Este trabalho foi financiado por doações R01DE018138 dos Institutos Nacionais de Saúde (PX) e, em parte, pela Virginia Commonwealth University Programa de Incentivo à Pesquisa Presidencial (PRIP) 144602-3 (PX). Agradecemos os drs. Lei Chen, Yuetan Dou e Xiaojing Wang para ajudar com a construção de mutantes do genoma de largura. Agradecemos também o Core Facility DNA da Virginia Commonwealth University de sequenciamento de DNA.

1. Projeto Primer <ol><li> Os iniciadores são concebidos utilizando em scripts casa baseada na S. sanguinis seqüência do genoma SK36. Três conjuntos de primers, F1/R1, F2/R2 e F3/R3 foram concebidos para amplificação da 1-kb de sequência a montante do gene alvo, a APHA-3 gene que codifica a resistência à canamicina (Km r) da proteína 3 e do 1 -kb de sequência a jusante do gene alvo, respectivamente (Figura 1). Entre estes iniciadores, F1 e R3 são concebidos utilizando ePrimer3 na suite de programas EMBOSS ( <a href="http://emboss.sourceforge.net/apps/cvs/emboss/apps/index.html" target="_blank">http://emboss.sourceforge.net/apps/cvs/emboss/apps/index.html</a> ) para amplificar as regiões que flanqueiam a montante ou a jusante do alvo gene. Iniciadores específicos do gene, R1 e F3, foram concebidos com base na extremidade 5 &#39;e 3&#39; as sequências do gene-alvo. Primers R1 e F3 contêm sequências de 25 pb adaptador no seu final 5 &#39;que são complementares a APHA-3gene. As temperaturas de fusão de cada um dos iniciadores foram concebidos para serem tão próximo quanto possível de 60 ° C para permitir a utilização de uma temperatura uniforme do recozimento para todas as reacções de PCR em formato de 96 poços. </li><li> F1, R1, R3, F3 e iniciadores são sintetizados em placas de 96 poços com base em uma ordem de genes. Cada placa contém um tipo de iniciadores na ordem mesmo gene. Diluir os primers em placa de 96 poços de primer de trabalho para uma concentração final de 10 uM para a amplificação por PCR, utilizando uma pipeta multicanal. </li></ol> 2. High-throughput Amplificação por PCR e Purificação <ol><li> Para alto rendimento amplificar 1-kb a montante ou a jusante do alvo S. genes sanguinis, montar uma mistura cocktail de PCR em gelo, num tubo cónico de 15 ml contendo 1640 uL DDH 2 O, 250 ul 10xHigh Fidelity PCR Buffer, 200 ul de 10 mM de mistura dNTP, 100 ul de 50 mM de MgSO4, 100 ul de 10 ng / ul S. sanguinis DNA genómico SK36 e 10 ul Platinum Taq DNA polimetilmetacrilatorase de alta fidelidade e transferência de 23 uL da mistura para cada poço na placa de 96 poços de PCR, utilizando uma pipeta multicanal. Transferir 1 ul de cada F1 e R1 (ou F3 e R3), a partir das placas de 10 uM de iniciadores úteis para a placa de PCR, utilizando uma pipeta multicanal. Selar a placa de PCR e amplificação de realizar a 94 ° C durante 1 min, e 30 ciclos de 94 ° C durante 30 seg, 54 ° C durante 30 seg e 68 ° C durante 1,5 min. </li><li> Prepare 1% de gel de agarose contendo brometo de etídio com 48 poços de carregamento pipeta multicanal encaixe. Mix 4 uL do produto de PCR com 1 ul de tampão de carga 5xDNA em placa de 96 poços e carregar as amostras em gel de agarose utilizando uma pipeta multicanal de 10 jil. Executar a electroforese a 135 V durante 30 min. Examine a banda em gel sob UVP documentação e sistema de análise. </li><li> Purifica-se o produto de PCR por PureLink kit de purificação de PCR utilizando 96 de centrifugação de acordo com as instruções do fabricante. Para a eluição de DNA, adicionar 40 ul estéril DDH 2 O para o bem da binding placa. </li><li> Escolher aleatoriamente vários amplicons na placa para examinar as concentrações de ADN, utilizando espectrofotometria NanoDrop. Ajustar a concentração de amplicons na placa de ~ 10 ng / ul. </li><li> Um plasmídeo contendo km cassete r é digerido com EcoR I como molde de PCR. O plasmídeo digerido é purificado através de kit de purificação PCR QIAquick e o DNA linear do plasmídeo é ajustada para a concentração final de ADN de 10 ng / ul. Montar 25 ul de mistura de amplicon km cassete incluindo r 16,4 ul DDH 2 O, 2,5 ul 10xHigh Fidelity PCR Buffer, 2 ul de 10 mM mistura de dNTP, 1 ul de 50 mM Mg SO 4, 1 ul de 10 mM F2, 1 ul de 10 R2 ^ M, 1 ul de DNA linear do plasmídeo e 0,1 ul de Platinum Taq DNA polimerase de alta fidelidade. Realização da amplificação de PCR a 94 ° C durante 1 min, e 30 ciclos de 94 ° C durante 30 seg, 55 ° C durante 30 seg e 68 ° C durante 1 min. Examinar o produto de PCR por electroforese em gel de agarose a 1%. Poola maior parte do fragmento amplificado cassete km r desde 10 indivíduo PCR purificado por QIAquick kit de purificação de PCR. Ajustar a concentração de amplicon de 10 ng / ul. </li><li> Para obter a última linear amplicon de PCR recombinante, três amplicons de PCR são combinados uns com os uL 1 (em quantidades aproximadamente iguais-molar) em uma placa de PCR bem como o modelo de PCR. Outros componentes de PCR é adicionado 14,4 ul incluindo DDH 2 O, 2,5 ul 10xHigh Fidelity PCR Buffer, 2 ul de 10 mM de mistura de dNTP, 1 ul de 50 mM Mg SO 4, 1 ul de 10 mM de F1, 1 ul de 10 R3 ^ M, 0,1 ul de Platinum Taq DNA polimerase de alta fidelidade. A amplificação por PCR é realizada a 94 ° C durante 2 min, 30 ciclos de 94 ° C durante 30 segundos a 55 ° C durante 30 seg e 68 ° C durante 3,5 min, e finalmente 68 ° C durante 4 min. </li><li> Examinar o amplicons PCR em gel de agarose. Purificar e quantificar os produtos de amplificação por PCR como descrito acima. Congelar os amplicons de PCR recombinados a -20 ° C. </li></ol> 3. ComPreparação Células competente <ol><li> Caldo Todd Hewitt é preparado, pH ajustado para 7,6 utilizando NaOH 10 N, aquecida à ebulição e depois arrefeceu-se até à temperatura ambiente e esterilizada utilizando poliestireno 0,22 uM de filtro 4. Adicionar 300 ul de cavalo inactivado pelo calor soro (concentração final de 2,5%) a 11,7 ml de caldo Todd Hewitt a 15 ml tubo cónico para compensar TH + HS médio. TH alíquota + HS médio em 2 ml e de 10 ml em tubos. </li><li> Inocular 5 ul de estoque S. sanguinis SK36 congelado a -80 ° C em 2 ml de meio HT + HS e incubar a cultura durante a noite com capeamento hermeticamente, a 37 ° C, acompanhado por pré-incubação a 10 ml + TH-tubo HS. </li><li> Depois de uma noite, transferir 50 ul da cultura em 10 ml de TH + HS e incubar o tubo a 37 ° C durante 3 h (correspondente a OD 660 de 0,07-0,08), imediatamente utilizando para a transformação. </li></ol> 4. Transformação de células e selecção de antibióticos <ol><li> Adicionam-se 2 jil de 70 ng S. sanguinis SK36 competênciatência peptídeo estimulante (CSP) e 2 ul de PCR recombinante linear amplicon (~ 50 ng) para tubos Eppendorf com 96 poços de bloco e pré-aquecê-los a 37 ° C. Transferir 330 uL de 3 hr-incubada SK36 cultura em cada tubo. Incubar a 37 ° C durante 1 h. Substitua DNA com estéril DDH 2 O como controle. </li><li> Colocar o bloco de gelo e espalhar 100 ul de cada transformação em infusão de cérebro e coração (BHI) em placa de ágar com 500 ug / ml de canamicina. Incubar as placas a 37 ° C durante 2 d em condições de microaerofilia. </li></ol> 5. Confirmação mutante e Armazenamento <ol><li> Para cada mutante de substituição, aleatoriamente pegar 2 colónias individuais, inocular a colónia em 5 ml de BHI contendo 500 ug / ml de canamicina e incubadas durante a noite o inoculo microaerobically a 37 ° C. Criopreservar cada cultura em glicerol a 30% à temperatura de -80 ° C </li><li> Para examinar se o mutante contendo o gene de substituição previsto, executar colónia PCR para cada mutante utilizando F1 e R3primers em placa de 96 poços PCR. Cerca de cultura 1-ul durante a noite a partir de colónias individuais é utilizado como o molde de ADN de 25-ul de reacção de amplificação por PCR. A PCR é realizada a 94 ° C durante 5 min, 35 ciclos de 94 ° C durante 30 seg, 55 ° C durante 30 seg e 68 ° C durante 3,5 min, e finalmente 68 ° C durante 4 min. </li><li> Para identificar precisamente banda dupla mutantes ou amplicon PCR contaminante, examine o amplicon de PCR por eletroforese durante 4 h em&gt; 12 cm de comprimento de 2% em gel de agarose com brometo de etídio coloração. Sob esta condição eletroforese em gel de agarose, os fragmentos amplificados com uma diferença de ≥ 100 pb foram claramente identificadas. Quando as bandas resultantes da amplificação da cassete de Km e r o gene do tipo selvagem são antecipados para diferir &lt;100 bp, um iniciador interno T1 é usado para determinar se um gene de tipo selvagem pode ser detectada por PCR. </li><li> Para confirmar ainda mais a eliminação, os amplicons são purificados por PureLink kit de purificação de PCR 96 e sequenciado utilizando o iniciador P1 queliga-se a cassete de r Km. Mantenha apenas os mutantes corretas confirmados por seqüenciamento. </li></ol>

<ol>
	<li>Sassetti, C. M., Boyd, D. H., Rubin, E. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genes+required+for+mycobacterial+growth+defined+by+high+density+mutagenesis.">Genes required for mycobacterial growth defined by high density mutagenesis.</a> Mol. Microbiol. 48, 77-84 (2003).</li><li>Kobayashi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Essential+Bacillus+subtilis+genes.">Essential Bacillus subtilis genes.</a> Proc. Natl. Acad. Sci. U.S.A. 100, 4678-4683 (2003).</li><li>Trieu-Cuot, P., Courvalin, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nucleotide+sequence+of+the+Streptococcus+faecalis+plasmid+gene+encoding+the+3'5"-aminoglycoside+phosphotransferase+type+III.">Nucleotide sequence of the Streptococcus faecalis plasmid gene encoding the 3'5"-aminoglycoside phosphotransferase type III.</a> Gene. 23, 331-341 (1983).</li><li>Paik, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+virulence+determinants+for+endocarditis+in+Streptococcus+sanguinis+by+signature-tagged+mutagenesis.">Identification of virulence determinants for endocarditis in Streptococcus sanguinis by signature-tagged mutagenesis.</a> Infect. Immun. 73, 6064-6074 (2005).</li><li>Lukomski, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonpolar+inactivation+of+the+hypervariable+streptococcal+inhibitor+of+complement+gene+(sic)+in+serotype+M1+Streptococcus+pyogenes+significantly+decreases+mouse+mucosal+colonization.">Nonpolar inactivation of the hypervariable streptococcal inhibitor of complement gene (sic) in serotype M1 Streptococcus pyogenes significantly decreases mouse mucosal colonization.</a> Infect. Immun. 68, 535-542 (2000).</li><li>Baba, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+Escherichia+coli+K-12+in-frame,+single-gene+knockout+mutants:+the+Keio+collection.">Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection.</a> Mol. Syst. Biol. 2, (2006).</li><li>de Berardinis, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+complete+collection+of+single-gene+deletion+mutants+of+Acinetobacter+baylyi+ADP1.">A complete collection of single-gene deletion mutants of Acinetobacter baylyi ADP1.</a> Mol. Syst. Biol. 4, 174 (2008).</li><li>Rodriguez, A. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Physiological+and+molecular+characterization+of+genetic+competence+in+Streptococcus+sanguinis.">Physiological and molecular characterization of genetic competence in Streptococcus sanguinis.</a> Mol. Oral. Microbiol. 26, 99-116 (2011).</li><li>Perry, D., Kuramitsu, H. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+transformation+of+Streptococcus+mutans+Infect.">Genetic transformation of Streptococcus mutans Infect.</a> Immun. 32, 1295-1297 (1981).</li><li>Pakula, R., Walczak, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=On+the+nature+of+competence+of+transformable+streptococci.">On the nature of competence of transformable streptococci.</a> J. Gen. Microbiol. 31, 125-133 (1963).</li><li>Datsenko, K. A., Wanner, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=One-step+inactivation+of+chromosomal+genes+in+Escherichia+coli+K-12+using+PCR+products.">One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products.</a> Proc. Natl. Acad. Sci. U.S.A. 97, 6640-6645 (2000).</li><li>Xu, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+essential+gene+identification+in+Streptococcus+sanguinis.">Genome-wide essential gene identification in Streptococcus sanguinis.</a> Sci. Rep. 1, (2011).</li></ol>

Não há conflitos de interesse declarados.

Para minimizar os possíveis efeitos polares da substituição de um gene-alvo com antibióticos gene exógeno em genes vizinhos, duas medidas são tomadas enquanto cartilha inicial de projeto. Para a maioria dos genes deletados, o R1 e F3 primers são concebidos para eliminar a região codificadora de 6 pb a seguir ao codão de iniciação para 30 pb antes do codão de paragem. Os últimos 30 pares de base são mantidas para proteger local potencial de ligação ribossomal usado por um gene adjacente a jusante. A regi?...

<table border="1"&gt;<tbody&gt;<tr&gt;<td<strong&gt; Nomes</strong</td&gt;<td<strong&gt; Empresa</strong</td&gt;<td<strong&gt; Catalog #</strong</td&gt;<td<strong&gt; Comentários (opcional)</strong</td&gt;</tr&gt;<tr&gt;<td&gt; Primer F2</td&gt;<td&gt; Integrated DNA Technologies</td&gt;<td</td&gt;<td&gt; TGACTAACTAGGAGGAATAAATG<br/&gt; GCTAAAATGAGAATAT</td&gt;</tr&gt;<tr&gt;<td&gt; R2 Primer</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; CATTATTCCCTCCAGGTACTAAAA<br/&gt; CAATTCATCCAGT</td&gt;</tr&gt;<tr&gt;<td&gt; Primer F2P</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GATAAACCCAGCGAACCATTTGA</td&gt;</tr&gt;<tr&gt;<td&gt; P1 Primer</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GCTTATATACCTTAGCAGGAGACA</td&gt;</tr&gt;<tr&gt;<td&gt; P2 Primer</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GTATGACATTGCCTTCTGCGTCC</td&gt;</tr&gt;<tr&gt;<td&gt; Primer 5 &#39;end_R1_seq</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GCCATTTATTCCTCCTAGTTAGTCA</td&gt;</tr&gt;<tr&gt;<td&gt; Primer 5 &#39;end_F3_seq</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; GTTTTAGTACCTGGAGGGAATAATG</td&gt;</tr&gt;<tr&gt;<td&gt; Primer 5 &#39;end_R1p_seq</td&gt;<td&gt; Ibid</td&gt;<td</td&gt;<td&gt; CCTCAAATGGTTCGCTGGGTTTATC</td&gt;</tr&gt;<tr&gt;<td&gt; CSP</td&gt;<td&gt; Synprep</td&gt;<td</td&gt;<td&gt; Sequência: NH2-DLRGVPNPWGWIFGR-COOH</td&gt;</tr&gt;<tr&gt;<td&gt; DNA Polymerase</td&gt;<td&gt; Invitrogen</td&gt;<td&gt; 11304-102</td&gt;<td&gt; Platinum Taq DNA Polymerase High Fidelity</td&gt;</tr&gt;<tr&gt;<td&gt; EcoRI</td&gt;<td&gt; New England Biolabs Inc.</td&gt;<td&gt; R0101S</td&gt;<td&gt; Enzima de restrição</td&gt;</tr&gt;<tr&gt;<td&gt; Agar</td&gt;<td&gt; American Bioanalytical</td&gt;<td&gt; AB01185</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; Agarose</td&gt;<td&gt; Promega</td&gt;<td&gt; V3125</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; BHI</td&gt;<td&gt; BD Biosciences</td&gt;<td&gt; 237500</td&gt;<td&gt; Brain Heart Infusion</td&gt;</tr&gt;<tr&gt;<td&gt; Horse soro</td&gt;<td&gt; Fisher Scientific</td&gt;<td&gt; SH3007403</td&gt;<td&gt; Horse soro</td&gt;</tr&gt;<tr&gt;<td&gt; Km</td&gt;<td&gt; Fisher Scientific</td&gt;<td&gt; BP906-5</td&gt;<td&gt; Canamicina</td&gt;</tr&gt;<tr&gt;<td&gt; TH caldo</td&gt;<td&gt; BD Biosciences</td&gt;<td&gt; 249240</td&gt;<td&gt; Caldo Todd Hewitt</td&gt;</tr&gt;<tr&gt;<td&gt; PureLink 96</td&gt;<td&gt; Invitrogen</td&gt;<td&gt; K310096</td&gt;<td&gt; 96 PureLink kit de purificação PCR</td&gt;</tr&gt;<tr&gt;<td&gt; QIAquick</td&gt;<td&gt; Qiagen</td&gt;<td&gt; 28106</td&gt;<td&gt; Kit de purificação PCR QIAquick</td&gt;</tr&gt;<tr&gt;<td&gt; Filtro</td&gt;<td&gt; Corning</td&gt;<td&gt; 431117</td&gt;<td&gt; Filtro de 0,22 uM poliestireno</td&gt;</tr&gt;<tr&gt;<td&gt; Sistema Anoxomat</td&gt;<td&gt; Mart Microbiologia bv</td&gt;<td&gt; Anoxomat Mark II</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; Centrífuga de bancada</td&gt;<td&gt; Thermo Scientific</td&gt;<td&gt; 75004377</td&gt;<td&gt; Sorvall Legend RT Além disso microplaca rotor</td&gt;</tr&gt;<tr&gt;<td&gt; Documentação Gel</td&gt;<td&gt; UVP LLC</td&gt;<td&gt; BioDoc-It 210</td&gt;<td</td&gt;</tr&gt;<tr&gt;<td&gt; Incubadora</td&gt;<td&gt; Fisher Scientific</td&gt;<td&gt; 11-690-625D</td&gt;<td&gt; Isotemp</td&gt;</tr&gt;<tr&gt;<td&gt; Labnet de Gel XL</td&gt;<td&gt; Labnet</td&gt;<td&gt; E0160</td&gt;<td&gt; Labnet de Gel XL</td&gt;</tr&gt;<tr&gt;<td&gt; Microcentrífuga</td&gt;<td&gt; Eppendorf</td&gt;<td&gt; 22621408</td&gt;<td&gt; Microcentrífuga 5415 R</td&gt;</tr&gt;<tr&gt;<td&gt; Pipetas Multicanal</td&gt;<td&gt; Thermo scientfic</td&gt;<td&gt; 4661040, 4661020</td&gt;<td&gt; Finnpipette F1</td&gt;</tr&gt;<tr&gt;<td&gt; Thermal Cycler</td&gt;<td&gt; Applied Biosystems Inc.</td&gt;<td&gt; N805-0200</td&gt;<td&gt; GeneAmp PCR System 9700</td&gt;</tr&gt;</tbody&gt;</table

genome-wide gene deletions in streptococcus sanguinis by high throughput pcr

Transposon mutagênese e único gene exclusão são dois métodos aplicados no genoma nocaute de genes em 1,2 bactérias. Embora mutagénese transposon é menos demorado, menos dispendiosa, e não requer informação sobre o genoma completo, existem dois pontos fracos neste método: (1) a possibilidade de um mutantes diferentes na biblioteca misto mutante que contra-selecciona mutantes com competição reduzida; e (2) a possibilidade de inactivação parcial do gene por meio de que os genes não perder completamente a sua função após a inserção de um transposão. Single-gene análise de deleção pode compensar os inconvenientes associados com a mutagénese transposon. Para melhorar a eficiência do genoma deleção do gene único, tentamos estabelecer uma técnica de alto rendimento para o genoma de deleção do gene único usando Streptococcus sanguinis como um organismo modelo. Cada deleção do gene construir em S. sanguinis genoma foi concebido para incluir uma-Kb a montante do gene alvo, o gene APHA-3, a proteína que codifica a resistência à canamicina, e 1-kb a jusante do gene alvo. Três conjuntos de primers F1/R1, F2/R2 e F3/R3, respectivamente, foram concebidos e sintetizados de um formato de placa de 96 poços para amplificações por PCR destes três componentes de cada apagamento construir. Primers R1 e F3 conter 25-bp sequências que são complementares a regiões do gene APHA-3 no fim do seu 5 &#39;. Uma larga escala de amplificação por PCR do gene-3 APHA é executada uma vez para criar todas as construções de deleção de um único gene. O promotor do gene APHA-3 é inicialmente excluídos para minimizar o potencial efeito polar da cassete de canamicina. Para criar as construções de deleção de genes, de alto rendimento e de amplificação por PCR de purificação são realizados num formato de placa de 96 poços. Um fragmento amplificado de PCR recombinante linear para cada deleção do gene será composto por quatro reacções de PCR utilizando polimerase de alta fidelidade de ADN. O expon inicialfase de crescimento cial de S. sanguinis cultivados em caldo Todd Hewitt suplementado com soro de cavalo a 2,5% inactivado é utilizada para aumentar a capacidade para a transformação de PCR-recombinantes construtos. Sob esta condição, até 20% de S. As células podem ser transformadas sanguinis usando ~ 50 ng de DNA. Com base nesta abordagem, 2.048 mutantes com um único gene de exclusão foram finalmente obtidos a partir dos genes de S. 2270 sanguinis excluindo quatro ORFs de genes contido inteiramente dentro ORFs outros S. sanguinis SK36 e 218 potenciais genes essenciais. A técnica na criação de construções de deleção do gene é de alto rendimento e poderia ser fácil de usar em eliminações do genoma de um único gene para todas as bactérias transformáveis.

Após amplificação por PCR, utilizando iniciadores F1 e R1, R3 e F3 e, aproximadamente, 1 kb a montante e a jusante de cada um S. sanguinis gene foram obtidos em formato de 96 poços, respectivamente (Figura 2A). Sob as nossas condições de PCR e utilizando os iniciadores desenhados, um produto específico foi amplificado a partir de S. sanguinis ADN genómico em cada reacção de PCR. Este resultado indicou os primers foram altamente específico para as metas de S. sanguinis.</...

Watch this Scientific Journal Video about Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR at JoVE.com

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Um eficiente do genoma método única mutação genética foi estabelecida utilizando<em&gt; Streptococcus sanguinis</em&gt; Como um organismo modelo. Este método tem alcançado via PCRs recombinantes de alto rendimento e transformações.

Do genoma deleções de genes em<em&gt; Streptococcus sanguinis</em&gt; Por PCR de Alto Rendimento

Transposon  mutagenesis and single-gene deletion are two methods applied in genome-wide  gene knockout in bacteria 1,2. Although transposon mutagenesis is ...

genome-wide-gene-deletions-streptococcus-sanguinis-high-throughput

Research

JoVE Journal

Biology

Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

16.4K visualizações.  Virginia Commonwealth University. Um eficiente do genoma método única mutação genética foi estabelecida utilizando Streptococcus sanguinis Como um organismo modelo. Este método tem alcançado via PCRs recombinantes de alto rendimento e transformações.

Vídeo: Genome-wide Gene Deletions in Streptococcus sanguinis by High Throughput PCR

Genome-wide Analysis using ChIP to Identify Isoform-specific Gene Targets

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the protein domains that bind to specific histone modifications. One such domain is the plant homeodomain (PHD), found in several chromatin-binding proteins. The epigenetic factor RBP2 has multiple PHD domains, however, they have different functions (Figure 4). In particular, the C-terminal PHD domain, found in a RBP2 oncogenic fusion in human leukemia, binds to trimethylated lysine 4 in histone H3 (H3K4me3)1. The transcript corresponding to the RBP2 isoform containing the C-terminal PHD accumulates during differentiation of promonocytic, lymphoma-derived, U937 cells into monocytes2. Consistent with both sets of data, genome-wide analysis showed that in differentiated U937 cells, the RBP2 protein gets localized to genomic regions highly enriched for H3K4me33. Localization of RBP2 to its targets correlates with a decrease in H3K4me3 due to RBP2 histone demethylase activity and a decrease in transcriptional activity. In contrast, two other PHDs of RBP2 are unable to bind H3K4me3. Notably, the C-terminal domain PHD of RBP2 is absent in the smaller RBP2 isoform4. It is conceivable that the small isoform of RBP2, which lacks interaction with H3K4me3, differs from the larger isoform in genomic location. The difference in genomic location of RBP2 isoforms may account for the observed diversity in RBP2 function. Specifically, RBP2 is a critical player in cellular differentiation mediated by the retinoblastoma protein (pRB). Consistent with these data, previous genome-wide analysis, without distinction between isoforms, identified two distinct groups of RBP2 target genes: 1) genes bound by RBP2 in a manner that is independent of differentiation; 2) genes bound by RBP2 in a differentiation-dependent manner.
To identify differences in localization between the isoforms we performed genome-wide location analysis by ChIP-Seq. Using antibodies that detect both RBP2 isoforms we have located all RBP2 targets. Additionally we have antibodies that only bind large, and not small RBP2 isoform (Figure 4). After identifying the large isoform targets, one can then subtract them from all RBP2 targets to reveal the targets of small isoform. These data show the contribution of chromatin-interacting domain in protein recruitment to its binding sites in the genome.

Here we are presenting a chromatin immunoprecipitation (ChIP) procedure for genome-wide location analysis of protein isoforms that differ in a histone-binding domain. We are applying it to ChIP-Seq analysis to identify the targets of the KDM5A/JARID1A/RBP2 histone demethylase.

Análise do genoma usando chip para identificar alvos isoforma específica Gene

Recruitment of transcriptional and epigenetic factors to their targets is a key step in their regulation. Prominently featured in recruitment are the ...

Biologia

Genome-wide Screen for miRNA Targets Using the MISSION Target ID Library

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, genome-wide cDNA library cloned into the 3'UTR downstream from the dual-selection fusion protein, thymidine kinase-zeocin (TKzeo). The first round of selection is for stable transformants, followed with introduction of a miRNA of interest, and finally, selecting for cDNAs containing the miRNA's target. Selected cDNAs are identified by sequencing (see Figure 1-3 for Target ID Library Workflow and details).
To ensure broad coverage of the human transcriptome, Target ID Library cDNAs were generated via oligo-dT priming using a pool of total RNA prepared from multiple human tissues and cell lines. Resulting cDNA range from 0.5 to 4 kb, with an average size of 1.2 kb, and were cloned into the p3&#900;TKzeo dual-selection plasmid (see Figure 4 for plasmid map). The gene targets represented in the library can be found on the Sigma-Aldrich webpage. Results from Illumina sequencing (Table 3), show that the library includes 16,922 of the 21,518 unique genes in UCSC RefGene (79%), or 14,000 genes with 10 or more reads (66%).

The Target ID Library is a plasmid-based, genome-wide collection of cloned cDNA used to identify miRNA targets. Here we demonstrate its use and application.

Genome-wide tela de Metas de miRNA Usando a missão Biblioteca ID Alvo

The Target ID Library is designed to assist in discovery and identification of microRNA (miRNA) targets. The Target ID Library is a plasmid-based, ...

Quantitative and Automated High-throughput Genome-wide RNAi Screens in C. elegans

RNA interference is a powerful method to understand gene function, especially when conducted at a whole-genome scale and in a quantitative context. In C. elegans, gene function can be knocked down simply and efficiently by feeding worms with bacteria expressing a dsRNA corresponding to a specific gene 1. While the creation of libraries of RNAi clones covering most of the C. elegans genome 2,3 opened the way for true functional genomic studies (see for example 4-7), most established methods are laborious. Moy and colleagues have developed semi-automated protocols that facilitate genome-wide screens 8. The approach relies on microscopic imaging and image analysis. 
	Here we describe an alternative protocol for a high-throughput genome-wide screen, based on robotic handling of bacterial RNAi clones, quantitative analysis using the COPAS Biosort (Union Biometrica (UBI)), and an integrated software: the MBioLIMS (Laboratory Information Management System from Modul-Bio) a technology that provides increased throughput for data management and sample tracking. The method allows screens to be conducted on solid medium plates. This is particularly important for some studies, such as those addressing host-pathogen interactions in C. elegans, since certain microbes do not efficiently infect worms in liquid culture.
	We show how the method can be used to quantify the importance of genes in anti-fungal innate immunity in C. elegans. In this case, the approach relies on the use of a transgenic strain carrying an epidermal infection-inducible fluorescent reporter gene, with GFP under the control of the promoter of the antimicrobial peptide gene nlp 29 and a red fluorescent reporter that is expressed constitutively in the epidermis. The latter provides an internal control for the functional integrity of the epidermis and nonspecific transgene silencing9. When control worms are infected by the fungus they fluoresce green. Knocking down by RNAi a gene required for nlp 29 expression results in diminished fluorescence after infection. Currently, this protocol allows more than 3,000 RNAi clones to be tested and analyzed per week, opening the possibility of screening the entire genome in less than 2 months.

Quantitative and Automated High-throughput Genome-wide RNAi Screens in C. elegans

We describe a protocol using C. elegans and RNAi feeding libraries that allows automated measurement of multiple parameters such as fluorescence, size and opacity of individual worms in a population. We give one example of a screen to identify genes involved in anti-fungal innate immunity in C. elegans.

Quantitativos e automatizada de alto rendimento de todo o genoma Telas de RNAi em C. elegans</em

RNA interference is a powerful method to understand gene function, especially when conducted at a whole-genome scale and in a quantitative context. In C. ...

The Green Monster Process for the Generation of Yeast Strains Carrying Multiple Gene Deletions

Phenotypes for a gene deletion are often revealed only when the mutation is tested in a particular genetic background or environmental condition1,2. There are examples where many genes need to be deleted to unmask hidden gene functions3,4. Despite the potential for important discoveries, genetic interactions involving three or more genes are largely unexplored. Exhaustive searches of multi-mutant interactions would be impractical due to the sheer number of possible combinations of deletions. However, studies of selected sets of genes, such as sets of paralogs with a greater a priori chance of sharing a common function, would be informative.
In the yeast Saccharomyces cerevisiae, gene knockout is accomplished by replacing a gene with a selectable marker via homologous recombination. Because the number of markers is limited, methods have been developed for removing and reusing the same marker5,6,7,8,9,10. However, sequentially engineering multiple mutations using these methods is time-consuming because the time required scales linearly with the number of deletions to be generated.
Here we describe the Green Monster method for routinely engineering multiple deletions in yeast11. In this method, a green fluorescent protein (GFP) reporter integrated into deletions is used to quantitatively label strains according to the number of deletions contained in each strain (Figure 1). Repeated rounds of assortment of GFP-marked deletions via yeast mating and meiosis coupled with flow-cytometric enrichment of strains carrying more of these deletions lead to the accumulation of deletions in strains (Figure 2). Performing multiple processes in parallel, with each process incorporating one or more deletions per round, reduces the time required for strain construction.
The first step is to prepare haploid single-mutants termed 'ProMonsters,' each of which carries a GFP reporter in a deleted locus and one of the 'toolkit' loci&#x2014;either Green Monster GMToolkit-a or GMToolkit-&alpha; at the can1&Delta; locus (Figure 3). Using strains from the yeast deletion collection12, GFP-marked deletions can be conveniently generated by replacing the common KanMX4 cassette existing in these strains with a universal GFP-URA3 fragment. Each GMToolkit contains: either the a- or &alpha;-mating-type-specific haploid selection marker1 and exactly one of the two markers that, when both GMToolkits are present, collectively allow for selection of diploids.
The second step is to carry out the sexual cycling through which deletion loci can be combined within a single cell by the random assortment and/or meiotic recombination that accompanies each cycle of mating and sporulation.

The Green Monster method enables the rapid assembly of multiple deletions marked with a reporter gene encoding green fluorescent protein. This method is based on driving yeast strains through repeated cycles of sexual assortment of deletions and fluorescence-based enrichment of cells carrying more deletions.

O Processo de monstro verde para a Geração de linhagens de levedura de transporte deleções de genes múltiplos

Phenotypes  for a gene deletion are often revealed only when the mutation is tested in a  particular genetic background or environmental condition1,2. ...

Profiling Individual Human Embryonic Stem Cells by Quantitative RT-PCR

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different lineages. A single cell transcriptome assay can be a new approach for dissecting individual variation. We have developed the single cell qRT-PCR method, and confirmed that this method works well in several gene expression profiles. In single cell level, each human embryonic stem cell, sorted by OCT4::EGFP positive cells, has high expression in OCT4, but a different level of NANOG expression. Our single cell gene expression assay should be useful to interrogate population heterogeneities.

Single cell gene expression assay is needed for understanding stem cell heterogeneities.

Profiling Individual células estaminais embrionárias humanas por RT-PCR quantitativo

Heterogeneity of stem cell population hampers detailed understanding of stem cell biology, such as their differentiation propensity toward different ...

Genome-wide Protein-protein Interaction Screening by Protein-fragment Complementation Assay (PCA) in Living Cells

Proteins are the building blocks, effectors and signal mediators of cellular processes. A protein&#8217;s function, regulation and localization often depend on its interactions with other proteins. Here, we describe a protocol for the yeast protein-fragment complementation assay (PCA), a powerful method to detect direct and proximal associations between proteins in living cells. The interaction between two proteins, each fused to a dihydrofolate reductase (DHFR) protein fragment, translates into growth of yeast strains in presence of the drug methotrexate (MTX). Differential fitness, resulting from different amounts of reconstituted DHFR enzyme, can be quantified on high-density colony arrays, allowing to differentiate interacting from non-interacting bait-prey pairs. The high-throughput protocol presented here is performed using a robotic platform that parallelizes mating of bait and prey strains carrying complementary DHFR-fragment fusion proteins and the survival assay on MTX. This protocol allows to systematically test for thousands of protein-protein interactions (PPIs) involving bait proteins of interest and offers several advantages over other PPI detection assays, including the study of proteins expressed from their endogenous promoters without the need for modifying protein localization and for the assembly of complex reporter constructs.

Genome-wide Protein-protein Interaction Screening by Protein-fragment Complementation Assay PCA in Living Cells

Proteins interact with each other and these interactions determine in a large part their functions. Protein interaction partners can be identified at high-throughput in vivo using a yeast fitness assay based on the dihydrofolate reductase protein-fragment complementation assay (DHFR-PCA).

Genome-wide proteína-proteína Interaction Triagem por proteína-fragmento de Complementação Assay (PCA) em células vivas

Proteins are the building blocks, effectors and signal mediators of cellular processes. A protein&#8217;s function, regulation and localization often ...

High-throughput Screening for Chemical Modulators of Post-transcriptionally Regulated Genes

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays focus on transcriptional regulation, being essentially aimed at the identification of promoter-targeting molecules. As a result, post-transcriptional mechanisms are largely uncovered by gene expression targeted drug development. Here we describe a cell-based assay aimed at investigating the role of the 3&#39; untranslated region (3&#8217; UTR) in the modulation of the fate of its mRNA, and at identifying compounds able to modify it. The assay is based on the use of a luciferase reporter construct containing the 3&#8217; UTR of a gene of interest stably integrated into a disease-relevant cell line. The protocol is divided into two parts, with the initial focus on the primary screening aimed at the identification of molecules affecting luciferase activity after 24 hr of treatment. The second part of the protocol describes the counter-screening necessary to discriminate compounds modulating luciferase activity specifically through the 3&#8217; UTR. In addition to the detailed protocol and representative results, we provide important considerations about the assay development and the validation of the hit(s) on the endogenous target. The described cell-based reporter gene assay will allow scientists to identify molecules modulating protein levels via post-transcriptional mechanisms dependent on a 3&#8217; UTR.

Here we describe a cell-based reporter gene assay as a valuable tool to screen chemical libraries for compounds modulating post-transcriptional control mechanisms exerted through 3&#8217; UTR.

Rastreio de alto rendimento para moduladores químicos de Genes Post-transcriptionally Regulamentados

Both transcriptional and post-transcriptional regulation have a profound impact on genes expression. However, commonly adopted cell-based screening assays ...

qPCRTag Analysis - A High Throughput, Real Time PCR Assay for Sc2.0 Genotyping

The Synthetic Yeast Genome Project (Sc2.0) aims to build 16 designer yeast chromosomes and combine them into a single yeast cell. To date one synthetic chromosome, synIII1, and one synthetic chromosome arm, synIXR2, have been constructed and their in vivo function validated in the absence of the corresponding wild type chromosomes. An important design feature of Sc2.0 chromosomes is the introduction of PCRTags, which are short, re-coded sequences within open reading frames (ORFs) that enable differentiation of synthetic chromosomes from their wild type counterparts. PCRTag primers anneal selectively to either synthetic or wild type chromosomes and the presence/absence of each type of DNA can be tested using a simple PCR assay. The standard readout of the PCRTag assay is to assess presence/absence of amplicons by agarose gel electrophoresis. However, with an average PCRTag amplicon density of one per 1.5 kb and a genome size of ~12 Mb, the completed Sc2.0 genome will encode roughly 8,000 PCRTags. To improve throughput, we have developed a real time PCR-based detection assay for PCRTag genotyping that we call qPCRTag analysis. The workflow specifies 500 nl reactions in a 1,536 multiwell plate, allowing us to test up to 768 PCRTags with both synthetic and wild type primer pairs in a single experiment.

Designer chromosomes of the Synthetic Yeast Genome project, Sc2.0, can be distinguished from their native counterparts using a PCR-based genotyping assay called PCRTagging, which has a presence/absence endpoint. Here we describe a high-throughput real time PCR detection method for PCRTag genotyping.

Análise qPCRTag - A High Throughput, PCR em Tempo Real Ensaio para Sc2.0 Genotipagem

The Synthetic Yeast Genome Project (Sc2.0) aims to build 16 designer yeast chromosomes and combine them into a single yeast cell. To date one synthetic ...

Genome-wide Mapping of Drug-DNA Interactions in Cells with COSMIC (Crosslinking of Small Molecules to Isolate Chromatin)

The genome is the target of some of the most effective chemotherapeutics, but most of these drugs lack DNA sequence specificity, which leads to dose-limiting toxicity and many adverse side effects. Targeting the genome with sequence-specific small molecules may enable molecules with increased therapeutic index and fewer off-target effects. N-methylpyrrole/N-methylimidazole polyamides are molecules that can be rationally designed to target specific DNA sequences with exquisite precision. And unlike most natural transcription factors, polyamides can bind to methylated and chromatinized DNA without a loss in affinity. The sequence specificity of polyamides has been extensively studied in vitro with cognate site identification (CSI) and with traditional biochemical and biophysical approaches, but the study of polyamide binding to genomic targets in cells remains elusive. Here we report a method, the crosslinking of small molecules to isolate chromatin (COSMIC), that identifies polyamide binding sites across the genome. COSMIC is similar to chromatin immunoprecipitation (ChIP), but differs in two important ways: (1) a photocrosslinker is employed to enable selective, temporally-controlled capture of polyamide binding events, and (2) the biotin affinity handle is used to purify polyamide&#8211;DNA conjugates under semi-denaturing conditions to decrease DNA that is non-covalently bound. COSMIC is a general strategy that can be used to reveal the genome-wide binding events of polyamides and other genome-targeting chemotherapeutic agents.

Genome-wide Mapping of Drug-DNA Interactions in Cells with COSMIC Crosslinking of Small Molecules to Isolate Chromatin

Identifying the direct targets of genome-targeting molecules remains a major challenge. To understand how DNA-binding molecules engage the genome, we developed a method that relies on crosslinking of small molecules to isolate chromatin (COSMIC).

Mapeamento de todo o genoma de DNA Interações medicamentosas-em células com COSMIC (reticulação de moléculas pequenas para isolar Chromatin)

The genome is the target of some of the most effective chemotherapeutics, but most of these drugs lack DNA sequence specificity, which leads to ...

DamID-seq: Genome-wide Mapping of Protein-DNA Interactions by High Throughput Sequencing of Adenine-methylated DNA Fragments

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is an alternative approach to chromatin immunoprecipitation (ChIP). An expressed fusion protein consisting of the protein of interest and the E. coli DNA adenine methyltransferase can methylate the adenine base in GATC motifs near the sites of protein-DNA interactions. Adenine-methylated DNA fragments can then be specifically amplified and detected. The original DamID assay detects the genomic locations of methylated DNA fragments by hybridization to DNA microarrays, which is limited by the availability of microarrays and the density of predetermined probes. In this paper, we report the detailed protocol of integrating high throughput DNA sequencing into DamID (DamID-seq). The large number of short reads generated from DamID-seq enables detecting and localizing protein-DNA interactions genome-wide with high precision and sensitivity. We have used the DamID-seq assay to study genome-nuclear lamina (NL) interactions in mammalian cells, and have noticed that DamID-seq provides a high resolution and a wide dynamic range in detecting genome-NL interactions. The DamID-seq approach enables probing NL associations within gene structures and allows comparing genome-NL interaction maps with other functional genomic data, such as ChIP-seq and RNA-seq.

We describe herein an assay by coupling DNA adenine methyltransferase identification (DamID) to high throughput sequencing (DamID-seq). This improved method provides a higher resolution and a wider dynamic range, and allows analyzing DamID-seq data in conjunction with other high throughput sequencing data such as ChIP-seq, RNA-seq, etc.

DamID-seq: Genoma-wide Mapeamento das Interações Proteína-DNA por High Throughput Sequencing de fragmentos de DNA metilado-Adenina

The DNA adenine methyltransferase identification (DamID) assay is a powerful method to detect protein-DNA interactions both locally and genome-wide. It is ...