Este projeto foi financiado pela Fundação Samuel Roberts Noble. Os autores agradecem Mss. Janie Gallaway e Colleen Elles excelente para cuidados com as plantas, e Ms. Katie Brown para obras de arte. Também gostaria de agradecer a Mss. Trina Cottrell, Pooja Uppalapati, Moumita Saha, Swetha Vinukonda e Mr. Isaac Greenhut para assistência técnica durante o estabelecimento deste protocolo.

1. Crescimento da planta e Target Gene Silenciando <ol><li> Condições de crescimento da planta: <ol><li> Semear N. sementes benthamiana em solo-less mistura envasamento, Metro-Mix 350 e germinar as sementes em uma câmara de crescimento. Qualquer outro solo ou o solo menos meio também pode ser usado em vez de Metro-Mix. </li><li> Transplante de três semanas de idade plântulas em vasos individuais e elas crescem numa estufa mantida a 21 ± 2 ° C, juntamente com outras condições de crescimento, conforme detalhado na literatura anterior 12. Dois a três dias após o transplante, as plantas podem ser usadas para TRV inoculação. </li></ol></li><li> Crescer TRV2 clones: TRV é um vírus bipartido e o seu genoma consiste em RNA1 e RNA2. RNA1 codifica para uma RNA polimerase dependente de RNA e de uma proteína de movimento 20,21. RNA2 codifica uma proteína capsidial (CP) e duas proteínas não estruturais dos RNAs subgenômico 21. Ambos RNA1 e RNA2 são necessários para a formação de vir amadurecidonós, partículas e sua propagação 20,21. Construção da biblioteca de cDNA em TRV2 vector é descrito na literatura anterior, 22,23. Resumidamente, a biblioteca VIGS utilizada neste estudo foi construído a partir do RNA extraído de tecidos de folhas expostas a vários eliciadores bióticos e abióticos. <ol><li> Retire Agrobacterium (estirpe GV2260) contendo os clones de cDNA no vector TRV2 (uma placa de 96 poços) a partir do congelador. Gradualmente o descongelamento e depois das culturas atingirem a temperatura ambiente, inocular a cultura de Agrobacterium indivíduo em Luria-Bertani (LB) em placa de ágar com rifampicina (10 ug / ml) e canamicina (50 ug / ml), utilizando um replicador de 96 pinos. </li><li> Incubar as placas a 28 ° C durante dois dias. Nós geralmente crescem quatro colônias idênticas para cada clone para que inóculo Agrobacterium adequada está disponível para inoculação picada de duas plantas. Executar todas as etapas sob condições estéreis. </li></ol></li><li> VIGS: <ol><li> CrescerAgrobacterium (GV2260) transportando TRV1 a 28 ° C em meio líquido LB com os antibióticos acima mencionados. Células colheita por centrifugação, a partir de culturas crescidas durante a noite, re-suspensão no tampão de inoculação (MES 10 mM, pH 5,5, 200 mM acetosiringona), e incubar durante 3 horas a temperatura ambiente num agitador a 50 rpm. </li><li> Colher as células por centrifugação e re-suspensão em 5 mM de tampão MES (pH 5,5) e inocula (DO600 = 0,3) para o lado abaxial 3-4 N. benthamiana folhas, utilizando uma seringa sem agulha. Procedimento de inoculação pormenorizadas demonstrado na literatura anterior 24. Mais tarde, no local da inoculação TRV1, inocular respectivos TRV2 colônias por picar as folhas com um palito. </li><li> Manter as plantas com nutrição adequada como o crescimento vigoroso é importante para VIGS eficientes 12. Cerca de duas semanas após a inoculação, as transcrições de genes-alvo vai começar a reduzir e as plantas estão prontas para INOC patógenomento de três semanas após a inoculação de TRV. </li></ol></li></ol> 2. Preparação das culturas não hospedeiras de patógenos e plantas de inoculação <ol><li> Detalhes de patógenos utilizados neste estudo: Pseudomonas syringae pv. Tabaci, P. syringae pv. tomate T1, P. syringae pv. glycinea e Xanthomonas campestris pv. vesicatória são usadas neste estudo. Crescer P. estirpes syringae em King B (KB) meio líquido suplementado com rifampicina (10 ug / ml), canamicina (50 ug / ml) a 28 ° C durante 12 horas. Crescer X. campestris pv. vesicatoria em meio líquido LB por 16 horas. Todos os agentes patogénicos abrigar um plasmídeo que pode expressar GFPuv conforme descrito na literatura anterior 19. </li><li> Preparação das culturas de patógenos para inoculação em plantas: <ol><li> Colher as células bacterianas por centrifugação e confirmar a presença de fluorescência verde usando longo walâmpada UV velength no escuro. Lave as células duas vezes com água esterilizada e re-suspender-los para a concentração desejada com água estéril. </li><li> Inocular o respectivo patógeno (s) sobre a face abaxial de folhas de genes silenciados alvo (5 ª a 8 ª) como pontos (cerca de 1,5 cm de diâmetro). Vários patogénios não hospedeiras podem ser testadas simultaneamente para o seu crescimento em plantas do gene alvo silenciada. Simultaneamente inocular o patógeno hospedeiro como este pode ser usado como um controlo positivo para a visualização do crescimento bacteriano planta. Também inocular o controle de vetores (TRV :: 00) plantas. </li></ol></li></ol> 3. Observação da planta em crescimento de patógenos bacterianos <ol><li> Expor as folhas inoculadas com uma luz UV de comprimento de onda longo no escuro. Colônias bacterianas podem ser vistos como pontos verdes fluorescentes no lado abaxial da folha no fundo de fluorescência vermelha emitida pela superfície da folha. </li><li> Observar o crescimento do patógenode dois dias após a inoculação (dpi) para 5 dpi. Observação de todos os dias, durante este intervalo de tempo é necessário. </li><li> Depois da primeira tela, a lista curta dos clones cuja silenciamento resulta em crescimento de um ou mais agentes patogénicos não hospedeiras (s). </li><li> Repita VIGS para os clones seleccionados e novamente testar a resposta das plantas de genes silenciados para patógeno não hospedeiras (s). Este segundo nível de triagem é feito para remover os falsos positivos obtidos durante a primeira tela. </li></ol> 4. Confirmação de plantas pré-seleccionados para a Resistência não hospedeiras comprometida <ol><li> Silenciem os clones de ADNc seleccionados a partir do ecrã, como descrito acima. Inocular com a planta inteira patógeno não hospedeiras (s), submergindo as plantas com as respectivas culturas de organismos patogénicos, com 0,01% (v / v), Silwet L-77 e sujeitando as plantas submersas a vácuo durante 3 - 5 min. Quantificar o crescimento bacteriano pelo ensaio de crescimento de 6,18,19 convencional tal como descrito abaixo. </li><li> Em 0 horas após a inoculação (hpi),3 dpi e 5 dpi, coletar duas amostras de folhas de cinco repetições biológicas para cada patógeno não hospedeiras (s) folhas inoculadas utilizando um soco folha (0,5 centímetros 2). Moer as amostras de folhas, diluído em série e a placa de seiva KB em meio de agar suplementado com antibióticos adequados e incubar a 28 ° C durante 2 dias. Contar as colónias de bactérias, utilizando um contador de colónias e calcular o crescimento de bactérias nas folhas, como descrito na literatura anterior 6. </li><li> As plantas não hospedeiras suscetíveis ao patógeno (s) deve mostrar maior número de crescimento do patógeno em relação ao controle de vetores. </li></ol> 5. Seqüenciamento do Insert e Identificação de gene alvo <ol><li> Realizar PCR de colónias para o clone seleccionado utilizando attB1 e attB2 iniciadores ou utilizando iniciadores que flanqueiam o local de clonagem no vector TRV2. Executar o produto de PCR em gel e vá para a amplificação de uma única banda. </li><li> Inserção de genes de plantas no vetor TRV2 podem ser seqüenciados usando attBiniciadores ou primers flanqueando o sítio de clonagem. </li><li> Realize BLAST usando a seqüência e identificar os detalhes do gene. </li><li> Obter seqüência de gene de corpo inteiro junto com as regiões não-traduzidas (UTRs). </li><li> Selecione 300-400 bp fragmentos de três regiões diferentes da seqüência e cloná-los em TRV2 vetor. Independentemente realizar VIGS usando todos os três VIGS construções e confirmar o compromisso da resistência não hospedeiras em todas as três plantas de genes silenciados. </li></ol>

<ol>
	<li>Heath, M. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonhost+resistance+and+nonspecific+plant+defenses.">Nonhost resistance and nonspecific plant defenses.</a> Currrent Opinion in Plant Biology. 3, 315-319 (2000).</li><li>Mysore, K. S., Ryu, C. -. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonhost+resistance:+how+much+do+we+know.">Nonhost resistance: how much do we know.</a> Trends in Plant Science. 9, 97-104 (2004).</li><li>Ellis, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+into+nonhost+disease+resistance:+can+they+assist+disease+control+in+agriculture.">Insights into nonhost disease resistance: can they assist disease control in agriculture.</a> The Plant Cell. 18, 523-528 (2006).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Nonhost+resistance+against+bacterial+pathogens:+retrospects+and+prospects.">Nonhost resistance against bacterial pathogens: retrospects and prospects.</a> Annual Review of Phytopathology. 51, (2013).</li><li>Lu, M., Tang, X., Zhou, J. -. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Arabidopsis+NHO1+is+required+for+general+resistance+against+Pseudomonas+bacteria.">Arabidopsis NHO1 is required for general resistance against Pseudomonas bacteria.</a> The Plant Cell. 13, 437-447 (2001).</li><li>Rojas, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Glycolate+oxidase+plays+a+major+role+during+nonhost+resistance+responses+by+modulating+reactive+oxygen+species+mediated+signal+transduction+pathways.">Glycolate oxidase plays a major role during nonhost resistance responses by modulating reactive oxygen species mediated signal transduction pathways.</a> The Plant Cell. 24, 336-352 (2012).</li><li>Daurelio, L. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transcriptome+analysis+reveals+novel+genes+involved+in+nonhost+response+to+bacterial+infection+in+tobacco.">Transcriptome analysis reveals novel genes involved in nonhost response to bacterial infection in tobacco.</a> Journal of Plant Physiology. 168, 382-391 (2011).</li><li>Moreau, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=EDS1+contributes+to+nonhost+resistance+of+Arabidopsis+thaliana+against+Erwinia+amylovora.">EDS1 contributes to nonhost resistance of Arabidopsis thaliana against Erwinia amylovora.</a> Molecular Plant-Microbe Interactions. 25, 421-430 (2012).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ornithine-delta-aminotransferase+and+proline+dehydrogenase+genes+play+a+role+in+non-host+disease+resistance+by+regulating+pyrroline-5-carboxylate+metabolism-induced+hypersensitive+response.">Ornithine-delta-aminotransferase and proline dehydrogenase genes play a role in non-host disease resistance by regulating pyrroline-5-carboxylate metabolism-induced hypersensitive response.</a> Plant, Cell &amp; Environment. 35, 1329-1343 (2012).</li><li>Burch-Smith, T. M., Anderson, J. C., Martin, G. B., Dinesh-Kumar, S. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Applications+and+advantages+of+virus-induced+gene+silencing+for+gene+function+studies+in+plants.">Applications and advantages of virus-induced gene silencing for gene function studies in plants.</a> The Plant Journal. 39, 734-746 (2004).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+dimensions+for+VIGS+in+plant+functional+genomics.">New dimensions for VIGS in plant functional genomics.</a> Trends in Plant Science. 16, 656-665 (2011).</li><li>Senthil-Kumar, M., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-induced+gene+silencing+can+persist+for+more+than+2+years+and+also+be+transmitted+to+progeny+seedlings+in+Nicotiana+benthamiana+and+tomato.">Virus-induced gene silencing can persist for more than 2 years and also be transmitted to progeny seedlings in Nicotiana benthamiana and tomato.</a> Plant Biotechnology Journal. 9, 797-806 (2011).</li><li>Bombarely, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+draft+genome+sequence+of+Nicotiana+benthamiana+to+enhance+molecular+plant-microbe+biology+research.">A draft genome sequence of Nicotiana benthamiana to enhance molecular plant-microbe biology research.</a> Molecular Plant-Microbe Interactions. 25, 1523-1530 (2012).</li><li>Sharma, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-induced+silencing+of+WIPK+and+SIPK+genes+reduces+resistance+to+a+bacterial+pathogen,+but+has+no+effect+on+the+INF1-induced+hypersensitive+response+(HR)+in+Nicotiana+benthamiana.">Virus-induced silencing of WIPK and SIPK genes reduces resistance to a bacterial pathogen, but has no effect on the INF1-induced hypersensitive response (HR) in Nicotiana benthamiana.</a> Mol Gen Genomics. 269, 583-591 (2003).</li><li>Baulcombe, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+forward+genetics+based+on+virus-induced+gene+silencing.">Fast forward genetics based on virus-induced gene silencing.</a> Current Opinion in Plant Biology. 2, 109-113 (1999).</li><li>Lu, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High+throughput+virus-induced+gene+silencing+implicates+heat+shock+protein+90+in+plant+disease+resistance.">High throughput virus-induced gene silencing implicates heat shock protein 90 in plant disease resistance.</a> EMBO Journal. 22, 5690-5699 (2003).</li><li>Pozo, O., Pedley, K. F., Martin, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MAPKKK[alpha]+is+a+positive+regulator+of+cell+death+associated+with+both+plant+immunity+and+disease.">MAPKKK[alpha] is a positive regulator of cell death associated with both plant immunity and disease.</a> EMBO Journal. 23, 3072-3082 (2004).</li><li>Wang, K., Senthil-Kumar, M., Ryu, C. -. M., Kang, L., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Phytosterols+play+a+key+role+in+plant+innate+immunity+against+bacterial+pathogens+by+regulating+nutrient+efflux+into+the+apoplast.">Phytosterols play a key role in plant innate immunity against bacterial pathogens by regulating nutrient efflux into the apoplast.</a> Plant Physiology. 158, 1789-1802 (2012).</li><li>Wang, K., Kang, L., Anand, A., Lazarovits, G., Mysore, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monitoring+in+planta+bacterial+infection+at+both+cellular+and+whole-plant+levels+using+the+green+fluorescent+protein+variant+GFPuv.">Monitoring in planta bacterial infection at both cellular and whole-plant levels using the green fluorescent protein variant GFPuv.</a> New Phytologist. 174, 212-223 (2007).</li><li>Ratcliff, F., Martin-Hernandez, A. M., Baulcombe, D. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Technical+Advance:+Tobacco+rattle+virus+as+a+vector+for+analysis+of+gene+function+by+silencing.">Technical Advance: Tobacco rattle virus as a vector for analysis of gene function by silencing.</a> The Plant Journal. 25, 237-245 (2001).</li><li>MacFarlane, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+biology+of+the+tobraviruses.">Molecular biology of the tobraviruses.</a> Journal of General Virology. 80, 2799-2807 (1999).</li><li>Anand, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+plant+genes+involved+in+Agrobacterium-mediated+plant+transformation+by+virus-induced+gene+silencing.">Identification and characterization of plant genes involved in Agrobacterium-mediated plant transformation by virus-induced gene silencing.</a> Molecular Plant-Microbe Interactions. 20, 41-52 (2007).</li><li>Liu, E., Page, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Optimized+cDNA+libraries+for+virus-induced+gene+silencing+(VIGS)+using+tobacco+rattle+virus.">Optimized cDNA libraries for virus-induced gene silencing (VIGS) using tobacco rattle virus.</a> Plant Methods. 4, 5 (2008).</li><li>Vel&#225;squez, A. C., Chakravarthy, S., Martin, G. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virus-induced+gene+silencing+(VIGS)+in+Nicotiana+benthamiana+and+tomato.">Virus-induced gene silencing (VIGS) in Nicotiana benthamiana and tomato.</a> J. Vis. Exp. (28), e1292 (2009).</li><li>Peart, J. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ubiquitin+ligase-associated+protein+SGT1+is+required+for+host+and+nonhost+disease+resistance+in+plants.">Ubiquitin ligase-associated protein SGT1 is required for host and nonhost disease resistance in plants.</a> Proceedings of the National Academy of Sciences. 99. , 99-10869 (2002).</li><li>Oh, S. -. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insight+into+Types+I+and+II+nonhost+resistance+using+expression+patterns+of+defense-related+genes+in+tobacco.">Insight into Types I and II nonhost resistance using expression patterns of defense-related genes in tobacco.</a> Planta. 223, 1101-1107 (2006).</li><li>Senthil-Kumar, M., Mysore, K., Kodama, H., Komamine, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RNAi+and+Plant+Gene+Function+Analysis.">RNAi and Plant Gene Function Analysis.</a> Methods in Molecular Biology. 744, 13-25 (2011).</li></ol>

Não temos nada a divulgar.

Imunidade da planta limita o crescimento de patógenos não hospedeiras e, portanto, pouca ou nenhuma fluorescência verde é emitido a partir de plantas controle do vetor folhas inoculadas com patógeno não hospedeiras sob luz UV de comprimento de onda longo (Figura 3D). No entanto, quando um gene envolvido na resistência não hospedeiras é silenciada, as plantas de genes silenciados favorecer o crescimento do patógeno e fluorescência verde é visto não hospedeiras (Figura 3E). E...

Resistência não hospedeiras é a resistência de todas as espécies de plantas contra as corridas de 1,2 patógeno particular. Isto dá amplo espectro e resistência a doenças em plantas durável 2,3. No entanto, o seu mecanismo, em particular contra patógenos bacterianos, não é bem compreendido 4. Triagem para mutantes ou plantas silenciadas que a resistência não hospedeiras compromisso, e alta taxa de transferência de perfis transcrição para a identificação de genes diferencialmente expressos durante a resistência não hospedeiras 5-9 são duas abordagens principais usadas anteriormente para dissecar a resistência bacteriana não hospedeiras. Como a resistência não hospedeiras é controlada por um mecanismo complexo (s) 4 com o envolvimento de vários genes, uma abordagem funcional genómico de alto rendimento para a identificação de genes é essencial para uma melhor compreensão do mecanismo de resistência não hospedeiras (s). Induzida por vírus silenciamento do gene (VIGS) tem sido utilizada com sucesso para silenciar planta endógenogenes em muitas espécies de plantas 10,11. Nicotiana benthamiana é uma das melhores plantas adequadas para VIGS 10,12 e seu projecto de seqüência do genoma já está disponível 13. vírus chocalho do Tabaco (TRV) baseados VIGS tem sido amplamente utilizado como ferramenta genética reversa para caracterizar genes envolvidos na resistência não hospedeiras 2,4,14. Este VIGS vetores e derivados estão agora disponíveis através Arabidopsis Biological Resource Center (ABRC, <a href="http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html" target="_blank">http://www.arabidopsis.org/abrc/catalog/individ_cloned_gene_1.html</a> ). VIGS também tem sido usada como ferramenta genética para a frente para a identificação de genes envolvidos na imunidade 15-17 planta, especialmente resistência não hospedeiras 6,18. Avaliação da resposta de hipersensibilidade (HR) mediada por morte celular induzida por plantas não hospedeiras contra um agente patogénico específico e avaliando a morte celular induzida pela doença são dois importantes ensaios utilizados principalmente para IDENTIFICARgene silenciado plantas susceptíveis g. No entanto, a morte celular HR é induzida apenas contra tipo II patógenos não hospedeiras e não contra os do tipo I não hospedeiras patógenos 2. Assim, ensaios de RH não pode ser universalmente utilizado para identificar estratégias de resistência não hospedeiras utilizadas pelas plantas, especialmente contra ampla gama de tipo I não hospedeiras patógenos. Além disso, a perda parcial da resistência não hospedeiras em um gene da planta silenciada nem sempre conduz a sintomas da doença e, consequentemente, 6 marcar a doença não pode ser utilizado para a identificação de plantas não hospedeiras comprometer a resistência. Em contrário, a avaliação do crescimento de agentes patogénicos em plantas não hospedeiras silenciados genes é um método melhor para estudar a perda de resistência nas plantas não hospedeiras de genes silenciados. Comparado ao ensaio de crescimento convencional 6,19, um método mais rápido para avaliar o crescimento bacteriano nas plantas não hospedeiras de genes silenciados pode encurtar o tempo necessário para a frente de triagem genética. Nós relatamos anteriormente um método para observar bactériasl crescimento do patógeno em folhas por olho nu sob luz ultravioleta (UV) utilizando bactérias expressando a proteína fluorescente verde (GFP) 19. Neste artigo, procuramos demonstrar a utilidade de GFPuv expressar patógenos bacterianos não hospedeiras para facilitar a identificação de plantas silenciadas genéticas que são comprometidos pela resistência não hospedeiras. Esta metodologia é preciso para identificação de plantas suscetíveis e passíveis de triagem em alta velocidade.

<table border="1">
 <tbody>
 <tr>
 <td>Name of the reagent/equipment</td>
 <td>Company</td>
 <td>Catalogue number</td>
 <td>Comments (optional)</td>
 </tr>
 <tr>
 <td>96-well U-bottom plates</td>
 <td> Becton Dickinson Labware (Franklin Lakes, NJ, USA)</td>
 <td> 35-3077</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td>96-pin replicator stainless steel</td>
 <td> Nalge Nunc International (Naperville, IL, USA)</td>
 <td> 250520</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> High Intensity UV Inspection Lamps, Model B-100ap</td>
 <td> Thomas scientific (Swedesboro, NJ, USA)</td>
 <td> 6283K50</td>
 <td> Manufacturer ID 95-0127-01</td>
 </tr>
 <tr>
 <td> Stuart SC6 colony counter</td>
 <td> Bibby Scientific Limited, Staffordshire, UK</td>
 <td> SC6PLUS</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Soil-less potting mixture, Metro-Mix 350</td>
 <td> SUNGRO Horticulture Distribution, Inc., (Bellevue, WA, USA)</td>
 <td>&nbsp;</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Primers: 
 attB1 (GGGGACAAGTTTGTACAAAAAAGCAGGCT) 
 attB2 (GGGGACCACTTTGTACAAGAAAGCTGGGT)</td>
 <td> Integrated DNA Technologies, Inc (Coralville, IA, USA)</td>
 <td> Custom synthesized</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> MES, Monohydrate</td>
 <td> VWR international (Radnor, PA, USA)</td>
 <td> CAS No. 145224-94-8</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Acetosyringone (Dimethoxy-4'-hydroxyacetophenone)</td>
 <td> Sigma Aldrich (St. Louis, MO, USA)</td>
 <td> D134406</td>
 <td>&nbsp;</td>
 </tr>
 <tr>
 <td> Vac-In-Stuff (Silwet L-77)</td>
 <td> Lehle Seeds (Round Rock, TX, USA)</td>
 <td> VIS-30</td>
 <td>&nbsp;</td>
 </tr>
 </tbody>
</table>

vigs-mediated forward genetics screening for identification of genes involved in nonhost resistance

Resistência à doença de plantas não hospedeiras contra agentes patogénicos bacterianos é controlada por caminhos de defesa complexos. Compreendendo este mecanismo é importante para o desenvolvimento de plantas resistentes a doenças duráveis ​​contra vasta gama de agentes patogénicos. Induzida por vírus silenciamento gênico (VIGS) baseado frente triagem genética é uma abordagem útil para a identificação de genes de defesa da planta transmitindo resistência não hospedeiras. Tobacco rattle virus (TRV) baseado VIGS VIGS vetor é o vetor mais eficiente até o momento e tem sido utilizado de forma eficiente para silenciar genes alvo endógenos em Nicotiana benthamiana. Neste artigo, demonstramos uma abordagem de triagem genética para a frente para o silenciamento de clones individuais a partir de uma biblioteca de cDNA em N. benthamiana e avaliar a resposta das plantas silenciados genes de resistência não hospedeiras comprometida contra patógenos não hospedeiras, Pseudomonas syringae pv. tomate T1, P. syringae pv. GlycINEA e X. campestris pv. vesicatoria. Estes patógenos bacterianos são manipuladas para expressar a proteína e as suas colónias GFPuv fluorescente verde pode ser visto a olho nu sob luz UV nas plantas não hospedeiras patogénicos inoculados se o gene alvo silenciada está envolvida na transmissão de resistência não hospedeiras. Isso facilita a identificação mais rápida e confiável de plantas silenciadas genes suscetíveis a agentes patogênicos não hospedeiras. Além disso, informações gene candidato promissor pode ser conhecido por seqüenciamento a inserção de genes de plantas em TRV vetor. Aqui demonstramos a elevada capacidade de transferência genética de frente VIGS mediadas para identificar genes envolvidos na resistência não hospedeiras. Aproximadamente, 100 cDNAs pode ser silenciado individualmente em cerca de duas a três semanas, e a sua relevância não hospedeiras na resistência contra vários agentes patogénicos bacterianos não hospedeiras pode ser estudado em uma semana depois. Neste artigo, vamos enumerar os passos detalhados envolvidos neste rastreio. Frente VIGS mediada genética screening abordagem pode ser estendido, não só para identificação de genes envolvidos na resistência não hospedeiras, mas também para estudar os genes comunicando várias tolerâncias de stress bióticos e abióticos em várias espécies de plantas.

Principal objetivo deste estudo é demonstrar um método para a identificação fácil e precisa de gene silenciado N. benthamiana plantas que estão comprometidos para a resistência não hospedeiras. Existem quatro principais etapas desta metodologia. O primeiro passo é o silêncio individualmente grande número de genes usando TRV-VIGS. Nós tínhamos cerca de 5000 genes silenciados 6,18 ao longo de um período de cerca de 1,5 anos, usando o protocolo ilustrado na Figura 1. Algum...

Watch this Scientific Journal Video about VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance at JoVE.com

VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance

Induzida por vírus silenciamento de genes é uma ferramenta útil para a identificação de genes envolvidos na resistência de plantas não hospedeiras. Nós demonstramos o uso de bactérias patogênicas que expressam GFPuv em identificar plantas silenciados genes suscetíveis a agentes patogênicos não hospedeiras. Esta abordagem é simples, rápido e facilita a triagem em grande escala e protocolo semelhante pode ser aplicado ao estudo de várias outras interacções planta-microorganismo.

VIGS Mediada frente Triagem Genética para identificação de genes envolvidos na resistência não hospedeiras


	Nonhost disease resistance of plants against bacterial pathogens is controlled by complex defense pathways. Understanding this mechanism is important ...

vigs-mediated-forward-genetics-screening-for-identification-genes

Research

JoVE Journal

Immunology and Infection

16.9K visualizações.  The Samuel Roberts Noble Foundation.  Induzida por vírus silenciamento de genes é uma ferramenta útil para a identificação de genes envolvidos na resistência de plantas não hospedeiras. Nós demonstramos o uso de bactérias patogênicas que expressam GFPuv em identificar plantas silenciados genes suscetíveis a agentes patogênicos não hospedeiras. Esta abordagem é simples, rápido e facilita a triagem em grande escala e protocolo semelhante pode ser aplicado ao estudo de várias outras interacçõe...

Vídeo: VIGS-Mediated Forward Genetics Screening for Identification of Genes Involved in Nonhost Resistance

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in bioterrorism is also a concern. A better understanding of the cellular factors that impact infection would facilitate the development of much-needed therapeutics. Recent advances in RNA interference (RNAi) technology coupled with complete genome sequencing of several organisms has led to the optimization of genome-wide, cell-based loss-of-function screens. Drosophila cells are particularly amenable to genome-scale screens because of the ease and efficiency of RNAi in this system 1. Importantly, a wide variety of viruses can infect Drosophila cells, including a number of mammalian viruses of medical and agricultural importance 2,3,4. Previous RNAi screens in Drosophila have identified host factors that are required for various steps in virus infection including entry, translation and RNA replication 5. Moreover, many of the cellular factors required for viral replication in Drosophila cell culture are also limiting in human cells infected with these viruses 4,6,7,8, 9. Therefore, the identification of host factors co-opted during viral infection presents novel targets for antiviral therapeutics. Here we present a generalized protocol for a high-throughput RNAi screen to identify cellular factors involved in viral infection, using vaccinia virus as an example.

RNAi Screening for Host Factors Involved in Vaccinia Virus Infection using Drosophila Cells

Novel host factors involved in viral infection can be identified through cell-based genome-wide loss of function RNAi screening. A Drosophila cell culture model is particularly amenable to this approach due to the ease and efficiency of RNAi. Here we demonstrate this technique using vaccinia virus as an example.

RNAi Triagem para Fatores Hospedeiros Envolvidos na Vaccinia Infecção pelo Vírus usando Drosophila Células

Viral pathogens represent a significant public health threat; not only can viruses cause natural epidemics of human disease, but their potential use in ...

Imunologia e Infecção

Human In Vitro Suppression as Screening Tool for the Recognition of an Early State of Immune Imbalance

Regulatory T cells (Tregs) are critical mediators of immune tolerance to self-antigens. In addition, they are crucial regulators of the immune response following an infection. Despite efforts to identify unique surface marker on Tregs, the only unique feature is their ability to suppress the proliferation and function of effector T cells. While it is clear that only in vitro assays can be used in assessing human Treg function, this becomes problematic when assessing the results from cross-sectional studies where healthy cells and cells isolated from subjects with autoimmune diseases (like Type 1 Diabetes-T1D) need to be compared. There is a great variability among laboratories in the number and type of responder T cells, nature and strength of stimulation, Treg:responder ratios and the number and type of antigen-presenting cells (APC) used in human in vitro suppression assays. This variability makes comparison between studies measuring Treg function difficult. The Treg field needs a standardized suppression assay that will work well with both healthy subjects and those with autoimmune diseases. We have developed an in vitro suppression assay that shows very little intra-assay variability in the stimulation of T cells isolated from healthy volunteers compared to subjects with underlying autoimmune destruction of pancreatic &beta;-cells. The main goal of this piece is to describe an in vitro human suppression assay that allows comparison between different subject groups. Additionally, this assay has the potential to delineate a small loss in nTreg function and anticipate further loss in the future, thus identifying subjects who could benefit from preventive immunomodulatory therapy1. Below, we provide thorough description of the steps involved in this procedure. We hope to contribute to the standardization of the in vitro suppression assay used to measure Treg function. In addition, we offer this assay as a tool to recognize an early state of immune imbalance and a potential functional biomarker for T1D.

Human In Vitro Suppression as Screening Tool for the Recognition of an Early State of Immune Imbalance

Tregs are potent suppressors of the immune system. There is a lack of unique surface markers to define them, hence, definitions of Tregs are primarily functional. Here we describe an optimized in vitro assay capable of identifying immune imbalance in subjects at risk to develop T1D.

Humano In Vitro Supressão como ferramenta de triagem para o reconhecimento de um Estado precoce de desequilíbrio imunológico

Regulatory T cells (Tregs) are critical mediators of immune tolerance to self-antigens. In addition, they are crucial regulators of the immune response ...

Reverse Genetics Mediated Recovery of Infectious Murine Norovirus

Human noroviruses are responsible for most cases of human gastroenteritis (GE) worldwide and are recurrent problem in environments where close person-to-person contact cannot be avoided 1, 2. During the last few years an increase in the incidence of outbreaks in hospitals has been reported, causing significant disruptions to their operational capacity as well as large economic losses. The identification of new antiviral approaches has been limited due to the inability of human noroviruses to complete a productive infection in cell culture 3. The recent isolation of a murine norovirus (MNV), closely related to human norovirus 4 but which can be propagated in cells 5 has opened new avenues for the investigation of these pathogens 6, 7. 
MNV replication results in the synthesis of new positive sense genomic and subgenomic RNA molecules, the latter of which corresponds to the last third of the viral genome (Figure 1). MNV contains four different open reading frames (ORFs), of which ORF1 occupies most of the genome and encodes seven non-structural proteins (NS1-7) released from a polyprotein precursor. ORF2 and ORF3 are contained within the subgenomic RNA region and encode the capsid proteins (VP1 and VP2, respectively) (Figure 1). Recently, we have identified that additional ORF4 overlapping ORF2 but in a different reading frame is functional and encodes for a mitochondrial localised virulence factor (VF1) 8.
Replication for positive sense RNA viruses, including noroviruses, takes place in the cytoplasm resulting in the synthesis of new uncapped RNA genomes. To promote viral translation, viruses exploit different strategies aimed at recruiting the cellular protein synthesis machinery 9-11. Interestingly, norovirus translation is driven by the multifunctional viral protein-primer VPg covalently linked to the 5' end of both genomic and subgenomic RNAs 12-14. This sophisticated mechanism of translation is likely to be a major factor in the limited efficiency of viral recovery by conventional reverse genetics approaches. 
Here we report two different strategies based on the generation of murine norovirus-1 (referred to as MNV herewith) transcripts capped at the 5' end. One of the methods involves both in vitro synthesis and capping of viral RNA, whereas the second approach entails the transcription of MNV cDNA in cells expressing T7 RNA polymerase. The availability of these reverse genetics systems for the study of MNV and a small animal model has provided an unprecedented ability to dissect the role of viral sequences in replication and pathogenesis 15-17.

Noroviruses are a major cause of gastroenteritis yet molecular techniques for their characterisation are still relatively new. Here we report two different reverse genetics approaches for the efficient recovery of murine norovirus (MNV), the only member of this genus which can be propagated in cell culture.

Recuperação de reversão genética mediada por norovírus Murina Infecciosas

Human noroviruses are responsible for most cases of human gastroenteritis (GE) worldwide and are recurrent problem in environments where close ...

Forward Genetic Approaches in Chlamydia trachomatis

Chlamydia trachomatis, the etiological agent of sexually transmitted diseases and ocular infections, remains poorly characterized due to its intractability to experimental transformation with recombinant DNA. We developed an approach to perform genetic analysis in C. trachomatis&#160;despite the lack of molecular genetic tools. Our method involves: i.) chemical mutagenesis to rapidly generate comprehensive libraries of genetically-defined mutants with distinct phenotypes; ii.) whole-genome sequencing (WGS) to map the underlying genetic lesions and to find associations between mutated gene(s) and a common phenotype; iii.) generation of recombinant strains through co-infection of mammalian cells with mutant and wild type bacteria. Accordingly, we were able to establish causal relationships between genotypes and phenotypes. The coupling of chemically-induced gene variation and WGS to establish correlative genotype&#8211;phenotype associations should be broadly applicable to the large list of medically and environmentally important microorganisms currently intractable to genetic analysis.

Forward Genetic Approaches in Chlamydia trachomatis

We describe a methodology to perform genetic analysis in Chlamydia based on chemical mutagenesis and whole genome sequencing. In addition, a system for DNA exchange within infected cells is described that can be used for genetic mapping. This method may be broadly applicable to microbial systems lacking transformation systems and molecular genetic tools.

Abordagens para a frente genéticos em<em&gt; Chlamydia trachomatis</em

Chlamydia trachomatis, the etiological agent of sexually transmitted diseases and ocular infections, remains poorly characterized due to its ...

Using RNA-interference to Investigate the Innate Immune Response in Mouse Macrophages

Macrophages are key phagocytic innate immune cells. When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the pathogen, produce various cytokines and chemokines to recruit and stimulate other immune cells, and present antigens to stimulate the adaptive immune response. Thus, being able to efficiently manipulate macrophages with techniques such as RNA-interference (RNAi) is critical to our ability to investigate this important innate immune cell. However, macrophages can be technically challenging to transfect and can exhibit inefficient RNAi-induced gene knockdown. In this protocol, we describe methods to efficiently transfect two mouse macrophage cell lines (RAW264.7 and J774A.1) with siRNA using the Amaxa Nucleofector 96-well Shuttle System and describe procedures to maximize the effect of siRNA on gene knockdown. Moreover, the described methods are adapted to work in 96-well format, allowing for medium and high-throughput studies. To demonstrate the utility of this approach, we describe experiments that utilize RNAi to inhibit genes that regulate lipopolysaccharide (LPS)-induced cytokine production.

In this protocol, we describe methods to efficiently transfect murine macrophage cell lines with siRNAs using the Amaxa Nucleofector 96-well Shuttle System, stimulate the macrophages with lipopolysaccharide, and monitor the effects on inflammatory cytokine production.

Usando RNA-interferência para investigar a imunitário inatas de resposta em macrófagos

Macrophages are key phagocytic innate immune cells.  When macrophages encounter a pathogen, they produce antimicrobial proteins and compounds to kill the ...

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Pseudomonas aeruginosa is a Gram-negative, environmental bacterium with versatile metabolic capabilities. P. aeruginosa is an opportunistic bacterial pathogen which establishes chronic pulmonary infections in patients with cystic fibrosis (CF). The overproduction of a capsular polysaccharide called alginate, also known as mucoidy, promotes the formation of mucoid biofilms which are more resistant than planktonic cells to antibiotic chemotherapy and host defenses. Additionally, the conversion from the nonmucoid to mucoid phenotype is a clinical marker for the onset of chronic infection in CF. Alginate overproduction by P. aeruginosa is an endergonic process which heavily taxes cellular energy. Therefore, alginate production is highly regulated in P. aeruginosa. To better understand alginate regulation, we describe a protocol using the mini-himar1 transposon mutagenesis for the identification of novel alginate regulators in a prototypic strain PAO1. The procedure consists of two basic steps. First, we transferred the mini-himar1 transposon (pFAC) from host E. coli SM10/&#955;pir into recipient P. aeruginosa PAO1 via biparental conjugation to create a high-density insertion mutant library, which were selected on Pseudomonas isolation agar plates supplemented with gentamycin. Secondly, we screened and isolated the mucoid colonies to map the insertion site through inverse PCR using DNA primers pointing outward from the gentamycin cassette and DNA sequencing. Using this protocol, we have identified two novel alginate regulators, mucE (PA4033) and kinB (PA5484), in strain PAO1 with a wild-type mucA encoding the anti-sigma factor MucA for the master alginate regulator AlgU (AlgT, &#963;22). This high-throughput mutagenesis protocol can be modified for the identification of other virulence-related genes causing change in colony morphology.

Identification of Novel Genes Associated with Alginate Production in Pseudomonas aeruginosa Using Mini-himar1 Mariner Transposon-mediated Mutagenesis

Here we describe a protocol using the mini-himar1 mariner transposon-mediated mutagenesis for generating a high-density insertion mutant library to screen, isolate and identify novel alginate regulators in the prototypic Pseudomonas aeruginosa strain PAO1.

Identificação de novos genes associados com alginato de Produção em<em&gt; Pseudomonas aeruginosa</em&gt; Usando Mini-<em&gt; Himar1</em&gt; Mutagênese Mariner Transposon mediada

Pseudomonas aeruginosa is a Gram-negative, environmental bacterium with versatile metabolic capabilities. P. aeruginosa is an opportunistic bacterial ...

Rapid Screening of HIV Reverse Transcriptase and Integrase Inhibitors

Although a number of anti HIV drugs have been approved, there are still problems with toxicity and drug resistance. This demonstrates a need to identify new compounds that can inhibit infection by the common drug resistant HIV-1 strains with minimal toxicity. Here we describe an efficient assay that can be used to rapidly determine the cellular cytotoxicity and efficacy of a compound against WT and mutant viral strains.
The desired target cell line is seeded in a 96-well plate and, after a 24 hr incubation, serially dilutions of the compounds to be tested are added. No further manipulations are necessary for cellular cytotoxicity assays; for anti HIV assays a predetermined amount of either a WT or drug resistant HIV-1 vector that expresses luciferase is added to the cells. Cytotoxicity is measured by using an ATP dependent luminescence assay and the impact of the compounds on infectivity is measured by determining the amount of luciferase in the presence or the absence of the putative inhibitors.
This screening assay takes 4 days to complete and multiple compounds can be screened in parallel. Compounds are screened in triplicate and the data are normalized to the infectivity/ATP levels in absence of target compounds. This technique provides a quick and accurate measurement of the efficacy and toxicity of potential anti HIV compounds.

Here we describe cellular cytotoxicity and single round infectivity assays that allow for the rapid and accurate screening of compounds to determine their cellular cytotoxicity (CC50) and IC50 values against WT and drug resistant HIV-1.

Triagem rápida de HIV transcriptase reversa e integrase Inibidores

Although a number of anti HIV drugs have been approved, there are still problems with toxicity and drug resistance. This demonstrates a need to identify ...

Forward Genetics Screens Using Macrophages to Identify Toxoplasma gondii Genes Important for Resistance to IFN-&#947;-Dependent Cell Autonomous Immunity

Toxoplasma gondii, the causative agent of toxoplasmosis, is an obligate intracellular protozoan pathogen. The parasite invades and replicates within virtually any warm blooded vertebrate cell type. During parasite invasion of a host cell, the parasite creates a parasitophorous vacuole (PV) that originates from the host cell membrane independent of phagocytosis within which the parasite replicates. While IFN-dependent-innate and cell mediated immunity is important for eventual control of infection, innate immune cells, including neutrophils, monocytes and dendritic cells, can also serve as vehicles for systemic dissemination of the parasite early in infection. An approach is described that utilizes the host innate immune response, in this case macrophages, in a forward genetic screen to identify parasite mutants with a fitness defect in infected macrophages following activation but normal invasion and replication in na&#239;ve macrophages. Thus, the screen isolates parasite mutants that have a specific defect in their ability to resist the effects of macrophage activation. The paper describes two broad phenotypes of mutant parasites following activation of infected macrophages: parasite stasis versus parasite degradation, often in amorphous vacuoles. The parasite mutants are then analyzed to identify the responsible parasite genes specifically important for resistance to induced mediators of cell autonomous immunity. The paper presents a general approach for the forward genetics screen that, in theory, can be modified to target parasite genes important for resistance to specific antimicrobial mediators. It also describes an approach to evaluate the specific macrophage antimicrobial mediators to which the parasite mutant is susceptible. Activation of infected macrophages can also promote parasite differentiation from the tachyzoite to bradyzoite stage that maintains chronic infection. Therefore, methodology is presented to evaluate the importance of the identified parasite gene to establishment of chronic infection.

Forward Genetics Screens Using Macrophages to Identify Toxoplasma gondii Genes Important for Resistance to IFN-&amp;#947;-Dependent Cell Autonomous Immunity

Forward genetics is a powerful approach to identify genes in intracellular pathogens important for resistance to cell autonomous immunity. The current approach uses innate immune cells, specifically macrophages, to identify novel Toxoplasma gondii genes important for immune evasion.

Atacante Genetics telas usando macrófagos para Identificar<em&gt; Toxoplasma gondii</em&gt; genes importantes celular para Resistance to-IFN-γ Dependente Immunity Autónoma

Toxoplasma gondii, the causative agent of toxoplasmosis, is an obligate intracellular protozoan pathogen. The parasite invades and replicates within ...

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

Brucella species are facultative intracellular pathogens that infect animals as their natural hosts. Transmission to humans is most commonly caused by direct contact with infected animals or by ingestion of contaminated food and can lead to severe chronic infections.
Brucella can invade professional and non-professional phagocytic cells and replicates within endoplasmic reticulum (ER)-derived vacuoles. The host factors required for Brucella entry into host cells, avoidance of lysosomal degradation, and replication in the ER-like compartment remain largely unknown. Here we describe two assays to identify host factors involved in Brucella entry and replication in HeLa cells. The protocols describe the use of RNA interference, while alternative screening methods could be applied. The assays are based on the detection of fluorescently labeled bacteria in fluorescently labeled host cells using automated wide-field microscopy. The fluorescent images are analyzed using a standardized image analysis pipeline in CellProfiler which allows single cell-based infection scoring.
In the endpoint assay, intracellular replication is measured two days after infection. This allows bacteria to traffic to their replicative niche where proliferation is initiated around 12 hr after bacterial entry. Brucella which have successfully established an intracellular niche will thus have strongly proliferated inside host cells. Since intracellular bacteria will greatly outnumber individual extracellular or intracellular non-replicative bacteria, a strain constitutively expressing GFP can be used. The strong GFP signal is then used to identify infected cells.
In contrast, for the entry assay it is essential to differentiate between intracellular and extracellular bacteria. Here, a strain encoding for a tetracycline-inducible GFP is used. Induction of GFP with simultaneous inactivation of extracellular bacteria by gentamicin enables the differentiation between intracellular and extracellular bacteria based on the GFP signal, with only intracellular bacteria being able to express GFP. This allows the robust detection of single intracellular bacteria before intracellular proliferation is initiated.

Microscopy-based Assays for High-throughput Screening of Host Factors Involved in Brucella Infection of Hela Cells

Two assays for microscopy-based high-throughput screening of host factors involved in Brucella infection are described. The entry assay detects host factors required for Brucella entry and the endpoint assay those required for intracellular replication. While applicable for alternative approaches, siRNA screening in HeLa cells is used to illustrate the protocols.

Os ensaios baseados em microscopia para high-throughput screening de Fatores Hospedeiros Envolvidos na<em&gt; Brucella</em&gt; A infecção de células HeLa

Brucella species are facultative intracellular pathogens that infect animals as their natural hosts. Transmission to humans is most commonly caused by ...

Screening Assays to Characterize Novel Endothelial Regulators Involved in the Inflammatory Response

The endothelial layer is essential for maintaining homeostasis in the body by controlling many different functions. Regulation of the inflammatory response by the endothelial layer is crucial to efficiently fight against harmful inputs and aid in the recovery of damaged areas. When the endothelial cells are exposed to an inflammatory environment, such as the outer component of gram-negative bacteria membrane, lipopolysaccharide (LPS), they express soluble pro-inflammatory cytokines, such as Ccl5, Cxcl1 and Cxcl10, and trigger the activation of circulating leukocytes. In addition, the expression of adhesion molecules E-selectin, VCAM-1 and ICAM-1 on the endothelial surface enables the interaction and adhesion of the activated leukocytes to the endothelial layer, and eventually the extravasation towards the inflamed tissue. In this scenario, the endothelial function must be tightly regulated because excessive or defective activation in the leukocyte recruitment could lead to inflammatory-related disorders. Since many of these disorders do not have an effective treatment, novel strategies with a focus on the vascular layer must be investigated. We propose comprehensive assays that are useful to the search of novel endothelial regulators that modify leukocyte function. We analyze endothelial activation by using specific expression targets involved in leukocyte recruitment (such as, cytokines, chemokines, and adhesion molecules) with several techniques, including: real-time quantitative polymerase chain reaction (RT-qPCR), western-blot, flow cytometry and adhesion assays. These approaches determine endothelial function in the inflammatory context and are very useful to perform screening assays to characterize novel endothelial inflammatory regulators that are potentially valuable for designing new therapeutic strategies.

Vascular endothelium tightly controls leukocyte recruitment. Inadequate leukocyte extravasation contributes to human inflammatory diseases. Therefore, searching for novel regulatory elements of endothelial activation is necessary to design improved therapies for inflammatory disorders. Here, we describe a comprehensive methodology to characterize novel endothelial regulators that can modify leukocyte trafficking during inflammation.