vektörleri için primerler ve PCR durumunu optimize eder. Not: &quot;: TCGGGATAAAAGCAGTCTGG;: İleri TCGGACGGAGATACGTGAGT&quot; Bu çalışmada kullanılan primerlerdir. PCR reaksiyonu, aşağıdaki koşullar ile yapıldı: Initial doğasını değiştiren 3 dakika boyunca 95 ° C&#39;de; 20 saniye, 15 saniye, 60 ° C&#39;de ve 10 saniye boyunca 72 ° C&#39;de, 95 ° C&#39;de 35 döngü; ve 10 dakika boyunca 72 ° C&#39;de son uzatma. RAAV9 vektöründe ilave sekansı PCR 31 özgünlüğünü ve verimliliğini etkileyebilir Ancak, optimize edilmiş primerleri ve PCR koşulları, plazmid-özeldir. </li><li> Adım 4.1.1 gösterilen şartlara PCR reaksiyonu gerçekleştirin. Bir jel özütleme kiti ile PCR ürünü saflaştırılır. </li><li> Bir spektrofotometre kullanılarak, saflaştırılmış DNA konsantrasyonu ölçümü. PCR ürününün molekül ağırlığı / uzunluğuna göre DNA moleküler sayıda konsantrasyonu hesaplanır. <ol><li> aşağıdaki denklem kullanılarak moleküler konsantrasyonu hesaplayın: moMolecular konsantrasyonu (DNA molekülleri veya bunların fragmanları / ml) = 6.23 x 10 23 mol-1 X Kon. x 10 -6 / MW. Not: (6.23 x 10 23 mol-1 Avagadro sayısı Kon .: DNA konsantrasyonu ng / ml; MW .: g / mol molekül ağırlığı). PCR ürününün elde konsantrasyonu, 100 ug / ml ve uzunluğu 200 bp Örneğin, iki-şeritli DNA molekül ağırlığı, her bir nükleotitden 2 x 200 x 310 = 124,000 (ortalama molekül ağırlığıdır tek-şeritli DNA, yaklaşık 310 g / mol) &#39;dir. Moleküler konsantrasyonu (DNA molekülleri / mi) 6.23 x 10 23 mol-1 X 100 ug / ml x 10 6 / 124.000 g / mol = 5.18 x 10 14 DNA molekülleri / ml =. </li><li> 10 ila 13 molekül / ml, 10 ila 12 molekül / ml, 10 11 molekülleri / ml, 10 10 molekülleri / ml, 10 9 molekülleri / ml, 10 konsantrasyonları ile, DNA fragmanının bir seyreltme serisi gerçekleştirmek ve standart örnekleri hazırlamak <sup&gt; 8 molekülleri / ml ve 10 7 molekülleri / ml olmuştur. (Adım 4.6, qPCR) kantitatif PCR için her bir standart numune için solüsyonun 1 ul kullanın. </li></ol></li></ol></li><li> 10x DNAz tamponu, 5 ul, DNAz 1 ul (10,000 U / ml) ve GKD 2 O. 39 ul toplam hacim 50 ul olmalıdır saflaştınlmış rAAV9 çözeltisi 5 ul karıştırın. </li><li> Kalıntı paketlenmemiş plazmid DNA çıkarmak için 30 dakika için 37 ° C &#39;de şişe inkübe edin. </li><li> 10 dakika boyunca 95 ° C &#39;de DNAz inaktive. , Çözelti önce soğumaya H2O 44 ul 10x DNAz tampon 5 ul proteinaz K ile stokunun 1 ul (10 mg / ml) ekleyin. </li><li> 2 saat boyunca 50 ° C&#39;da, çözelti inkübe edin. reaksiyonu durdurun ve 10 dakika boyunca 95 ° C &#39;de Proteinaz K etkisiz hale getirirler. </li><li> kantitatif PCR (qPCR) deneyi için örnek 1 ul kullanın. titresi hesaplayın. <ol><li> Numuneler fr kullanarak adım 4.1.1 tasarlanmış primerler ile kantitatif PCR (qPCR) çalıştırınom adımı 4.1.4 (standart numune) ve aşama 4.5 ila (örnekler, bundan). <ol><li> Her bir reaksiyon için, (Taq polimeraz, dNTP karışımı, tampon, MgCl2 ve yeşil boya ihtiva eder) 2x Yeşil ana karışımı 10 ul ileri primer (5 uM), 0.5 ul ters primeri (5 uM), 0.5 ul karıştırın H2O 8 ul ve örnek 1 ul ölçülecek. aşağıdaki koşullarda qPCR gerçekleştirmek: 2 dakika ve 10 dakika boyunca 95 ° C, 50 ° C &#39;de numuneler tutun; 15 sn için ve 1 dakika boyunca 60 ° C &#39;de 95 ° C&#39; de 40 döngü gerçekleştirmek; erime aşaması için, 30 saniye ve 15 saniye süreyle 60 ° C, 95 ° C &#39;de numuneler inkübe edin. Standart numuneler (Şekil 3) C T numaraları dayalı standart eğri oluşturmak. </li></ol></li><li> standart bir eğriye karşı AAV numunenin molekül konsantrasyon / titresi hesaplanır. rAAV9 tek iplikli DNA genomu, bu nedenle molekül konsantrasyonundan 2 kat daha yüksek olacakHesaplanan değer (2x gücü (10, y), Şekil 3B). Buna ek olarak, arıtılmış, rAAV9 titresi bağlı DNase ve proteinaz K reaksiyonlarda virüsü (100 ul toplam 5 ul) 1:20 seyreltme hesaplama elde edilen daha büyük bir değere 20 kat olacaktır. </li></ol></li></ol> Heart Yenidoğan Farelerde ve Gen İfadesi Tahliller 5. rAAV9 Enjeksiyon <ol><li> polioksietilen-polioksipropilen blok kopolimeri, PBS çözeltisi içinde rAAV9 çalışma çözümleri hazırlayın. 1-7 x 10 12 parçacıklar / ml titreleri ile virüs stok yapmak. NOT: deri altı enjeksiyonu ile her doğum sonrası gün 0.5-1.5 fare içine rAAV9 çözeltisi 50-70 ul sunun. etkin gen ifadesinin veya demonte elde etmek için, enjekte edilen AAV miktarını optimize etmek için her bir çalışma için bir pilot testi gerçekleştirmek için tavsiye edilir. önyargı en aza indirmek için her çalışma için rAAV9.cTNT :: Luc veya rAAV9.U6 :: karıştıran kontrolleri aynı miktarda kullanın. NOT: 1-1.5 kullanılanx 10 11 parçacıklar / yavru aşırı ekspresyonunun ve 2.5 - doğum sonrası gün 0.5-1.5 mi ce) içinde demonte için 5 x 10 11 parçacıklar / yavru. </li><li> Deri altı enjeksiyonu ile P0.5-P2.5 de rAAV9 neonatal fareler davranın. <ol><li> rAAV9 çözümü ile bir 29G1 / 2, 0.33 x 12.7 mm insülin şırınga önceden doldurun. Hava kabarcıklarını çıkarmak için dikkatli olun. </li><li> başparmak ve işaret parmağı ile bir yandan cryo anestezi yavru tutun. Enjeksiyondan önce, steril durumunu korumak için% 70 izopropil alkol ile doymuş bir çubukla sopayla yavru arka cilt tokatlamak. 5 ila 10 ° &#39;lik bir açı ile hayvan ön-dorsal subkütisine bir şırınga iğnesi yerleştirin. insülin şırınga kullanarak rAAV9 çözeltisi 50-70 ul enjekte edilir. NOT: rAAV9 da intraperitoneal veya intravenöz enjeksiyon 26,27 aracılığıyla fare teslim edilebilir. kalp teslim genlerin etkin ekspresyonu elde edilebilir. Bununla birlikte, intraperitonal enjekteİyon bazen karaciğer sızan ifade neden olabilir. enjeksiyonundan sonra, yavruların durumu her gün izlendi. </li></ol></li><li> Kalp gen ekspresyonunun seviyesi qPCR, immünofloresan veya western blot ile izlenebilir (Örnek sonuçlar Şekil 4&#39;te gösterilmiştir ve 5) 25,26. Not: Fareler, sıkıştırılmış gaz kaynağından teslim CO2 ile ötenazi uygulandı. Doku örnekleri hayvanların kalp atış hızı, hareket ve solunum sona olduğu doğrulandıktan sonra toplanmıştır. Yenidoğan kemirgenler 2 ötenazi CO dayanıklı ve keskin bir makas kullanarak kafaları kesilmek suretiyle kurban edilmiştir. yöntem Amerikan Veteriner Hekimleri Birliği Ötanazi Paneli önerileri ile tutarlıdır. </li></ol>

<ol>
	<li>Primrose, S. B., Twyman, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Principles of gene manipulation and genomics. , (2013).</li><li>Doudna, J. A., Charpentier, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+new+frontier+of+genome+engineering+with+CRISPR-Cas9.">The new frontier of genome engineering with CRISPR-Cas9.</a> Science. 346, 1258096 (2014).</li><li>Gaj, T., Gersbach, C. A., Barbas, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ZFN,+TALEN,+and+CRISPR/Cas-based+methods+for+genome+engineering.">ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering.</a> Trends Biotechnol. 31, 397-405 (2013).</li><li>Hsu, P. D., Lander, E. S., Zhang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+applications+of+CRISPR-Cas9+for+genome+engineering.">Development and applications of CRISPR-Cas9 for genome engineering.</a> Cell. 157, 1262-1278 (2014).</li><li>Sander, J. D., Joung, J. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas+systems+for+editing,+regulating+and+targeting+genomes.">CRISPR-Cas systems for editing, regulating and targeting genomes.</a> Nat. Biotechnol. 32, 347-355 (2014).</li><li>Szulc, J., Wiznerowicz, M., Sauvain, M. -. O., Trono, D., Aebischer, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+versatile+tool+for+conditional+gene+expression+and+knockdown.">A versatile tool for conditional gene expression and knockdown.</a> Nat. Methods. 3, 109-116 (2006).</li><li>Nimesh, S., Halappanavar, S., Kaushik, N. K., Kumar, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+Gene+Delivery+Systems.">Advances in Gene Delivery Systems.</a> BioMed Res. Int. 2015, 610342 (2015).</li><li>Kamimura, K., Suda, T., Zhang, G., Liu, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+gene+delivery+systems.">Advances in gene delivery systems.</a> Pharm. Med. 25, 293-306 (2011).</li><li>Thomas, C. E., Ehrhardt, A., Kay, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progress+and+problems+with+the+use+of+viral+vectors+for+gene+therapy.">Progress and problems with the use of viral vectors for gene therapy.</a> Nat. Rev. Genet. 4, 346-358 (2003).</li><li>Giacca, M., Zacchigna, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-mediated+gene+delivery+for+human+gene+therapy.">Virus-mediated gene delivery for human gene therapy.</a> J. Control Release. 161, 377-388 (2012).</li><li>Witlox, M., Lamfers, M., Wuisman, P., Curiel, D., Siegal, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolving+gene+therapy+approaches+for+osteosarcoma+using+viral+vectors:+review.">Evolving gene therapy approaches for osteosarcoma using viral vectors: review.</a> Bone. 40, 797-812 (2007).</li><li>De Miguel, M. P., Cheng, L., Holland, E. C., Federspiel, M. J., Donovan, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+the+c-Kit+signaling+pathway+in+mouse+primordial+germ+cells+by+retroviral-mediated+gene+transfer.">Dissection of the c-Kit signaling pathway in mouse primordial germ cells by retroviral-mediated gene transfer.</a> Proc. Natl. Acad. Sci. USA. 99, 10458-10463 (2002).</li><li>Nagano, M., Shinohara, T., Avarbock, M. R., Brinster, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retrovirus-mediated+gene+delivery+into+male+germ+line+stem+cells.">Retrovirus-mediated gene delivery into male germ line stem cells.</a> FEBS Lett. 475, 7-10 (2000).</li><li>Scharfmann, R., Axelrod, J. H., Verma, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+in+vivo+expression+of+retrovirus-mediated+gene+transfer+in+mouse+fibroblast+implants.">Long-term in vivo expression of retrovirus-mediated gene transfer in mouse fibroblast implants.</a> Proc. Natl. Acad. Sci. USA. 88, 4626-4630 (1991).</li><li>Katz, R. A., Greger, J. G., Skalka, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+cell+cycle+status+on+early+events+in+retroviral+replication.">Effects of cell cycle status on early events in retroviral replication.</a> J. Cell. Biochem. 94, 880-889 (2005).</li><li>Escors, D., Breckpot, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentiviral+vectors+in+gene+therapy:+their+current+status+and+future+potential.">Lentiviral vectors in gene therapy: their current status and future potential.</a> Arch. Immunol. Ther. Exp. 58, 107-119 (2010).</li><li>M&#225;trai, J., Chuah, M. K., VandenDriessche, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+advances+in+lentiviral+vector+development+and+applications.">Recent advances in lentiviral vector development and applications.</a> Mol. Ther. 18, 477-490 (2010).</li><li>Miyazaki, Y., Miyake, A., Nomaguchi, M., Adachi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+dynamics+of+retroviral+genome+and+the+packaging.">Structural dynamics of retroviral genome and the packaging.</a> Front. Microbiol. 2, 1-9 (2011).</li><li>Douglas, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus-Mediated+Gene+Delivery.">Adenovirus-Mediated Gene Delivery.</a> Gene Delivery to Mammalian Cells: Volume 2: Viral Gene Transfer Techniques. , 3-14 (2004).</li><li>Armend&#225;riz-Borunda, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+first+generation+adenoviral+vectors+for+preclinical+protocols:+amplification,+purification+and+functional+titration.">Production of first generation adenoviral vectors for preclinical protocols: amplification, purification and functional titration.</a> J. Biosci. Bioeng. 112, 415-421 (2011).</li><li>Snyder, R. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adeno-associated+virus-mediated+gene+delivery.">Adeno-associated virus-mediated gene delivery.</a> J Gene Med. 1, 166-175 (1999).</li><li>Samulski, R. J., Muzyczka, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=AAV-mediated+gene+therapy+for+research+and+therapeutic+purposes.">AAV-mediated gene therapy for research and therapeutic purposes.</a> Annu. Rev. Virol. 1, 427-451 (2014).</li><li>Kaplitt, M. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+gene+transfer+in+porcine+myocardium+after+coronary+infusion+of+an+adeno-associated+virus+vector.">Long-term gene transfer in porcine myocardium after coronary infusion of an adeno-associated virus vector.</a> Ann. Thorac. Surg. 62, 1669-1676 (1996).</li><li>Kaspar, B. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Myocardial+gene+transfer+and+long-term+expression+following+intracoronary+delivery+of+adeno-associated+virus.">Myocardial gene transfer and long-term expression following intracoronary delivery of adeno-associated virus.</a> J. Gene. Med. 7, 316-324 (2005).</li><li>Ding, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trbp+regulates+heart+function+through+microRNA-mediated+Sox6+repression.">Trbp regulates heart function through microRNA-mediated Sox6 repression.</a> Nat. Genet. 47, 776-783 (2015).</li><li>Lin, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardiac-specific+YAP+activation+improves+cardiac+function+and+survival+in+an+experimental+murine+MI+model.">Cardiac-specific YAP activation improves cardiac function and survival in an experimental murine MI model.</a> Circ. Res. 115, 354-363 (2014).</li><li>Wahlquist, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+miR-25+improves+cardiac+contractility+in+the+failing+heart.">Inhibition of miR-25 improves cardiac contractility in the failing heart.</a> Nature. 508, 531-535 (2014).</li><li>Carroll, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mouse+model+for+adult+cardiac-specific+gene+deletion+with+CRISPR/Cas9.">A mouse model for adult cardiac-specific gene deletion with CRISPR/Cas9.</a> Proc. Natl. Acad. Sci. USA. 113, 338-343 (2016).</li><li>Jiang, J., Wakimoto, H., Seidman, J., Seidman, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allele-specific+silencing+of+mutant+Myh6+transcripts+in+mice+suppresses+hypertrophic+cardiomyopathy.">Allele-specific silencing of mutant Myh6 transcripts in mice suppresses hypertrophic cardiomyopathy.</a> Science. 342, 111-114 (2013).</li><li>Gibson, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+assembly+of+DNA+molecules+up+to+several+hundred+kilobases.">Enzymatic assembly of DNA molecules up to several hundred kilobases.</a> Nat. Methods. 6, 343-345 (2009).</li><li>Rychlik, W., Spencer, W., Rhoads, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+the+annealing+temperature+for+DNA+amplification+in+vitro.">Optimization of the annealing temperature for DNA amplification in vitro.</a> Nucleic Acids Res. 18, 6409-6412 (1990).</li><li>Allocca, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serotype-dependent+packaging+of+large+genes+in+adeno-associated+viral+vectors+results+in+effective+gene+delivery+in+mice.">Serotype-dependent packaging of large genes in adeno-associated viral vectors results in effective gene delivery in mice.</a> J. Clin. Invest. 118, 1955-1964 (2008).</li><li>Wu, Z., Yang, H., Colosi, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+genome+size+on+AAV+vector+packaging.">Effect of genome size on AAV vector packaging.</a> Mol. Ther. 18, 80-86 (2010).</li><li>Li, J., Sun, W., Wang, B., Xiao, X., Liu, X. -. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+trans-splicing+as+a+means+for+viral+vector-mediated+in+vivo+gene+therapy.">Protein trans-splicing as a means for viral vector-mediated in vivo gene therapy.</a> Hum. Gene Ther. 19, 958-964 (2008).</li><li>Piras, B. A., O'Connor, D. M., French, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systemic+delivery+of+shRNA+by+AAV9+provides+highly+efficient+knockdown+of+ubiquitously+expressed+GFP+in+mouse+heart,+but+not+liver.">Systemic delivery of shRNA by AAV9 provides highly efficient knockdown of ubiquitously expressed GFP in mouse heart, but not liver.</a> PLoS One. 8, e75894 (2013).</li><li>Lovric, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Terminal+differentiation+of+cardiac+and+skeletal+myocytes+induces+permissivity+to+AAV+transduction+by+relieving+inhibition+imposed+by+DNA+damage+response+proteins.">Terminal differentiation of cardiac and skeletal myocytes induces permissivity to AAV transduction by relieving inhibition imposed by DNA damage response proteins.</a> Mol. Ther. 20, 2087-2097 (2012).</li></ol>

The authors have nothing to disclose.

Plazmid, inşaat sırasında istenmeyen ITR rekombinasyonu azaltmak için çok önemlidir. virüs oluşturmadan önce, bir zaman kısıtlaması sindirim ve agaroz jel elektroforezi kullanılarak AAV plazmid ITR bütünlüğünü izlemek gerekir. % 100 sağlam plazmidler elde etmek mümkün değildir, ancak rekombinasyon oranı mümkün olduğunca en aza indirilmelidir. Az% 20 başarı rAAV9 paket için kabul edilebilir. Dikkat çekici bir alt sallayarak hızla (180-200 rpm) ile düşük sıcaklıkta (30 ° C) bakteriler...

A correction was made to the Authors section in: <a href="http://www.jove.com/video/54787">Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts</a>.
One of the authors names and affiliation was corrected from:
Jian-Ming Jiang3,4 
3 Department of Genetics, Harvard Medical School 
4 Howard Hughes Medical Institute
to:
Jianming Jiang5 
5 Department of Biochemistry, Yong Loo Lin School of Medicine, National University of Singapore

A correction was made to the Authors section in: <a href="http://www.jove.com/video/54787">Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts</a>.

Erratum: Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts

Çeşitli biyolojik sistemlerde, belirli genlerin dışavurumu ya da aktivitesini kontrol gen fonksiyonu 1 çalışmasında değerli bir strateji haline gelmiştir. Bu amacı gerçekleştirmek doğrudan bir aracı nükleotid dizilerini işlemek ve mutant alelleri üretmektir. canlı hücre genomuna kesin ve hedeflenen bir değişiklik yapmak hala olmasına rağmen Bir zaman alıcı ve emek yoğun bir uygulamadır, güçlü TALEN ve CRISPR / Cas9 araçlarının geliştirilmesi genom düzenleme 2-5 yeni bir dönem açtı. Gen manipülasyonu için daha rutin laboratuvar yöntemi genetik malzemeler (DNA&#39;lar ve kodlama dizileri veya siRNA&#39;lar / shRNAs içeren RNA&#39;lar) açık veya ilgi 1,6 gen (ler) demonte hücrelerin içine giriş odaklanmıştır. Pek çok durumda, gen manipülasyonu için büyük bir darboğaz hücrelerine DNA, RNA ya da protein verilmesidir. In vitro çalışmalarda dikkate alarak, verimli transfecti ilesistemlerde çok kültürlenmiş hücre çizgileri kurulmuştur. Bununla birlikte, özellikle de fare modelinde in vivo gen aktarım daha zordur. Eksojen reaktiflerin etkili biçimde hücreye alınması elde edilmesi amacıyla bypass gereken ekstra ve hücre içi engellerin bir dizi işlem bulunmaktadır. Ek engeller, hızlı temizleme ve teslim malzemeler 7,8 kısa süreli içerir. Bu sorunları aşmak için bir strateji, in vivo gen aktarımı için &quot;taşıyıcılar&quot; veya &quot;araçlar&quot; gibi viral vektörler kullanmaktır. Virüslerin doğal olarak gelişmiş iletim özellikleri hücre 7,9,10 söz konusu bir genin etkin bir dağıtımını sağlar. Viral vektörlerin çok sayıda türleri geliştirilmiş ve farelerde, farklı hücre tipleri ve organların in vivo gen manipülasyonu esnek olanak edilmiştir. En yaygın olarak kullanılan viral sistemler retrovirüs, lentivirüs, adenovirüs ve adeno-ilişkili virüs (AAV) dahildir <s&gt; 11 kadar. Retrovirüsler, tek dallı bir RNA virüsleridir ve hedef hücre ve organ 12-14 transdüksiyona genlerin yaşam boyu ifadesi için potansiyel sağlamaktadır mitotik bölünmesi sırasında istikrarlı bir şekilde konukçu hücre genomuna genetik malzemenin neden olabilir. Bununla birlikte, retrovirüsler, çok çeşitli, sadece bölünen hücreleri enfekte eder ve bölünmeyen hücreleri onların etkinliği 15 derece düşüktür. Bu gen aktarımı için bunların kullanımını sınırlar. Lentivirüs Retroviridae ailesinin bir cinsidir. Diğer retrovirüsler arasında farklı, lentivirüs, her iki bölme ve bölünmeyen hücreleri enfekte edebilir ve yaygın olarak post-mitotik ve yüksek farklılaşmış hücrelerin 16 gen transferi için kullanılmıştır. Lentivirüs yaşam döngüsü, konakçı genomuna vektör DNA&#39;nın entegrasyonu içermektedir. Bu nedenle, lentivirüs aracılığıyla gen teslimi transduse genetik elementlerin 16-18 kararlı ve uzun süreli ifadesini sağlar. Ancak, bu özellik bir çift e temsil edebilirVektör DNA &#39;nın entegrasyonu girmeyle mutagenez neden olabileceğinden, bu virüslerin kullanımı dged kılıcı gen ekspresyonunu değiştirmek için ve ev sahibi hücrelerde artefakt etkilere neden olabilir. Adenovirüs başka yaygın olarak kullanılan gen aktarım sistemidir. Retrovirüsler ve lentivirüsler farklı olarak, Adenovirüsler, entegre olmayan ve konakçı hücreler 8,10,11,19 genomik bütünlüğü ile karışmaz. Buna ek olarak, Adenovirüsler, bir çok hücre tipinde içine DNA transfekte olabilir ve enfeksiyon aktif hücre bölünmesi 19 bağlı değildir. Viral vektörler yeteneği 19,20 çoğaltılması zorunda adenovirüslerin başka önemli özelliği, vektör arınma kolaylığıdır. Bununla birlikte, bu sistemin en önemli uyarı adenovirüslerin, özellikle gen tedavisi çalışmalarında, birçok araştırmalarda kullanımını kısıtlayan, hedef hücrelerin ve organlar 19 güçlü bir bağışıklık tepkilerini tetikler olabilir. Bu farklı tip ile karşılaştırıldığındaViral vektörlerin s, rekombinant adeno-bağlantılı virüs (AAV) ideal bir gen iletim sisteminin 21,22 olduğu görülmektedir. Minimal immünojenite ve patojenitesini 23,24 sergiler. Buna ek olarak, rAAV bölünmesi ve bölünmeyen hücreleri hem de dahil olmak üzere hücre tiplerinin geniş bir yelpazede enfekte eder. Çoğu durumda, rAAV ana genomlarına entegre değildir; Bu nedenle, hedef hücrelerde arzu genetik ya da genomik değişiklik riski düşüktür 22&#39;dir. Son zamanlarda, rAAV sistemleri başarıyla fare kalp kası 23,25-29, DNA kodlayan proteinlerin miRNA&#39;lar, shRNAs ve CRISPR-gRNAs in vivo verilmesi için kullanılmaktadır. Bu metodoloji kardiyovasküler araştırma alanında temel araştırmalar ve gen tedavisi çalışmaları kolaylaştırmıştır. Burada detaylı bir işlemi etkin bir şekilde tarif edilmiştir aşın veya fare kalplerinde ilgi genleri demonte rAAV9 vektörleri üretir. Protokol, basit ve etkili bir yöntem temin etmektedirfare deneysel modellerde kalp gen ifadesi manipüle.

<table border="0" cellpadding="0" cellspacing="0" width="1175">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:575px;">Polyethylenimine, Linear (MW 25,000)</td>
			<td style="width:241px;">Polysciences, Inc.&#160;</td>
			<td style="width:192px;">#23966-2</td>
			<td style="width:167px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:575px;">Tube, Polypropylene, 36.2 mL, 25 x 87 mm, (qty. 56)</td>
			<td style="width:241px;">Beckman Coulter, Inc</td>
			<td style="width:192px;"># 362183</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:575px;">Nuclease, ultrapure</td>
			<td style="width:241px;">SIGMA</td>
			<td style="width:192px;">#E8263-25KU</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:575px;">Density Gradient Medium(Iodixanol)</td>
			<td style="width:241px;">SIGMA</td>
			<td style="width:192px;">#D1556-250ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:575px;">Centrifugal Filter Unit with Ultracel-100 membrane</td>
			<td style="width:241px;">EMD Millipore Corporation</td>
			<td style="width:192px;">#UFC910008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:575px;">Laboratory pipetting needle with 90&#176; blunt ends,gauge 14, L 6 in., nickel plated hub</td>
			<td style="width:241px;">SIGMA</td>
			<td style="width:192px;">#CAD7942-12EA</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:575px;">Poloxamer 188 solution (Pluronic&#174; F-68 solution)</td>
			<td style="width:241px;">SIGMA</td>
			<td style="width:192px;">P5556-100ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:575px;">Proteinase K</td>
			<td style="width:241px;">SIGMA</td>
			<td style="width:192px;">3115828001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:575px;">DNase I</td>
			<td style="width:241px;">Roche</td>
			<td style="width:192px;">10104159001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:575px;">Centrifuge machine</td>
			<td style="width:241px;">Thermo Scientific</td>
			<td style="width:192px;">75004260</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:575px;">Centrifuge System</td>
			<td style="width:241px;">Beckman Coulter</td>
			<td style="width:192px;">363118</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:575px;">Ultracentrifuge</td>
			<td style="width:241px;">Beckman Coulter</td>
			<td style="width:192px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:575px;">DMEM medium</td>
			<td style="width:241px;">Fisher Scientific</td>
			<td style="width:192px;">SH30243FS</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:575px;">Fetal Bovine Serum&#160;</td>
			<td style="width:241px;">Atlanta Biologicals&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;&#160;</td>
			<td style="width:192px;">S11150</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:575px;">rAAV9 vector</td>
			<td style="width:241px;">Penn Vector Core</td>
			<td style="width:192px;">P1967</td>
			<td></td>
		</tr>
	</tbody>
</table>

preparation of raav9 to overexpress or knockdown genes in mouse hearts

sıçan modellerinde genetik materyallerin miyokard teslim yoluyla ifade ya da belirli genlerin aktivitesini kontrol eden gen fonksiyonlarının soruşturma izin verir. merkezinde Bunların terapötik potansiyeli de belirlenebilir. Fare kalp in vivo molekül müdahale sınırlı yaklaşımlar bulunmaktadır. Rekombinant adeno-bağlantılı virüsü (AAV) tabanlı genom mühendisliği in vivo kardiyak gen manipülasyonu için gerekli bir araç olarak kullanılmıştır. Bu teknolojinin belirli avantajları minimal yüksek verimlilik, yüksek özgüllük, düşük genomik entegrasyon oranı dahil immünojenisite ve minimal patojenite. Burada, rAAV9 vektörleri, inşa paket ve arındırmak için detaylı bir prosedür açıklanmıştır. Yenidoğan yavruların halinde rAAV9 deri altı enjeksiyonu, karaciğer ve diğer dokularında güçlü bir ifade ya da fare kalbinde ilgili gen (ler) in etkin bir devirme ile sonuçlanır, fakat. Kalp-specifi kullanarakCı TnnT2 promoteri, kalp GFP geninin yüksek elde edildi. Ayrıca, rAAV9-U6-ShRNA kullanılmıştır zaman mRNA kalbinde inhibe edilmiştir hedef. rAAV9 teknoloji bilgisi çalışma kardiyovasküler araştırmalar için de faydalı olabilir.

RAAV9.cTNT :: GFP veya rAAV9.U6 :: shRNA plasmidlerin rAAV9 yapımı için strateji Şekil sırasıyla 1 ve 2, gösterilmiştir. Örnek olarak, rAAV9 vektörü, fare kalplerinde GFP geninin aşın ifade etmek üzere oluşturuldu. Elde edilen plazmid, iki ITR sitelerinin (Şekil 1) tarafından sınırlanan cTnT :: GFP kasetini içermektedir. RAAV9.U6 :: ShRNA vektör Trbp mRNA demonte inşa edilmiştir (Şekil 2)<...

Watch this Scientific Journal Video about Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts at JoVE.com

Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts

In this manuscript, a method to prepare recombinant adeno-associated virus 9 (rAAV9) vectors to manipulate gene expression in the mouse heart is described.

Fare Kalpler eksprese rAAV9 hazırlanması veya demonte Genler

Controlling the expression or activity of specific genes through the myocardial delivery of genetic materials in murine models permits the investigation ...

preparation-of-raav9-to-overexpress-or-knockdown-genes-in-mouse-hearts

Research

JoVE Journal

Genetics

12.7K Görüntüleme.  Boston Children's Hospital. In this manuscript, a method to prepare recombinant adeno-associated virus 9 (rAAV9) vectors to manipulate gene expression in the mouse heart is described. 

Video: Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts

The Use of Induced Somatic Sector Analysis (ISSA) for Studying Genes and Promoters Involved in Wood Formation and Secondary Stem Development

Secondary stem growth in trees and associated wood formation are significant both from biological and commercial perspectives. However, relatively little is known about the molecular control that governs their development. This is in part due to physical, resource and time limitations often associated with the study of secondary growth processes. A number of in vitro techniques have been used involving either plant part or whole plant system in both woody and non-woody plant species. However, questions about their applicability for the study of secondary stem growth processes, the recalcitrance of certain species and labor intensity are often prohibitive for medium to high throughput applications. Also, when looking at secondary stem development and wood formation the specific traits under investigation might only become measurable late in a tree&#39;s lifecycle after several years of growth. In addressing these challenges alternative in vivo protocols have been developed, named Induced Somatic Sector Analysis, which involve the creation of transgenic somatic tissue sectors directly in the plant&#39;s secondary stem. The aim of this protocol is to provide an efficient, easy and relatively fast means to create transgenic secondary plant tissue for gene and promoter functional characterization that can be utilized in a range of tree species. Results presented here show that transgenic secondary stem sectors can be created in all live tissues and cell types in secondary stems of a variety of tree species and that wood morphological traits as well as promoter expression patterns in secondary stems can be readily assessed facilitating medium to high throughput functional characterization.

The Use of Induced Somatic Sector Analysis ISSA for Studying Genes and Promoters Involved in Wood Formation and Secondary Stem Development

Here we present a protocol that facilitates the medium to high throughput functional characterization of gene and promoter constructs in tree secondary stem tissue within comparatively short time frames. It is efficient, easy to use and widely applicable to a range of tree species.

Ahşap Formasyonu ve İkincil Kök Gelişimi ile ilgilendim Genler ve Promoters incelenmesi için Kaynaklı Somatik Sektör Analizi (ISSA) Kullanımı

Secondary stem growth in trees and associated wood formation are significant both from biological and commercial perspectives. However, relatively little ...

Genetik

Peptide-derived Method to Transport Genes and Proteins Across Cellular and Organellar Barriers in Plants

The capacity to introduce exogenous proteins and express (or down-regulate) specific genes in plants provides a powerful tool for fundamental research as well as new applications in the field of plant biotechnology. Viable methods that currently exist for protein or gene transfer into plant cells, namely Agrobacterium and microprojectile bombardment, have disadvantages of low transformation frequency, limited host range, or a high cost of equipment and microcarriers. The following protocol outlines a simple and versatile method, which employs rationally-designed peptides as delivery agents for a variety of nucleic acid- and protein-based cargoes into plants. Peptides are selected as tools for development of the system due to their biodegradability, reduced size, diverse and tunable properties as well as the ability to gain intracellular/organellar access. The preparation, characterization and application of optimized formulations for each type of the wide range of delivered cargoes (plasmid DNA, double-stranded DNA or RNA, and protein) are described. Critical steps within the protocol, possible modifications and existing limitations of the method are also discussed.

Existing methods for the modification of plants have limited applicability. The novel peptide-derived technology proposed here promises both simplicity and efficiency in the introduction of exogenous protein or genes into the desired intracellular compartments of intact plants.

Peptit kaynaklı Yöntem Bitkiler Genler ve Proteinler Hücresel karşısında ve Organel Engeller Transport

The capacity to introduce exogenous proteins and express (or down-regulate) specific genes in plants provides a powerful tool for fundamental research as ...

Rearing and Double-stranded RNA-mediated Gene Knockdown in the Hide Beetle, Dermestes maculatus

Advances in genomics have raised the possibility of probing biodiversity at an unprecedented scale. However, sequence alone will not be informative without tools to study gene function. The development and sharing of detailed protocols for the establishment of new model systems in laboratories, and for tools to carry out functional studies, is thus crucial for leveraging the power of genomics. Coleoptera (beetles) are the largest clade of insects and occupy virtually all types of habitats on the planet. In addition to providing ideal models for fundamental research, studies of beetles can have impacts on pest control as they are often pests of households, agriculture, and food industries. Detailed protocols for rearing and maintenance of D. maculatus laboratory colonies and for carrying out dsRNA-mediated interference in D. maculatus are presented. Both embryonic and parental RNAi procedures-including apparatus set up, preparation, injection, and post-injection recovery-are described. Methods are also presented for analyzing embryonic phenotypes, including viability, patterning defects in hatched larvae, and cuticle preparations for unhatched larvae. These assays, together with in situ hybridization and immunostaining for molecular markers, make D. maculatus an accessible model system for basic and applied research. They further provide useful information for establishing procedures in other emerging insect model systems.

Rearing and Double-stranded RNA-mediated Gene Knockdown in the Hide Beetle, Dermestes maculatus

Here, we present protocols for rearing an intermediate-germ beetle, Dermestes maculatus (D. maculatus) in the lab. We also share protocols for embryonic and parental RNAi and methods for analyzing embryonic phenotypes to study gene function in this species.

Yetiştirme ve Gizle böcek RNA aracılı gen demonte çift sarmallı,<em&gt; Dermestes maculatus</em

Advances in genomics have raised the possibility of probing biodiversity at an unprecedented scale. However, sequence alone will not be informative ...

Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast

We describe a PCR- and homologous recombination-based system for generating targeted mutations in histone genes in budding yeast cells. The resulting mutant alleles reside at their endogenous genomic sites and no exogenous DNA sequences are left in the genome following the procedure. Since in haploid yeast cells each of the four core histone proteins is encoded by two non-allelic genes with highly homologous open reading frames (ORFs), targeting mutagenesis specifically to one of two genes encoding a particular histone protein can be problematic. The strategy we describe here bypasses this problem by utilizing sequences outside, rather than within, the ORF of the target genes for the homologous recombination step. Another feature of this system is that the regions of DNA driving the homologous recombination steps can be made to be very extensive, thus increasing the likelihood of successful integration events. These features make this strategy particularly well-suited for histone gene mutagenesis, but can also be adapted for mutagenesis of other genes in the yeast genome.

Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast

A strategy for generating mutations in histone genes at their endogenous location in Saccharomyces cerevisiae is presented.

Hedeflenen<em&gt; In situ</emBudding Maya&gt; Mutajenezis Histon ve Genler

We describe a PCR- and homologous recombination-based system for generating targeted mutations in histone genes in budding yeast cells. The resulting ...

Transient Expression of Foreign Genes in Insect Cells (sf9) for Protein Functional Assay

The transient gene expression system is one of the most important technologies for performing protein functional analysis in the baculovirus in vitro cell culture system. This system was developed to express foreign genes under the control of the baculoviral promoter in transient expression plasmids. Furthermore, this system can be applied to a functional assay of either the baculovirus itself or foreign proteins. The most widely and commercially available transient gene expression system is developed based on the immediate-early gene (IE) promoter of Orgyia pseudotsugata multicapsid nucleopolyhedrovirus (OpMNPV). However, a low expression level of foreign genes in insect cells was observed. Therefore, a transient gene expression system was constructed for improving protein expression. In this system, recombinant plasmids were constructed to contain the target sequence under the control of the Drosophila heat shock 70 (Dhsp70) promoter. This protocol presents the application of this heat shock-based pDHsp/V5-His (V5 epitope with 6 histidine)/Spodoptera frugiperda cell (sf9 cell) system; this system is available not only for gene expression but also for evaluating the anti-apoptotic activity of candidate proteins in insect cells. Furthermore, this system can be either transfected with one recombinant plasmid or co-transfected two potentially functionally antagonistic recombinant plasmids in insect cells. The protocol demonstrates the efficiency of this system and provides a practical case of this technique.

Transient Expression of Foreign Genes in Insect Cells sf9 for Protein Functional Assay

This protocol describes a heat shock-induced protein expression system (pDHsp/V5-His/sf9 cell system), which can be used for either expressing foreign proteins or evaluating the anti-apoptotic activity of potential foreign proteins and their truncated amino acids in insect cells.

Geçici ifade, yabancı genlerin Protein fonksiyonel tahlil için böcek hücrelerindeki (sf9)

The transient gene expression system is one of the most important technologies for performing protein functional analysis in the baculovirus in vitro cell ...

Simultaneous Video-EEG-ECG Monitoring to Identify Neurocardiac Dysfunction in Mouse Models of Epilepsy

In epilepsy, seizures can evoke cardiac rhythm disturbances such as heart rate changes, conduction blocks, asystoles, and arrhythmias, which can potentially increase risk of sudden unexpected death in epilepsy (SUDEP). Electroencephalography (EEG) and electrocardiography (ECG) are widely used clinical diagnostic tools to monitor for abnormal brain and cardiac rhythms in patients. Here, a technique to simultaneously record video, EEG, and ECG in mice to measure behavior, brain, and cardiac activities, respectively, is described. The technique described herein utilizes a tethered (i.e., wired) recording configuration in which the implanted electrode on the head of the mouse is hard-wired to the recording equipment. Compared to wireless telemetry recording systems, the tethered arrangement possesses several technical advantages such as a greater possible number of channels for recording EEG or other biopotentials; lower electrode costs; and greater frequency bandwidth (i.e., sampling rate) of recordings. The basics of this technique can also be easily modified to accommodate recording other biosignals, such as electromyography (EMG) or plethysmography for assessment of muscle and respiratory activity, respectively. In addition to describing how to perform the EEG-ECG recordings, we also detail methods to quantify the resulting data for seizures, EEG spectral power, cardiac function, and heart rate variability, which we demonstrate in an example experiment using a mouse with epilepsy due to Kcna1 gene deletion. Video-EEG-ECG monitoring in mouse models of epilepsy or other neurological disease provides a powerful tool to identify dysfunction at the level of the brain, heart, or brain-heart interactions.

Here, we present a protocol to record brain and heart bio signals in mice using simultaneous video, electroencephalography (EEG), and electrocardiography (ECG). We also describe methods to analyze the resulting EEG-ECG recordings for seizures, EEG spectral power, cardiac function, and heart rate variability.

Eş zamanlı Video-EEG-EKG Neurocardiac disfonksiyon epilepsi fare modelleri tanımlamak için izleme

In epilepsy, seizures can evoke cardiac rhythm disturbances such as heart rate changes, conduction blocks, asystoles, and arrhythmias, which can ...

qKAT: Quantitative Semi-automated Typing of Killer-cell Immunoglobulin-like Receptor Genes

Killer cell immunoglobulin-like receptors (KIRs) are a set of inhibitory and activating immune receptors, on natural killer (NK) and T cells, encoded by a polymorphic cluster of genes on chromosome 19. Their best-characterized ligands are the human leukocyte antigen (HLA) molecules that are encoded within the major histocompatibility complex (MHC) locus on chromosome 6. There is substantial evidence that they play a significant role in immunity, reproduction, and transplantation, making it crucial to have techniques that can accurately genotype them. However, high-sequence homology, as well as allelic and copy number variation, make it difficult to design methods that can accurately and efficiently genotype all KIR genes. Traditional methods are usually limited in the resolution of data obtained, throughput, cost-effectiveness, and the time taken for setting up and running the experiments. We describe a method called quantitative KIR semi-automated typing (qKAT), which is a high-throughput multiplex real-time polymerase chain reaction method that can determine the gene copy numbers for all genes in the KIR locus. qKAT is a simple high-throughput method that can provide high-resolution KIR copy number data, which can be further used to infer the variations in the structurally polymorphic haplotypes that encompass them. This copy number and haplotype data can be beneficial for studies on large-scale disease associations, population genetics, as well as investigations on expression and functional interactions between KIR and HLA.

Quantitative killer cell immunoglobulin-like receptor (KIR) semi-automated typing (qKAT) is a simple, high-throughput, and cost-effective method to copy number type KIR genes for their application in population and disease association studies.

qKAT: nicel Semi-automated yazmaktan katil hücreli immünglobulin benzeri reseptör gen

Killer cell immunoglobulin-like receptors (KIRs) are a set of inhibitory and activating immune receptors, on natural killer (NK) and T cells, encoded by a ...

An In Vitro Protocol for Evaluating MicroRNA Levels, Functions, and Associated Target Genes in Tumor Cells

MicroRNAs (miRNAs) are small regulatory RNAs which are recognized to modulate numerous intracellular signaling pathways in several diseases including cancers. These small regulatory RNAs mainly interact with the 3&#8217; untranslated regions (3&#8217; UTR) of their target messenger RNAs (mRNAs) ultimately resulting in the inhibition of decoding processes of mRNAs and the augmentation of target mRNA degradations. Based on the expression levels and intracellular functions, miRNAs are able to serve as regulatory factors of oncogenic and tumor-suppressive mRNAs. Identification of bona fide target genes of a miRNA among hundreds or even thousands of computationally predicted targets is a crucial step to discern the roles and basic molecular mechanisms of a miRNA of interest. Various miRNA target prediction programs are available to search possible miRNA-mRNA interactions. However, the most challenging question is how to validate direct target genes of a miRNA of interest. This protocol describes a reproducible strategy of key methods on how to identify miRNA targets related to the function of a miRNA. This protocol presents a practical guide on step-by-step procedures to uncover miRNA levels, functions, and related target mRNAs using the probe-based real-time polymerase chain reaction (PCR), sulforhodamine B (SRB) assay following a miRNA mimic transfection, dose-response curve generation, and luciferase assay along with the cloning of 3&#8217; UTR of a gene, which is necessary for proper understanding of the roles of individual miRNAs.

This protocol uses a probe-based real-time polymerase chain reaction (PCR), a sulforhodamine B (SRB) assay, 3&#8217; untranslated regions (3&#8217; UTR) cloning, and a luciferase assay to verify the target genes of a miRNA of interest and to understand the functions of miRNAs.

Tümör hücrelerinde MicroRNA seviyeleri, fonksiyonları ve Ilişkili hedef genler değerlendirmek için bir In vitro protokol

MicroRNAs (miRNAs) are small regulatory RNAs which are recognized to modulate numerous intracellular signaling pathways in several diseases including ...

In Vivo Forward Genetic Screen to Identify Novel Neuroprotective Genes in Drosophila melanogaster

There is much to understand about the onset and progression of neurodegenerative diseases, including the underlying genes responsible. Forward genetic screening using chemical mutagens is a useful strategy for mapping mutant phenotypes to genes among Drosophila and other model organisms that share conserved cellular pathways with humans. If the mutated gene of interest is not lethal in early developmental stages of flies, a climbing assay can be conducted to screen for phenotypic indicators of decreased brain functioning, such as low climbing rates. Subsequently, secondary histological analysis of brain tissue can be performed in order to verify the neuroprotective function of the gene by scoring neurodegeneration phenotypes. Gene mapping strategies include meiotic and deficiency mapping that rely on these same assays can be followed by DNA sequencing to identify possible nucleotide changes in the gene of interest.

In Vivo Forward Genetic Screen to Identify Novel Neuroprotective Genes in Drosophila melanogaster

We present a protocol using a forward genetic approach to screen for mutants exhibiting neurodegeneration in Drosophila melanogaster. It incorporates a climbing assay, histology analysis, gene mapping and DNA sequencing to ultimately identify novel genes related to the process of neuroprotection.

In vivo Ileri genetik ekran Drosophila melanogaster yeni Nörokoruyucu genler tanımlamak için

There is much to understand about the onset and progression of neurodegenerative diseases, including the underlying genes responsible. Forward genetic ...

Modulation of Tau Subcellular Localization as a Tool to Investigate the Expression of Disease-related Genes

Tau is a microtubule binding protein expressed in neurons and its main known function is related to the maintenance of cytoskeletal stability. However, recent evidence indicated that Tau is present also in other subcellular compartments including the nucleus where it is implicated in DNA protection, in rRNA transcription, in the mobility of retrotransposons and in the structural organization of the nucleolus. We have recently demonstrated that nuclear Tau is involved in the expression of the VGluT1 gene, suggesting a molecular mechanism that could explain the pathological increase of glutamate release in the early stages of Alzheimer&#39;s disease. Until recently, the involvement of nuclear Tau in modulating the expression of target genes has been relatively uncertain and ambiguous due to technical limitations that prevented the exclusion of the contribution of cytoplasmic Tau or the effect of other downstream factors not related to nuclear Tau. To overcome this uncertainty, we developed a method to study the expression of target genes specifically modulated by the nuclear Tau protein. We employed a protocol that couples the use of localization signals and the subcellular fractionation, allowing the exclusion of the interference from the cytoplasmic Tau molecules. Most notably, the protocol is easy and is composed of classic and reliable methods that are broadly applicable to study the nuclear function of Tau in other cell types and cellular conditions.

Tau is a neuronal protein present both in the cytoplasm, where it binds microtubules, and in the nucleus, where it exerts unconventional functions including the modulation of Alzheimer&#39;s disease-related genes. Here, we describe a method to investigate the function of nuclear Tau while excluding any interferences coming from cytoplasmic Tau.

Tau Subsellojen Lokalizasyonunun Hastalıkla İlgili Genlerin İfadesini Araştırmaaracı Olarak Modülasyonu

Tau is a microtubule binding protein expressed in neurons and its main known function is related to the maintenance of cytoskeletal stability. However, ...