Name: preparation of raav9 to overexpress or knockdown genes in mouse hearts
Uploaded: 2016-12-17T13:00:00.000+00:00
Duration: 11 min 11 s
Description: Watch this Scientific Journal Video about Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts at JoVE.com

We thank Dr. Zaffar Haque for careful reading of the manuscript. We thank Drs. Masaharu Kataoka and Gengze Wu for discussions and help. Work in the Wang lab is supported by the American Heart Association, Muscular Dystrophy Association, and NIH (HL085635, HL116919, HL125925).

모든 기술 단계는 바이오 안전성위원회와 보스턴 어린이 병원의 기관 동물 관리 및 사용위원회에 의해 승인 된 프로토콜에 따라 수행 하였다. 보스턴 어린이 병원은 규제 빛 / 어둠주기와 온도 조절과 무균 마우스 시설을 갖추고 있습니다. 수의학 및 동물 관리 직원의 변화 케이지는 마우스의 상태를 확인합니다. 시설은 AAALAC 인증을하고 활동적인 동물 복지 보증 인증 (AAALAC의 인증이 1992년 2월 24일 동물 복지 보증 번호를 부여. : A3303-01)이있다. 마우스는 가압 가스 공급원으로부터 공급 CO (2)에 의해 안락사시켰다. 조직 샘플은 정지 한 동물의 심장 박동수, 움직임 및 호흡 확인 후 수집 하였다. 신생아 설치류 2 안락사를 공동 내성과 날카로운 가위를 사용하여 잘린에 의해 안락사시켰다. 이러한 방법은 미국 수의학 메디카의 안락사에 대한 패널의 권고와 일치리터 협회. 플라스미드 백본으로의 cDNA 또는 shRNA를 발현 카세트를 복제하여 rAAV9를 구축 1. 생성 참고 : rAAV9 플라스미드 유전자 과발현에 사용되는 반전 터미널 반복 AAV2의 (LTR에)을 함유하는 닭 TNNT2 항구하도록 수정되었습니다 형질 유전자 25,26,29의 심근 - 특이 적 발현을 가능하게 프로모터 (rAAV9.cTNT). 고유 된 NheI 및 KpnI로 절단 부위는 프로모터 하류의 플라스미드에 도입되었다. 관심의 유전자를 코딩하는 cDNA 단편을 이들 두 제한 부위를 사용하여 25,26,29 rAAV9 골격 내로 클로닝 될 수있다. 여기서, 예를 들어, 마우스 마음에 GFP 유전자의 과발현을위한 rAAV9 벡터를 생성 하였다. 그 결과 플라스미드이 ITR 사이트 (그림 1) 측면에 나란히 서고 cTnT의 :: GFP 카세트가 포함되어 있습니다. rAAV9.U6 ::의 shRNA 구조는 25 녹다운 유전자를 사용 하였다. 사용하여 디자인 shRNA를온라인 shRNA를 디자인 서버. rAAV9.U6 :: shRNA를 어닐링함으로써 상기 U6 프로모터를 보유하는 제한 효소 소화 rAAV9 벡터로의 shRNA 서열을 DNA를 함유 올리고 결찰 또는 장거리하여 PCR과 분자 내 깁슨 조립체 기반 &quot;완벽&quot;하거나 생성 할 수있다 건설 30. 그 결과 플라스미드이 ITR 사이트 (그림 2) 측면에 나란히 서고 U6-shRNA를 카세트를 포함해야합니다. 여기서, 일례로서, rAAV9.U6 :: shRNA를 벡터는 mRNA의 Trbp (: GCAGTGATGGATATGCATCTTCTCGAGAAGATGCATATCCATCACTCG Trbp shRNA를 순서) 넉다운하도록 구성 하였다. 스크램블의 shRNA는 음성 대조군 (CCTAAGGTTAAGTCGCCCTCGCTCGAGCGAGGGCGACTTAACCTTAGG)로서 사용 하였다. <ol><li> rAAV9 플라스미드 골격으로하는 cDNA 또는 shRNA를 발현 카세트를 복제. 유능한 대장균 세포 (25)으로 DNA를 변형. 주 : DNA rAAV9 변환에 사용하거나 stbl3 STBL2 대장균 세포가 원하지 않는 ITR 재결합을 최소화하기. </li><li> 데리러형질 전환 된 대장균 세포에서 양성 클론. 릴리 - 바넷 매체의 500 ml의의 문화를 증폭하고 박테리아 세포 25-30에서 rAAV9 플라스미드를 추출합니다. 주 : MIDI / 맥시 DNA (&gt; 100 μg의) 높은 양을 얻기 위해 rAAV9 플라스미드 수험. 전술 한 바와 같이 바이러스를 생성하기 전에, 항상 제한 소화 및 아가 로스 겔 전기 영동에 의해 AAV 플라스미드 서열 무결성 분석 (http://www.vvf.uzh.ch/cloningservice/11bpdeletion/itrintegrity.html). </li></ol> rAAV9 플라스미드 HEK293 세포의 형질 감염 2 <ol><li> 선형 폴리에틸렌 이민 (PEI) 솔루션의 1 μg의 / μl를 준비합니다. 내 독소 무 DH에서 70-80 ℃로 가열 된 2 O를 PEI 분말을 녹인다. RT까지 애프터, 1 M HCl로 pH를 7.0으로 용액을 중화. 필터 소독 (0.22 μm의) 솔루션. 1 μg의 / μL PEI 원액 (1,400 μL / 튜브) 나누어지는 및 오디오 솔루션을 저장-20 ° C에서 이온. </li><li> 10 % 소 태아 혈청 (FBS) 및 1 % 페니실린 / 스트렙토 마이신을 둘 베코 변형 이글 중간 (DMEM)에서 배양 HEK293 세포. 배양 5 ± 0.5 %의 이산화탄소와 37 ° C의 배양기에서 세포 (CO 2). </li><li> 2 희석 : 1 일 0시 10 150-mm 요리에 1 분할&gt; 90 % 합류 세포의 형질 전환 이전에 18 ~ 20 시간을 HEK293 세포를 접시. 참고 : 1 일에, 세포는 90 %의 합류에 도달해야한다. </li><li> 1 일에서, rAAV9 플라스미드 (예를 들어, rAAV9.cTNT :: GFP 또는 rAAV6.U6 :: shRNA를 구축), 광고 도우미 플라스미드 및 PEI 25,26,29를 사용하여 AAV-담당자 / 캡 플라스미드와 HEK293 세포를 형질. <ol><li> 90 %의 합류 세포의 10 요리를 들어, 50 ml의 원심 분리기 튜브에 광고 도우미 플라스미드의 70 AAV-담당자 / 캡 플라스미드의 μg의, rAAV9 플라스미드 PF 70 μg의, 200 μg의 혼합. </li><li> 세포 융합 적은 경우 비례 DNA 량을 조정한다. 세포가 75 % 합류에있는 경우 예를 들어,을 줄이기비례 DNA의 양 (단계 2.4.1에 표시된 금액의 90분의 75) : 70 X 90분의 75 = AAV-담당자 / 캡 플라스미드의 58.3 μg의, rAAV9 플라스미드의 X 90분의 75 = 58.3 μg의 70, 200 X 믹스 50 ㎖의 원심 분리기 튜브 광고 도우미 플라스미드의 90분의 75 = 166.7 μg의. </li><li> 50 ML 튜브에 (FBS)없이 RT DMEM의 49 ML을 추가하고 잘 섞는다. </li><li> PEI를 만들기 위해 PEI 솔루션의 1,360 μl를 추가 : DNA 비율 (V / w)는 4 일 : 1. 잘 섞다. 30 분 - 15 RT에서 품어. </li><li> (열 150 mm 접시에 대해, 혼합물을 50 mL)을 각각 150 mm 접시에 단계 2.4.4에서 제조 한 혼합물을 5 mL를 추가한다. </li></ol></li><li> 문화 60-72 시간 동안 5 ± 0.5 % CO 2와 37 ° C를 인큐베이터에있는 세포. </li></ol> 3. 수확 트랜 HEK293의 세포와 rAAV9 벡터의 정화 <ol><li> 세포를 형질 감염 후 60-72 시간을 수확. 시키다 최대 피펫 팅하여 배양 배지 아래 접시에 세포를 정지. 멸균하는 모든 세포 현탁액을 전송50ml의 튜브. </li><li> 5 분 동안 500 XG에 세포를 원심 분리기. 각 튜브에 5 ㎖ PBS로 세포 펠렛을 재현 탁 한 50 ㎖ 튜브에 모든 세포 현탁액을 결합한다. </li><li> 5 분 동안 500 XG에 세포를 원심 분리기. 상층 액을 버린다. 이 단계에서, -80 ° C에서 세포 펠렛을 보관하거나 즉시 단계 3.4-3.15에 설명 된 것처럼 펠렛으로부터 AAV 정제. </li><li> 150 mM의 염화나트륨 및 20 mM 트리스 - 염산, pH가 8.0 : 용해 버퍼를 준비합니다. 필터 소독 (0.22 μM). 4 ° C에서 버퍼를 저장합니다. </li><li> 용해 완충액 10 mL로 펠렛을 재현 탁. </li><li> 해동 후 37 ° C에서 -80 ° C에서 또는 드라이 아이스 / 에탄올 배스에서 동결 해물. 1 분 동안 소용돌이. 동결과 용해 액을 3 회 해동. </li><li> 해동 해물로의 MgCl 2 용액을 추가 (1 mM의 수 분해물에서의 MgCl 2의 최종 농도를 확인하십시오). 250 U / ㎖의 최종 농도로 클레아 추가. DNA / 단백질 AGGR을 용해 15 분 동안 37 ℃에서 인큐베이션egation. 참고 : DNA / 단백질 응집은 클레아 제 또는 효소 처리 후 용해되지 않는 경우 다운스는 해물을 20 번 균질화. </li><li> 4 ℃에서 20 분 동안 4,800 XG에서 샘플을 원심 분리기. 상층 액을 수집합니다. </li><li> 한편, Iodixanol 그라데이션 용액을 제조 : <ol><li> 10 배 PBS 5 ㎖, 1 M의 MgCl 2, 0.05 ㎖, 1 M KCl을 0.125 ㎖, 5 M NaCl을 10 ㎖ 및 구배 매질 ofdensity 12.5 ml를 혼합하여 구배 용액의 17 %를 준비한다. H 2 O를 사용하여 50 ㎖로 전체 볼륨을 조절 </li><li> 10 배 PBS 5 ㎖, 1 M의 MgCl 2, 0.05 ㎖, 1 M KCl을 0.125 ㎖, 밀도 구배 배지 20 ㎖, 0.5 %, 0.2 ㎖ (w / v)의 페놀 레드를 혼합하여 25 % 용액을 제조 하였다. H 2 O를 사용하여 50 ㎖로 전체 볼륨을 조절 </li><li> 10 배 PBS 5 ㎖, 0.05 ~ 1 M의 MgCl 2 ㎖, 1 M KCl을 0.125 ㎖, 및 밀도 구배 매체를 33.3 mL로 혼합하여 40 % 용액을 제조 하였다. 사용하여 50 ㎖로 전체 볼륨을 조절H 2 O </li><li> 혼합하여 60 % 용액을 제조 0.05 ml의 1 M의 MgCl 2, 1 M KCl을 0.125 ㎖를 밀도 구배 배지 50 ㎖, 0.1 ㎖의 0.5 % (W / V) 페놀 레드. </li></ol></li><li> 바늘과 주사기, 바닥부터 60 % 5 17 %의 ㎖, 25 %의 5 ㎖, 40 % 5 ㎖ 및 5 ㎖의 순으로 폴리 프로필렌 튜브에 Iodixanol 구배 용액로드. 그라디언트의 상단에 단계 3.8 (14 ~ 16 ㎖)에서 얻은 모든 해물을 넣습니다. 아래에서 위로 나와 구배, 60 %, 40 %, 25 %, 17 %, 및 파쇄 층이다. 용해 버퍼와 튜브를 입력하고 코르크로 커버. </li><li> 16 ° C에서 90 분 동안 185,000 XG에 원심 분리기. </li><li> 주사기 바이러스 분획 (40 % 층)을 수확. 단지 40 %의 층을 흡입, 40 %와 60 % 분수 사이의 교차점에 바늘 (21 게이지)를 삽입합니다. 주 : 25 % 층의 어떤을 흡입하지 마십시오. </li><li> 멸균 폴리 옥시 에틸렌 - polyoxypro으로 바이러스 성 부분을 혼합15 ml의 총 부피 : 최대 pylene 블록 공중 PBS 용액 (PBS에 희석 10,000 10 % 폴리 옥시 에틸렌 - 폴리 옥시 프로필렌 블록 공중 합체의 1 개). 필터 튜브 (차단 MW = 100 kD의)에 혼합물을로드합니다. 4 ℃에서 30 분 동안 2,000 XG에 원심 분리기. </li><li> 하단의 솔루션을 폐기하십시오. 15 ml의 총 부피로 폴리 옥시 에틸렌 - 폴리 옥시 프로필렌 블록 공중 합체를 PBS 용액으로 필터 튜브 리필. 4 ℃에서 20 분 동안 2,000 XG에 원심 분리기. 이 단계를 두 번 더 반복합니다. 정제 된 rAAV9 바이러스 (필터 위의 부분)를 수집합니다. </li><li> 1.7 mL의 튜브에 필터 튜브의 정제 rAAV9을 전송합니다. 정제 된 rAAV9 나누어지는 (100 - AAV의 볼륨 및 역가에 따라 400 μL / 튜브) 및 -80 ° C에서 바이러스를 저장합니다. 참고 : 반복 동결 해빙을 피하십시오. </li></ol> rAAV9의 역가 4. 측정 <ol><li> 표준 DNA 샘플을 준비합니다. <ol><li> 구체적이고 효율적인 PCR 디자인rAAV9 벡터에 대한 프라이머와는 PCR 조건을 최적화 할 수 있습니다. 참고 : &quot;TCGGGATAAAAGCAGTCTGG, 역방향 : 정 TCGGACGGAGATACGTGAGT을&quot;이 연구에 사용 된 프라이머이다. PCR 반응은 다음과 같은 조건으로 수행 하였다 : 초기 변성을 3 분 동안 95 ℃로; 20 초, 15 초, 60 ° C, 10 초 동안 72 ° C 95 ° C의 35주기; 10 분 동안 72 ℃에서 최종 연장. rAAV9 벡터에 삽입 된 서열을 PCR (31)의 특이성 및 효율에 영향을 미칠 수있다 그러나, 최적화 된 프라이머와 PCR 조건은 특정 플라스미드이다. </li><li> 단계 4.1.1에 도시 된 상태로 PCR 반응을 수행한다. 겔 추출 키트와 PCR 생성물을 정제 하였다. </li><li> 분광 광도계를 사용하여 정제 된 DNA의 농도를 측정한다. PCR 산물의 분자량 / 길이에 기초 DNA 분자 수의 농도를 계산한다. <ol><li> 다음 식을 사용하여 분자의 농도를 계산한다 모lecular 농도 (DNA 분자 또는 조각 / ㎖) = 6.23 × 10 23 몰 -1 X 콘. × 10 -6 / MW. 참고 : (6.23 × 10 23 몰 -1 Avagadro의 수이다 콘 : DNA 농도 μg의 / ㎖에서, MW : g / 몰의 분자량). PCR 산물의 수득 농도가 100 μg의 / ㎖이고, 길이는 200 bp의 경우, 예를 들어, 이중 가닥 DNA의 분자량은 각각의 뉴클레오티드 2 X 200 X 310 = 124,000 (평균 분자량은 단일 가닥 DNA는 약 310g / 몰)입니다. 분자 농도 (DNA 분자 / ㎖)을 6.23 X 10 23 몰 -1 × 100 μg의 / ㎖ X 10-6 / 124,000g / 몰 = 5.18 × 106 (14) DNA 분자 / ㎖를 =. </li><li> 1013 분자 / ㎖, 10 내지 12 분자 / ㎖, 1011 분자 / ㎖, 1010 분자 / ㎖, 109 분자 / ㎖, (10)의 농도의 DNA 단편의 일련의 희석을 수행하여 표준 시료를 조제 <sup&gt; 8 분자 / ㎖, 10 (7) 분자 / ㎖. (단계 4.6, qPCR에) 정량 PCR의 각 표준 샘플 액 1 μl를 사용합니다. </li></ol></li></ol></li><li> 10 배의 DNase 완충액 5 μL, 1 μL의 DNase (10,000 U / ㎖)이 DDH O. 39 μl의 총 부피는 50 μL로 정제되어야 rAAV9 용액 5 μl를 섞는다. </li><li> 잔류 패키징 플라스미드 DNA를 제거하기 위해 30 분 동안 37 ℃에서 유리 병을 부화. </li><li> 10 분 동안 95 ° C에서 DNase의 불활. 용액을 냉각 H 2 O 44 μL, 10 배의 DNase 버퍼의 5 μL 및 테 K 주식의 1 μL (10 ㎎ / ㎖)를 추가합니다. </li><li> 2 시간 동안 50 ° C에서 상기 용액을 인큐베이션. 반응을 정지하고 10 분간 95 ℃에서 테 K 불 활성화. </li><li> 정량적 PCR (qPCR에) 분석을위한 시료의 1 μl를 사용합니다. 역가를 계산합니다. <ol><li> 샘플의 FR을 사용하여 단계 4.1.1 설계 프라이머로 정량적 PCR (qPCR에)를 실행옴 단계 4.1.4 (표준 시료) 및 4.5 단계에서 (샘플을 측정 할). <ol><li> 각 반응의 경우, (Taq 중합 효소,의 dNTP 혼합물, 버퍼의 MgCl 2 및 녹색 염료 함유) 배 그린 마스터 믹스를 10 ㎕의 정방향 프라이머 (5 μM) 0.5 ㎕의 역방향 프라이머 (5 μM) 0.5 ㎕를 혼합 H 2 O 8 μL, 샘플 1 ㎕를 측정한다. 다음의 조건을 qPCR을 수행하여 2 분, 10 분, 95 ° C, 50 ° C에서 샘플을 보유; 15 초 동안 1 분 동안 60 ° C에서 95 ° C에서 40 사이클을 수행; 용융 단계를 들면, 30 초, 15 초 동안 60 ° C에서 95 ° C에서 샘플을 배양한다. 표준 시료 (그림 3)의 C T 번호에 따라 표준 곡선을 생성합니다. </li></ol></li><li> 표준 곡선에 대한 AAV 샘플의 분자 농도 / 역가를 계산합니다. rAAV9 단일 가닥 DNA 게놈을 가지고 있으므로, 분자 농도보다 2 배 것계산 된 값 (배 전원 (10, y)를,도 3b). 또한, 정제 rAAV9의 역가 인해 DNase를 테와 K의 반응에 바이러스 (100 μl의 총 5 μL)의 1시 20분 희석 계산에서 얻어진 것보다 더 높은 20 배 것이다. </li></ol></li></ol> 마음에 신생아 마우스 및 유전자 발현 분석 실험 5. rAAV9 주입 <ol><li> 폴리 옥시 에틸렌 - 폴리 옥시 프로필렌 블록 공중 합체 PBS 용액 rAAV9 작업 용액을 준비한다. 1-7 × 10 12 입자 / ml의의 역가와 바이러스 재고를 확인하십시오. 참고 : 피하 주사하여 각 출생 후의 일 0.5 ~ 1.5 마우스로 rAAV9 솔루션의 50-70 μl를 제공합니다. 효율적인 유전자 과발현 또는 최저를 달성하기 위하여, 주입 AAV의 양을 최적화하기 위해 각 연구에 대한 파일럿 테스트를 수행 할 것을 권장한다. 바이어스를 최소화하기 위해 각 연구 rAAV9.cTNT :: 루크 또는 rAAV9.U6 :: 스크램블 컨트롤의 동일한 금액을 사용합니다. 참고 : 우리는 1.5을 사용× 10 11 개 / 강아지 과발현 및 2.5 - 출생 후 하루 0.5 ~ 1.5 마일 CE)에서 최저 5 × 10 11 개 / 강아지. </li><li> 피하 주사에 의해 P0.5-P2.5에서 rAAV9와 신생아 쥐를 치료. <ol><li> rAAV9 솔루션과 29G1 / 2, 0.33 X 12.7 mm 인슐린 주사기를 사전 입력합니다. 공기 방울을 제거주의하십시오. </li><li> 엄지와 집게 손가락으로 한 손에 극저온 마취 강아지를 잡으십시오. 주입 전에, 무균 상태를 유지하기 위해 70 % 이소 프로필 알콜로 포화 된 면봉 막대기와 강아지의 피부를 다시 와이프. 5 내지 10 °의 각도에서 동물의 전방 - 등쪽 피하에 주사기 바늘을 삽입한다. 인슐린 주사기를 사용 rAAV9 용액 50-70 ㎕를 주입한다. 참고 rAAV9 또한 복강 내 또는 정맥 내 주사 (26, 27)를 통해 마우스에 전달 될 수있다. 마음에 전달 된 유전자의 효율적인 표현을 얻을 수있다. 그러나, 복강 내 분사이온은 때때로 간에서 새는 표현 될 수 있습니다. 주입 후, 새끼 조건 매일 모니터링 하였다. </li></ol></li><li> 마음에 유전자 발현의 수준은 qPCR에, 면역 형광 또는 웨스턴 블롯으로 모니터링 할 수 있습니다 (대표 결과는 그림 4에 표시됩니다 5) 25, 26. 참고 : 마우스는 압축 가스 소스로부터 전달 CO 2 안락사시켰다. 조직 샘플은 동물의 심장 박동수, 움직임 및 호흡이 멈춘 것을 확인한 후 수집 하였다. 신생아 설치류 2 안락사를 공동 내성과 날카로운 가위를 사용하여 잘린에 의해 안락사시켰다. 이 방법은 미국 수의학 협회의 안락사에 대한 패널의 권고와 일치한다. </li></ol>

<ol>
	<li>Primrose, S. B., Twyman, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Principles of gene manipulation and genomics. , (2013).</li><li>Doudna, J. A., Charpentier, E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+new+frontier+of+genome+engineering+with+CRISPR-Cas9.">The new frontier of genome engineering with CRISPR-Cas9.</a> Science. 346, 1258096 (2014).</li><li>Gaj, T., Gersbach, C. A., Barbas, C. F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=ZFN,+TALEN,+and+CRISPR/Cas-based+methods+for+genome+engineering.">ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering.</a> Trends Biotechnol. 31, 397-405 (2013).</li><li>Hsu, P. D., Lander, E. S., Zhang, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Development+and+applications+of+CRISPR-Cas9+for+genome+engineering.">Development and applications of CRISPR-Cas9 for genome engineering.</a> Cell. 157, 1262-1278 (2014).</li><li>Sander, J. D., Joung, J. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas+systems+for+editing,+regulating+and+targeting+genomes.">CRISPR-Cas systems for editing, regulating and targeting genomes.</a> Nat. Biotechnol. 32, 347-355 (2014).</li><li>Szulc, J., Wiznerowicz, M., Sauvain, M. -. O., Trono, D., Aebischer, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+versatile+tool+for+conditional+gene+expression+and+knockdown.">A versatile tool for conditional gene expression and knockdown.</a> Nat. Methods. 3, 109-116 (2006).</li><li>Nimesh, S., Halappanavar, S., Kaushik, N. K., Kumar, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+Gene+Delivery+Systems.">Advances in Gene Delivery Systems.</a> BioMed Res. Int. 2015, 610342 (2015).</li><li>Kamimura, K., Suda, T., Zhang, G., Liu, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Advances+in+gene+delivery+systems.">Advances in gene delivery systems.</a> Pharm. Med. 25, 293-306 (2011).</li><li>Thomas, C. E., Ehrhardt, A., Kay, M. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progress+and+problems+with+the+use+of+viral+vectors+for+gene+therapy.">Progress and problems with the use of viral vectors for gene therapy.</a> Nat. Rev. Genet. 4, 346-358 (2003).</li><li>Giacca, M., Zacchigna, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-mediated+gene+delivery+for+human+gene+therapy.">Virus-mediated gene delivery for human gene therapy.</a> J. Control Release. 161, 377-388 (2012).</li><li>Witlox, M., Lamfers, M., Wuisman, P., Curiel, D., Siegal, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evolving+gene+therapy+approaches+for+osteosarcoma+using+viral+vectors:+review.">Evolving gene therapy approaches for osteosarcoma using viral vectors: review.</a> Bone. 40, 797-812 (2007).</li><li>De Miguel, M. P., Cheng, L., Holland, E. C., Federspiel, M. J., Donovan, P. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dissection+of+the+c-Kit+signaling+pathway+in+mouse+primordial+germ+cells+by+retroviral-mediated+gene+transfer.">Dissection of the c-Kit signaling pathway in mouse primordial germ cells by retroviral-mediated gene transfer.</a> Proc. Natl. Acad. Sci. USA. 99, 10458-10463 (2002).</li><li>Nagano, M., Shinohara, T., Avarbock, M. R., Brinster, R. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retrovirus-mediated+gene+delivery+into+male+germ+line+stem+cells.">Retrovirus-mediated gene delivery into male germ line stem cells.</a> FEBS Lett. 475, 7-10 (2000).</li><li>Scharfmann, R., Axelrod, J. H., Verma, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+in+vivo+expression+of+retrovirus-mediated+gene+transfer+in+mouse+fibroblast+implants.">Long-term in vivo expression of retrovirus-mediated gene transfer in mouse fibroblast implants.</a> Proc. Natl. Acad. Sci. USA. 88, 4626-4630 (1991).</li><li>Katz, R. A., Greger, J. G., Skalka, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+cell+cycle+status+on+early+events+in+retroviral+replication.">Effects of cell cycle status on early events in retroviral replication.</a> J. Cell. Biochem. 94, 880-889 (2005).</li><li>Escors, D., Breckpot, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lentiviral+vectors+in+gene+therapy:+their+current+status+and+future+potential.">Lentiviral vectors in gene therapy: their current status and future potential.</a> Arch. Immunol. Ther. Exp. 58, 107-119 (2010).</li><li>M&#225;trai, J., Chuah, M. K., VandenDriessche, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Recent+advances+in+lentiviral+vector+development+and+applications.">Recent advances in lentiviral vector development and applications.</a> Mol. Ther. 18, 477-490 (2010).</li><li>Miyazaki, Y., Miyake, A., Nomaguchi, M., Adachi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Structural+dynamics+of+retroviral+genome+and+the+packaging.">Structural dynamics of retroviral genome and the packaging.</a> Front. Microbiol. 2, 1-9 (2011).</li><li>Douglas, J. T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus-Mediated+Gene+Delivery.">Adenovirus-Mediated Gene Delivery.</a> Gene Delivery to Mammalian Cells: Volume 2: Viral Gene Transfer Techniques. , 3-14 (2004).</li><li>Armend&#225;riz-Borunda, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Production+of+first+generation+adenoviral+vectors+for+preclinical+protocols:+amplification,+purification+and+functional+titration.">Production of first generation adenoviral vectors for preclinical protocols: amplification, purification and functional titration.</a> J. Biosci. Bioeng. 112, 415-421 (2011).</li><li>Snyder, R. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adeno-associated+virus-mediated+gene+delivery.">Adeno-associated virus-mediated gene delivery.</a> J Gene Med. 1, 166-175 (1999).</li><li>Samulski, R. J., Muzyczka, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=AAV-mediated+gene+therapy+for+research+and+therapeutic+purposes.">AAV-mediated gene therapy for research and therapeutic purposes.</a> Annu. Rev. Virol. 1, 427-451 (2014).</li><li>Kaplitt, M. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+gene+transfer+in+porcine+myocardium+after+coronary+infusion+of+an+adeno-associated+virus+vector.">Long-term gene transfer in porcine myocardium after coronary infusion of an adeno-associated virus vector.</a> Ann. Thorac. Surg. 62, 1669-1676 (1996).</li><li>Kaspar, B. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Myocardial+gene+transfer+and+long-term+expression+following+intracoronary+delivery+of+adeno-associated+virus.">Myocardial gene transfer and long-term expression following intracoronary delivery of adeno-associated virus.</a> J. Gene. Med. 7, 316-324 (2005).</li><li>Ding, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trbp+regulates+heart+function+through+microRNA-mediated+Sox6+repression.">Trbp regulates heart function through microRNA-mediated Sox6 repression.</a> Nat. Genet. 47, 776-783 (2015).</li><li>Lin, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cardiac-specific+YAP+activation+improves+cardiac+function+and+survival+in+an+experimental+murine+MI+model.">Cardiac-specific YAP activation improves cardiac function and survival in an experimental murine MI model.</a> Circ. Res. 115, 354-363 (2014).</li><li>Wahlquist, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Inhibition+of+miR-25+improves+cardiac+contractility+in+the+failing+heart.">Inhibition of miR-25 improves cardiac contractility in the failing heart.</a> Nature. 508, 531-535 (2014).</li><li>Carroll, K. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mouse+model+for+adult+cardiac-specific+gene+deletion+with+CRISPR/Cas9.">A mouse model for adult cardiac-specific gene deletion with CRISPR/Cas9.</a> Proc. Natl. Acad. Sci. USA. 113, 338-343 (2016).</li><li>Jiang, J., Wakimoto, H., Seidman, J., Seidman, C. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Allele-specific+silencing+of+mutant+Myh6+transcripts+in+mice+suppresses+hypertrophic+cardiomyopathy.">Allele-specific silencing of mutant Myh6 transcripts in mice suppresses hypertrophic cardiomyopathy.</a> Science. 342, 111-114 (2013).</li><li>Gibson, D. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Enzymatic+assembly+of+DNA+molecules+up+to+several+hundred+kilobases.">Enzymatic assembly of DNA molecules up to several hundred kilobases.</a> Nat. Methods. 6, 343-345 (2009).</li><li>Rychlik, W., Spencer, W., Rhoads, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimization+of+the+annealing+temperature+for+DNA+amplification+in+vitro.">Optimization of the annealing temperature for DNA amplification in vitro.</a> Nucleic Acids Res. 18, 6409-6412 (1990).</li><li>Allocca, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Serotype-dependent+packaging+of+large+genes+in+adeno-associated+viral+vectors+results+in+effective+gene+delivery+in+mice.">Serotype-dependent packaging of large genes in adeno-associated viral vectors results in effective gene delivery in mice.</a> J. Clin. Invest. 118, 1955-1964 (2008).</li><li>Wu, Z., Yang, H., Colosi, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effect+of+genome+size+on+AAV+vector+packaging.">Effect of genome size on AAV vector packaging.</a> Mol. Ther. 18, 80-86 (2010).</li><li>Li, J., Sun, W., Wang, B., Xiao, X., Liu, X. -. Q. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+trans-splicing+as+a+means+for+viral+vector-mediated+in+vivo+gene+therapy.">Protein trans-splicing as a means for viral vector-mediated in vivo gene therapy.</a> Hum. Gene Ther. 19, 958-964 (2008).</li><li>Piras, B. A., O'Connor, D. M., French, B. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Systemic+delivery+of+shRNA+by+AAV9+provides+highly+efficient+knockdown+of+ubiquitously+expressed+GFP+in+mouse+heart,+but+not+liver.">Systemic delivery of shRNA by AAV9 provides highly efficient knockdown of ubiquitously expressed GFP in mouse heart, but not liver.</a> PLoS One. 8, e75894 (2013).</li><li>Lovric, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Terminal+differentiation+of+cardiac+and+skeletal+myocytes+induces+permissivity+to+AAV+transduction+by+relieving+inhibition+imposed+by+DNA+damage+response+proteins.">Terminal differentiation of cardiac and skeletal myocytes induces permissivity to AAV transduction by relieving inhibition imposed by DNA damage response proteins.</a> Mol. Ther. 20, 2087-2097 (2012).</li></ol>

The authors have nothing to disclose.

이 플라스미드를 구조 중에 원하지 ITR 재결합을 최소화하는 것이 중요하다. 바이러스를 생성하기 전에, 하나는 항상 제한 분해 및 아가 로스 겔 전기 영동을 사용하여 플라스미드 AAV ITR의 무결성을 모니터링한다. 이는 100 % 그대로 플라스미드를 획득하는 것은 불가능하지만, 재결합 율은 가급적 최소화되어야한다. 20 % 미만에 성공 rAAV9 포장 허용됩니다. 참고로, 저급 진탕 속도 (RPM 180-200)와 하부 ?...

A correction was made to the Authors section in: <a href="http://www.jove.com/video/54787">Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts</a>.
One of the authors names and affiliation was corrected from:
Jian-Ming Jiang3,4 
3 Department of Genetics, Harvard Medical School 
4 Howard Hughes Medical Institute
to:
Jianming Jiang5 
5 Department of Biochemistry, Yong Loo Lin School of Medicine, National University of Singapore

A correction was made to the Authors section in: <a href="http://www.jove.com/video/54787">Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts</a>.

Erratum: Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts

다양한 생물학적 시스템에서 특정 유전자의 발현 또는 활성을 제어하는 유전자 기능 (1)의 연구에 귀중한 전략이되고있다. 이러한 목적을 달성하는 직접적인 방법은 뉴클레오티드 서열을 조작하여 돌연변이 대립 유전자를 생성한다. 살아있는 세포의 게놈에 정확한 타겟 변경하는 것은있을지라도 a는 시간과 노동 집약적 인 연습, 강력한 TALEN 및 Crispr / Cas9 도구의 개발은 게놈 편집 2-5의 새로운 시대를 열었습니다. 유전자 조작보다 일상적인 실험 방법은 유전 물질 (DNA를 코딩 서열 또는 siRNA를 / shRNA를 포함하는 RNA를) 명시 적 또는 관심 1,6의 유전자 (들)를 넉다운 할 수있는 세포로을의 도입에 초점을 맞추고있다. 많은 경우에, 유전자 조작을위한 주요 병목 세포 내로 DNA, RNA 또는 단백질의 전달이다. 시험관 연구와 관련, 효율적인 transfecti로시스템에 많은 배양 세포 라인에 설립되었습니다. 그러나, 특히 마우스 모델에서 생체 내 유전자 전달은 더 도전이다. 외인성 시약의 효율적인 세포 흡수를 달성하기 위하여 바이 패스 될 필요 역외 세포 내 장벽의 시리즈가있다. 추가 장애물은 신속한 통관 및 전달 물질의 7,8의 짧은 기간을 포함한다. 이러한 문제를 회피하기위한 한 가지 전략은 생체 내 유전자 전달에 대한 &quot;캐리어&quot;또는 &quot;차량&quot;으로 바이러스 벡터를 사용하는 것이다. 바이러스의 자연적 진화 전달 특성은 세포 7,9,10에 관심있는 유전자의 효율적인 전달을 할 수 있습니다. 바이러스 벡터의 많은 종류가 개발 마우스에서 다른 유형의 세포 및 기관의 생체 내 유전자 조작 유연한 사용되었다. 가장 일반적으로 사용되는 바이러스 시스템은 레트로 바이러스, 렌티 바이러스, 아데노 바이러스 및 아데노 - 관련 바이러스 (AAV)를 포함 <s&gt; 11입니다. 레트로 바이러스는 단일 가닥 RNA 바이러스이며 표적 세포 및 기관 12-14에서 형질 도입 유전자의 평생 발현의 가능성을 제공하고, 유사 분열 분할 중에 안정한 방식으로 숙주 세포의 게놈에 유전 물질을 도입 할 수있다. 그러나, 레트로 바이러스의 여러 유형의 세포만을 분할 감염, 비 - 분할 세포의 효능 15 매우 낮다. 이 유전자 전달을 위해 자신의 유틸리티를 제한합니다. 렌티 바이러스는 Retroviridae 가족의 속입니다. 다른 레트로 바이러스와는 달리, 렌티 바이러스 모두 분할 및 비 - 분할 세포를 감염시킬 수있는 널리 포스트 유사 분열 및 고도로 분화 된 세포 (16)에 유전자 전달을 위해 사용되었다. 렌티 바이러스의 생활주기는 숙주 게놈 내로 벡터 DNA의 통합을 포함한다. 따라서,의 Lentivirus이 매개 유전자 전달은 형질 유전 적 요소 16-18의 안정적이고 오래 지속 표현을 할 수 있습니다. 그러나이 기능은 이중 전자를 나타낼 수있다벡터 DNA의 통합 삽입 성 돌연변이를 초래할 수있다 이러한 바이러스의 사용 dged 검, 유전자 발현을 조작 할 및 숙주 세포에 artefactual 효과를 일으킬 수 있습니다. 아데노 다른 널리 사용되는 유전자 전달 시스템이다. 레트로 바이러스 및 렌티 바이러스와는 달리, 아데노 바이러스는 비 통합하고 숙주 세포의 게놈 8,10,11,19 무결성을 방해하지 않는다. 또한, 아데노 바이러스는 많은 종류의 세포로 DNA를 형질 감염 할 수 있으며, 감염 활성 세포 분열 (19)에 의존하지 않다. 바이러스 벡터의 능력 (19, 20)를 복제 할 필요 같이 아데노 바이러스의 또 다른 중요한 특징은, 벡터 정제의 용이성이다. 그러나, 이러한 시스템의 주요주의 할 점은 아데노 바이러스 감염, 특히 유전자 치료 연구에서, 여러 연구에서의 사용을 제한하는 대상 세포 및 기관 (19)의 강한 면역 반응을 유발할 수 있다는 것이다. 서로 다른 유형에 비해바이러스 벡터들, 재조합 아데노 - 관련 바이러스 (rAAV)는 이상적인 유전자 전달 시스템 (21, 22)로 나타난다. 그것은 최소한의 면역 원성 및 병원성 (23, 24)을 나타낸다. 또한 rAAV는 핵공 포함한 세포 유형의 넓은 범위를 감염시킨다. 대부분의 경우, rAAV가 숙주 게놈에 통합되지 않는다; 따라서, 표적 세포의 바람직하지 않은 유전자 또는 게놈 변화의 위험이 낮은 (22)이다. 최근 rAAV 시스템 성공적 쥐 심근 23,25-29 DNA로 인코딩 단백질의 miRNAs, shRNA를하고 Crispr-gRNAs의 생체 내 전달을 위해 사용되었다. 이 방법론은 심혈관 연구 분야의 기초 연구 및 유전자 치료 연구를 촉진했다. 여기서, 자세한 절차는 효율적으로 기술되었다 과발현 또는 마우스 마음에 대한 관심의 유전자를 녹다운 rAAV9 벡터를 생성한다. 프로토콜은 간단하고 효과적인 방법을 제공한다실험 쥐 모델에서 심장 유전자 발현을 조작.

<table><tbody><tr><td>Polyethylenimine, Linear (MW 25,000)</td><td>Polysciences, Inc.&amp;nbsp;</td><td>#23966-2</td><td></td></tr><tr><td>Tube, Polypropylene, 36.2 ml, 25 x 87 mm, (qty. 56)</td><td>Beckman Coulter, Inc</td><td># 362183</td><td></td></tr><tr><td>Nuclease, ultrapure</td><td>SIGMA</td><td>#E8263-25KU</td><td></td></tr><tr><td>Density Gradient Medium(Iodixanol)</td><td>SIGMA</td><td>#D1556-250ML</td><td></td></tr><tr><td>Centrifugal Filter Unit with Ultracel-100 membrane</td><td>EMD Millipore Corporation</td><td>#UFC910008</td><td></td></tr><tr><td>Laboratory pipetting needle with 90&amp;deg; blunt ends,gauge 14, L 6 in., nickel plated hub</td><td>SIGMA</td><td>#CAD7942-12EA</td><td></td></tr><tr><td>Poloxamer 188 solution (Pluronic&amp;reg; F-68 solution)</td><td>SIGMA</td><td>P5556-100ML</td><td></td></tr><tr><td>Proteinase K</td><td>SIGMA</td><td>3115828001</td><td></td></tr><tr><td>DNase I</td><td>Roche</td><td>10104159001</td><td></td></tr><tr><td>Centrifuge machine</td><td>Thermo Scientific</td><td>75004260</td><td></td></tr><tr><td>Centrifuge System</td><td>Beckman Coulter</td><td>363118</td><td></td></tr><tr><td>Ultracentrifuge</td><td>Beckman Coulter</td><td></td><td></td></tr><tr><td>DMEM medium</td><td>Fisher Scientific</td><td>SH30243FS</td><td></td></tr><tr><td>Fetal Bovine Serum&amp;nbsp;</td><td>Atlanta Biologicals&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;&amp;nbsp;</td><td>S11150</td><td></td></tr><tr><td>rAAV9 vector</td><td>Penn Vector Core</td><td>P1967</td><td></td></tr></tbody></table>

preparation of raav9 to overexpress or knockdown genes in mouse hearts

뮤린 모델에서 유전 물질의 전달을 통해 심근 발현 또는 특정 유전자의 활성을 조절하는 유전자 기능의 조사를 허용한다. 마음에 그들의 치료 가능성도 결정될 수있다. 마우스 마음에 생체 분자의 개입에 대한 제한된 접근 방법이있다. 재조합 아데노 관련 바이러스 (rAAV) 기반 게놈 엔지니어링은 생체 내 심장 유전자 조작을위한 필수적인 도구로 활용되고있다. 이 기술의 구체적인 장점은 최소한의 높은 효율, 특이성, 낮은 게놈 통합 레이트를 포함 면역 원성, 최소한의 병원성. 여기서, rAAV9 벡터를 구성하는 패키지와 정화 상세한 절차를 설명한다. 신생아 새끼로 rAAV9의 피하 주사는 간 및 기타 조직에서 강력한 발현 또는 마우스 심장에 대한 관심의 유전자 (들)의 효율적인 최저의 결과가 아니라. 심장-보고 특정 사용C TnnT2 프로모터, 마음에 GFP 유전자의 고 발현을 얻었다. 또한, rAAV9-U6-shRNA를가 이용 될 때의 mRNA가 마음에 억제 대상. rAAV9 기술의 지식을 작업 심장 혈관 연구에 유용 할 수있다.

rAAV9.cTNT : GFP 또는 rAAV9.U6 :: shRNA를 플라스미드 rAAV9 구조에 대한 전략은 각각도 1 및도 2에 나타내었다. 예로서, rAAV9 벡터는 마우스의 마음에 GFP 유전자를 과발현하기 위해 생성 하였다. 그 결과 플라스미드이 ITR 사이트 (그림 1) 측면에 나란히 서고 cTnT의 :: GFP 카세트가 포함되어 있습니다. rAAV9.U6 :: shRNA를 벡터가 Trbp의 mRNA를 넉다운하?...

Watch this Scientific Journal Video about Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts at JoVE.com

Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts

In this manuscript, a method to prepare recombinant adeno-associated virus 9 (rAAV9) vectors to manipulate gene expression in the mouse heart is described.

마우스 마음에서 과발현하는 rAAV9의 제조 또는 최저 유전자

Controlling the expression or activity of specific genes through the myocardial delivery of genetic materials in murine models permits the investigation ...

preparation-of-raav9-to-overexpress-or-knockdown-genes-in-mouse-hearts

Research

JoVE Journal

Genetics

12.7K 조회수.  Boston Children's Hospital. In this manuscript, a method to prepare recombinant adeno-associated virus 9 (rAAV9) vectors to manipulate gene expression in the mouse heart is described. 

비디오: Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts

Delivery of Modified mRNA in a Myocardial Infarction Mouse Model

Myocardial infarction (MI) is a leading cause of morbidity and mortality in the Western world. In the past decade, gene therapy has become a promising treatment option for heart disease, owing to its efficiency and exceptional therapeutic effects. In an effort to repair the damaged tissue post-MI, various studies have employed DNA-based or viral gene therapy but have faced considerable hurdles due to the poor and uncontrolled expression of the delivered genes, edema, arrhythmia, and cardiac hypertrophy. Synthetic modified mRNA (modRNA) presents a novel gene therapy approach that offers high, transient, safe, nonimmunogenic, and controlled mRNA delivery to the heart tissue without any risk of genomic integration. Due to these remarkable characteristics combined with its bell-shaped pharmacokinetics in the heart, modRNA has become an attractive approach for the treatment of heart disease. However, to increase its effectiveness in vivo, a consistent and reliable delivery method needs to be followed. Hence, to maximize modRNA delivery efficiency and yield consistency in modRNA use for in vivo applications, an optimized method of preparation and delivery of modRNA intracardiac injection in a mouse MI model is presented. This protocol will make modRNA delivery more accessible for basic and translational research.

This protocol presents a simple and coherent way to transiently upregulate a gene of interest using modRNA after myocardial infarction in mice.

심근 경색 마우스 모델에서 수정된 mRNA의 납품

Myocardial infarction (MI) is a leading cause of morbidity and mortality in the Western world. In the past decade, gene therapy has become a promising ...

연구

유전학

Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging

Cardiac myocytes isolated from adult hearts are widely accepted as a model somewhere half way between embryonic and neonatal muscle cells on one side and a working heart on the other. Thus, cardiomyocytes serve as good models for cardiac cellular physiology and pathophysiology, for pharmaceutical investigations as well as for the exploration of transgenic animal models. Here we describe a method of isolating the cells from the heart. Furthermore we show how a genetic manipulation on cardiac myocytes can be performed without breeding a transgenic animal: This is the combination of long term culture (1 week) and adenoviral gene transfer. The latter one is described from the construction of the virus to the transduction of the cells. It can be used for the expression of genetically encoded biosensors (GEBs), fluorescent fusion proteins, but also for protein over expression and down regulation, e.g. using RNAi. Here we provide an example for the expression of a fusion protein staining a subcellular structure (Golgi). Such protein expression can be visualized by confocal imaging of z-stacks for a 3D-reconstruction of subcellular structures. The protocol comprises state-of-the-art in cell culture, molecular biology and biophysics and thus provides an approach for exploring new horizons in cellular cardiology.

Adult cardiac myocytes are primary cells that can be isolated from animal hearts and cultured for several days. Within this culture period adenoviral gene transfer can be used to express genetically encoded biosensors (GEBs) or fluorescent fusion proteins. Both approaches allow cellular investigations by means of confocal microscopy.

공촛점 이미징에 대한 분리 및 성인 심장 Myocytes의 유전자 조작

Cardiac myocytes isolated from adult hearts are widely accepted as a model somewhere half way between embryonic and neonatal muscle cells on one side and ...

생물학

Electroporation-based transgenesis of Cardiac cells in mouse hearts(생쥐 심장의 심장 세포의 전기천공법 기반 형질전환)

An Efficient Transgenesis Approach for Gene Delivery in the Mouse Embryonic Heart

The mammalian heart is a complex organ formed during development via highly diverse populations of progenitor cells. The origin, timing of recruitment, and fate of these progenitors are vital for the proper development of this organ. The molecular mechanisms that govern the morphogenesis of the heart are essential for understanding the pathogenesis of congenital heart diseases and embryonic cardiac regeneration. Classical approaches to investigate these mechanisms employed the generation of transgenic mice to assess the function of specific genes during cardiac development. However, mouse transgenesis is a complex, time-consuming process that often cannot be performed to assess the role of specific genes during heart development. To address this, we have developed a protocol for efficient electroporation and culture of mouse embryonic hearts, enabling transient transgenesis to rapidly assess the effect of gain- or loss-of-function of genes involved in cardiac development. Using this methodology, we successfully overexpressed Meis1 in the embryonic heart, with a preference for epicardial cell transfection, demonstrating the capabilities of the technique.

저자 스포트라이트: 신속한 유전자 스크리닝을 위한 심장 세포 형질전환(Cardiac Cell Transgenesis)

This protocol presents a detailed methodological framework for electroporation-based transgenesis of cardiac cells in developing mouse hearts. The video assets provided here will facilitate learning of this versatile technique.

마우스 배아 심장에서 유전자 전달을 위한 효율적인 transgenesis 접근법

The mammalian heart is a complex organ formed during development via highly diverse populations of progenitor cells. The origin, timing of recruitment, ...

발생학

Adeno-Associated Virus-Mediated Delivery of CRISPR for Cardiac Gene Editing in Mice

The clustered, regularly interspaced, short, palindromic repeat (CRISPR) system has greatly facilitated genome engineering in both cultured cells and living organisms from a wide variety of species. The CRISPR technology has also been explored as novel therapeutics for a number of human diseases. Proof-of-concept data are highly encouraging as exemplified by recent studies that demonstrate the feasibility and efficacy of gene editing-based therapeutic approach for Duchenne muscular dystrophy (DMD) using a murine model. In particular, intravenous and intraperitoneal injection of the recombinant adeno-associated virus (rAAV) serotype rh.74 (rAAVrh.74) has enabled efficient cardiac delivery of the Staphylococcus aureus CRISPR-associated protein 9 (SaCas9) and two guide RNAs (gRNA) to delete a genomic region with a mutant codon in exon 23 of mouse Dmd gene. This same approach can also be used to knock out the gene-of-interest and study their cardiac function in postnatal mice when the gRNA is designed to target the coding region of the gene. In this protocol, we show in detail how to engineer rAAVrh.74-CRISPR vector and how to achieve highly efficient cardiac delivery in neonatal mice.

Here we provide a detailed protocol to carry out in vivo cardiac gene editing in mice using recombinant Adeno-Associated Virus(rAAV)-mediated delivery of CRISPR. This protocol offers a promising therapeutic strategy to treat dystrophic cardiomyopathy in Duchenne muscular dystrophy and can be used to generate cardiac-specific knockout in postnatal mice.

Adeno 관련 바이러스 중재 배달 심장 유전자 쥐에서 편집에 대 한 CRISPR의

The clustered, regularly interspaced, short, palindromic repeat (CRISPR) system has greatly facilitated genome engineering in both cultured cells and ...

의학

Cell Labeling and Injection in Developing Embryonic Mouse Hearts

Testing the fate of embryonic or pluripotent stem cell-derivatives in in vitro protocols has led to controversial outcomes that do not necessarily reflect their in vivo potential. Preferably, these cells should be placed in a proper embryonic environment in order to acquire their definite phenotype. Furthermore, cell lineage tracing studies in the mouse after labeling cells with dyes or retroviral vectors has remained mostly limited to early stage mouse embryos with still poorly developed organs. To overcome these limitations, we designed standard and ultrasound-mediated microinjection protocols to inject various agents in targeted regions of the heart in mouse embryos at E9.5 and later stages of development. &#160;Embryonic explant or embryos are then cultured or left to further develop in utero. These agents include fluorescent dyes, virus, shRNAs, or stem cell-derived progenitor cells. Our approaches allow for preservation of the function of the organ while monitoring migration and fate of labeled and/or injected cells. These technologies can be extended to other organs and will be very helpful to address key biological questions in biology of development.

We describe a series of methods to inject dyes, DNA vectors, virus, and cells in order to monitor both cell fate and phenotype of endogenous and grafted cells derived from embryonic or pluripotent cells within mouse embryos at embryonic day (E)9.5 and later stages of development.

배아의 마우스 하트을 개발에있는 셀의 레테르를 붙이는 및 사출

Testing the fate of embryonic or pluripotent stem cell-derivatives in in vitro protocols has led to controversial outcomes that do not necessarily reflect ...

In vitro Assessment of Cardiac Reprogramming by Measuring Cardiac Specific Calcium Flux with a GCaMP3 Reporter

Cardiac reprogramming has become a potentially promising therapy to repair a damaged heart. By introducing multiple transcription factors, including Mef2c, Gata4, Tbx5 (MGT), fibroblasts can be reprogrammed into induced cardiomyocytes (iCMs). These iCMs, when generated in situ in an infarcted heart, integrate electrically and mechanically with the surrounding myocardium, leading to a reduction in scar size and an improvement in heart function. Because of the relatively low reprogramming efficiency, purity, and quality of the iCMs, characterization of iCMs remains a challenge. The currently used methods in this field, including flow cytometry, immunocytochemistry, and qPCR, mainly focus on cardiac-specific gene and protein expression but not on the functional maturation of iCMs. Triggered by action potentials, the opening of voltage-gated calcium channels in cardiomyocytes leads to a rapid influx of calcium into the cell. Therefore, quantifying the rate of calcium influx is a promising method to evaluate cardiomyocyte function. Here, the protocol introduces a method to evaluate iCM function by calcium (Ca2+) flux. An &#945;MHC-Cre/Rosa26A-Flox-Stop-Flox-GCaMP3 mouse strain was established by crossing Tg(Myh6-cre)1Jmk/J (referred to as Myh6-Cre below) with Gt(ROSA)26Sortm38(CAG-GCaMP3)Hze/J (referred to as Rosa26A-Flox-Stop-Flox-GCaMP3 below) mice. Neonatal cardiac fibroblasts (NCFs) from P0-P2 neonatal mice were isolated and cultured in vitro, and a polycistronic construction of MGT was introduced to NCFs, which led to their reprogramming to iCMs. Because only successfully reprogrammed iCMs will express GCaMP3 reporter, the functional maturation of iCMs can be visually assessed by Ca2+ flux with fluorescence microscopy. Compared with un-reprogrammed NCFs, NCF-iCMs showed significant calcium transient flux and spontaneous contraction, similar to CMs. This protocol describes in detail the mouse strain establishment, isolation and selection of neonatal mice hearts, NCF isolation, production of retrovirus for cardiac reprogramming, iCM induction, the evaluation of iCM Ca2+ flux using our reporter line, and related statistical analysis and data presentation. It is expected that the methods described here will provide a valuable platform to assess the functional maturation of iCMs for cardiac reprogramming studies.

We describe here, the establishment and application of an Tg(Myh6-cre)1Jmk/J /Gt(ROSA)26Sortm38(CAG-GCaMP3)Hze/J (referred to as &#945;MHC-Cre/Rosa26A-Flox-Stop-Flox-GCaMP3 below) mouse reporter line for cardiac reprogramming assessment. Neonatal cardiac fibroblasts (NCFs) isolated from the mouse strain are converted into induced cardiomyocytes (iCMs), allowing for convenient and efficient evaluation of reprogramming efficiency and functional maturation of iCMs via calcium (Ca2+) flux.

GCaMP3 리포터와 심장 특정 칼슘 플럭스를 측정하여 심장 재프로그래밍의 체외 평가

Cardiac reprogramming has become a potentially promising therapy to repair a damaged heart. By introducing multiple transcription factors, including ...

Selective Gene Silencing in the Choroid Plexus

Targeted Knockdown of Genes in the Choroid Plexus

The choroid plexus (ChP) serves as a critical gateway for immune cell infiltration into the central nervous system (CNS) under both physiological and pathological conditions. Recent research has shown that regulating ChP activity may offer protection against CNS disorders. However, studying the biological function of the ChP without affecting other brain regions is challenging due to its delicate structure. This study presents a novel method for gene knockdown in ChP tissue using adeno-associated viruses (AAVs) or cyclization recombination enzyme (Cre) recombinase protein consisting of TAT sequence (CRE-TAT). The results demonstrate that after injecting AAV or CRE-TAT into the lateral ventricle, the fluorescence was exclusively concentrated in the ChP. Using this approach, the study successfully knocked down the adenosine A2A receptor (A2AR) in the ChP using RNA interference (RNAi) or Cre/locus of X-overP1 (Cre/LoxP) systems, and showed that this knockdown could alleviate the pathology of experimental autoimmune encephalomyelitis (EAE). This technique may have important implications for future research on the ChP's role in CNS disorders.

저자 스포트라이트: 맥락총(Choroid Plexus) 연구를 위한 유전자 발현 조작 기법의 통찰력과 혁신 

Here, we describe a method to selectively alter gene expressions in the choroid plexus while avoiding any impact in other brain areas.

맥락총(Choroid Plexus)에서 유전자의 표적 녹다운(Targeted knockdown of Genes in the Choroid Plexus)

The choroid plexus (ChP) serves as a critical gateway for immune cell infiltration into the central nervous system (CNS) under both physiological and ...

마우스 마음에서 과발현하는 rAAV9의 제조 또는 최저 유전자

요약

더 많은 비디오 탐색

이 비디오의 챕터

심근 경색 마우스 모델에서 수정된 mRNA의 납품

공촛점 이미징에 대한 분리 및 성인 심장 Myocytes의 유전자 조작

마우스 배아 심장에서 유전자 전달을 위한 효율적인 transgenesis 접근법

마우스 배아 심장에서 유전자 전달을 위한 효율적인 transgenesis 접근법

마우스 배아 심장에서 유전자 전달을 위한 효율적인 transgenesis 접근법

Adeno 관련 바이러스 중재 배달 심장 유전자 쥐에서 편집에 대 한 CRISPR의

배아의 마우스 하트을 개발에있는 셀의 레테르를 붙이는 및 사출

GCaMP3 리포터와 심장 특정 칼슘 플럭스를 측정하여 심장 재프로그래밍의 체외 평가

맥락총(Choroid Plexus)에서 유전자의 표적 녹다운(Targeted knockdown of Genes in the Choroid Plexus)

맥락총(Choroid Plexus)에서 유전자의 표적 녹다운(Targeted knockdown of Genes in the Choroid Plexus)