Gostaríamos de agradecer o apoio financeiro do Programa de Larkins Monash, bem como a partir de um CDF NHMRC e uma subvenção de projecto NHMRC. Além disso, gostaríamos de agradecer a Sue Mei Lim pelas sugestões construtivas, Edwina McGlinn por seu apoio e da equipe de Monash Flowcore (em particular Adam Dinsdale) por sua ajuda na produção do vídeo.

1 Instrumento Settings / Preparação do reagente / Genotipagem <ol><li> Preparar meio de células iPS: Suplemento 500 ml Knockout meio DMEM com soro fetal bovino 75 ml (FBS), 5 ml de L-glutamina, 5 ml de aminoácidos não-essenciais, 500 ul β-mercaptoetanol 5 x 10 5 unidades de factor inibidor da leucemia ( LIF). Consulte a Lista de Materiais para o produto e informações de compra de reagentes utilizados no contexto deste manuscrito. </li><li> Preparar meio MEF: Suplemento 500 ml meio DMEM com FBS a 50 ml, 5 ml de L-glutamina, 5 ml de aminoácidos não-essenciais, 5 mL de piruvato de sódio, 500 uL β-mercaptoetanol. </li><li> Preparar meio de congelamento: Para 10 mL, combinar 9 ml de FBS com 1 ml de DMSO. </li><li> Gelatina Prepara pratos revestidos Adicionar solução de gelatina porcina 3-5 mL de 0,1% para um frasco T75 e incubar à temperatura ambiente durante pelo menos 10 min e aspirado imediatamente antes do uso. </li><li> Prepare FACS meio rotulagem: Para 10 mL, 9,9 mL combinar de PBS com 0,1 ml de FBS. </li><li> Realizeuma genotipagem de PCR para o locus Rosa26 m2rtTA: Realizar as reacções com polimerase do ADN de Taq de acordo com as instruções do fabricante. Use uma modificação MgCl2 -concentration de 3,5 mm e os três seguintes primers: oIMR8052: 5 &#39;GCG AAG AGT TTG TCC TCA ACC 3&#39;, oIMR8545: 5&#39;AAA GTC GCT CTG AGT TAT TGT 3 &#39;, oIMR8546: 5&#39; GGA GCG GGA ATG GAA GAT ATG 3 &#39;. Condições de ciclo: 94 ° C durante 3 min; 35 ciclos de (94 ° C durante 30 seg, 65 ° C durante 1 min, 72 ° C durante 1 min); 72 ° C durante 2 min; manter a 12 ° C. O tamanho esperado do produto: 650 pb para o alelo de tipo selvagem e 340 pb para o alelo mutante. </li><li> Realize uma genotipagem PCR para o locus Collagen-StemCa / OKSM: Realizar reações com Taq DNA polimerase, conforme as instruções. Use uma modificação MgCl2 -concentration de 2,5 mM e os três iniciadores seguintes: col / frt-B: 5 &#39;CCCTCCATGTGTGACCAAGG 3&#39;, col / frtA1: 5 &#39;GCACAGCATTGCGGACATGC 3&#39;, col / frtC1: 5 &#39;GCAGAAGCGCGGCCGTCTGG 3 &#39;. Condições de ciclo: 95 ° C durante 1 minuto: 2 ciclos de (94 ° C durante 30 seg, 70 ° C durante 45 s), 6 ciclos de (94 ° C durante 30 seg, 68 ° C durante 45 seg) e 30 ciclos de (94 ° C durante 20 seg, 60 ° C durante 1 min); 72 ° C durante 5 min; manter a 12 ° C. O tamanho esperado do produto: 331 pb para o alelo tipo selvagem e 551 pb para o alelo mutante. </li><li> Realizar todos os passos de centrifugação a 400 xg durante 3 minutos a 4 ° C. </li></ol> 2 Geração de rato embrionárias fibroblastos <ol><li> Realize um acasalamento cronometrado entre um animal da estirpe OKSM com um membro do sexo oposto da estirpe m2rtTA. Embriões colheita no dia embrionário 13,5 por abate a mãe e remover o corno uterino. Antes da remoção da trompa uterina, pulverizar a região abdominal com uma solução de etanol a 80%, para evitar a contaminação microbiana. </li><li> Transferir a trompa uterina num prato de 10 cm de cultura de tecidos contendo 10 ml de Solução Salina Tamponada com Fosfato estéril (PBS). Use tesouras cirúrgicas esterilizadas de grau para cortar o corno uterino em pedaços contendo um embrião (ver Figura 3A, B). </li><li> Use um microscópio de dissecção (idealmente situado dentro de uma cultura capa de tecido) e uma pinça esterilizada para remover cuidadosamente o envelope uterino e as membranas extra-embrionárias que cercam cada embrião. Transferir cada embrião para uma placa de 10 cm separado com 10 ml de PBS. </li><li> Continuar removendo a cabeça do embrião, membros, cauda e dos órgãos internos (coração, fígado, intestino, etc), com as pinças (ver Figura 3C). Transferir a cabeça do embrião dentro de um tubo de 1,5 mL e congelar para baixo de modo que pode ser utilizado para genotipagem, se necessário. </li><li> Transferir o tronco do embrião em um 10 centímetros prato vazio e usar duas lâminas cirúrgicas para picar o embrião por 2 min. Adicionar 200 ul de solução de tripsina / EDTA por cima do embrião picada e incubar durante 3-5 minutos à temperatura ambiente. Continue picados por um 2 min, adicione 2 ml de meio do MEF no<html> ativar tripsina, e depois transferir para um tubo de 15 ml. </li><li> Usar uma pipeta de 1000 ul de dissociar mais mecanicamente o tecido por pipetagem suave. Transferir para um gelatina revestida prato de 10 cm e adicionar um adicional de 10 ml de meio de MEF. Nota: Ambas as incubadoras normóxicas e de hipóxia pode ser usado para a cultura, referem-se a discussão para mais informações. </li><li> Após 24-48 h, a placa deve ser densamente coberto com MEFs. </li><li> Alternativamente, as células podem ser depois propagadas e congelado para baixo. Para o congelamento de células, remova o meio de cultura, lavar o prato com 10 ml de PBS para remover traços de mídia e sobreposição com 3 ml de tripsina / solução de EDTA. Incuba-se durante 3-5 minutos a 37 ° C, a digestão inactivar a tripsina por adição de 5 ml de meio de MEF e transferência para um tubo de centrifugação de 15 ml. Gire para baixo e colocar o agregado em 3 ml de mídia de congelamento. Transferir para 3 criotubos e congelar para baixo em um recipiente de congelamento de células. </li></ol> 3. Reprogramação de MEFs ove_content &quot;&gt; NOTA: as células por centrifugação a 200 xg por 5 min a 4 ° C e usar normóxicas incubadoras de cultura de tecidos para a reprogramação Ela pode ser benéfica para derivar e expandir MEFs sob condições de hipóxia (5% de oxigênio, veja a discussão para mais informações. ). <ol><li> Descongelar rapidamente um frasco de congelação baixa passagem (P0-P1, 2-3 células Mio) em um banho de água (37 ° C) e o seu conteúdo para um tubo com 10 ml de meio de MEF pré-aquecidas. Células de pellets, ressuspender em media MEF 12 ml fresco, transferir para uma gelatina revestido recipiente de cultura T75, e permitir que as células se recuperar para 24-48 horas antes de prosseguir. Nota: MEFs também pode ser utilizado directamente após a derivação. </li><li> Após a remoção do meio de cultura, lavar com PBS e MEFs cellularize por sobreposição com uma solução de tripsina / EDTA (3 ml para 3-5 min a 37 ° C). Saciar a tripsina, adicionando 5 ml de meio MEF e dissociar ainda mais células por agitação suave com uma pipeta de 10 ml. Determinar o número de células utilizando um hemocitómetro. </li><li> Para reprograexperimentos mming, MEFs semente em frascos T75 revestidos com gelatina a densidades de 6,7 x 10 células / 3 cm 2 (~ 0,5 milhões de células por frasco) em meios de IPSC contendo 2 ug / ml de doxiciclina. Consulte a Tabela 1 em relação a recomendações de semeadura para se obter cerca de 2 intermediários reprogramação milhões para cada ponto de tempo. Nota: A reprogramação começa com a adição de doxiciclina (2 mg / mL), suplementado mídia </li><li> Para os primeiros 6 dias substituir mídia todos os dias com doxiciclina fresco suplementado mídia iPSC (12 ml por frasco de mídia T75). Além deste ponto renovar mídia diariamente se há o número de células de altura. Dobrar o volume de cultura se alterações na mídia só pode ser realizada em dias alternados. </li><li> Intermediários Colheita de reprogramação nos momentos necessários (sugestão: dias 3, 6, 9, 12), removendo a mídia, a lavagem com volume adequado de PBS (10 ml para um frasco T75) e sobreposição com solução de tripsina-EDTA (3 ml para um frasco T75). Incubardurante 3-5 min a 37 ° C e extingue-se por adição de 5 ml de meio iPSC seguido por pipetagem suave. </li><li> Contagem de suspensão de células com um hemocitómetro (ver acima), por centrifugação, aspirar o sobrenadante e ressuspender as células em 10 ml de PBS para remover quaisquer vestígios de tripsina. Agregar as células mais uma vez, aspirar o sobrenadante e prossiga com o passo 4.1 para isolar os intermediários de reprogramação. Nota: As células submetidas a reprogramação pode ser criopreservadas e descongeladas para FACS isolamento em um estágio posterior. </li><li> Para estabelecer totalmente reprogramadas iPS culturas, cultivo de células em free-dox mídia iPSC por mais 4-7 dias. Nota: As culturas de reprogramação com sucesso irão conter um grande número de colónias por dia 12 (ver Figura 4). Durante este tempo, as células iPS aberrantes que ainda carecem de expressão OKSM desaparecerá. </li><li> Alternativamente, para propagar as restantes culturas completamente reprogramadas iPS: inicialmente, as sementes MEFs irradiados a uma densidade de 15 x 10 3 células / cm 2 </sse&gt; em 12 ml de meio iPSC Onto uma gelatina revestida T75 balão de um dia ou de 6 horas antes das experiências. </li><li> Em seguida, as culturas de células iPS cellularize por meios de remoção, lavando o frasco T75 com 10 ml de PBS, sobrepondo com 3 ml de solução de tripsina-EDTA e incubando durante 3-5 min a 37 ° C. Saciar tripsina pela adição de 5 ml de mídia IPSC seguido de mistura suave, transferir para um tubo de 15 ml, girar para baixo e, em seguida, novamente suspensas em 10 ml de mídia iPS. </li><li> Transferir 500 ul desta suspensão de células sobre os MEFs irradiados (frasco T75) e permitir que as culturas a crescer durante 4-5 dias. Nota: iPS estabelecidas as culturas podem ser criopreservados ou utilizados para experimentos. Linhagens de células clonais podem ser obtidas escolhendo colônias IPSC individuais sob um microscópio de dissecação 22. </li><li> Cryo preservar culturas IPSC confluentes, conforme descrito no 2.8 para MEFs. </li></ol> 4 Rotulagem de anticorpos <ol><li> Pellets de células Ressuspender de culturas de reprogramação, elaborados na Seção 3, emFACS suplementado com meio de marcação de anticorpos (anti-Thy 1.2-pacífico azuis 1: 400, anti-biotina SSEA-1 1: 400 e anti-EpCAM Fitc 1: 400). Utilizar 200 ul de mistura de marcação suplementado por 5 milhões de células e incuba-se em gelo. </li><li> Após 10 min de toque suave do tubo para ressuspender as células e incuba-se durante mais 10 min em gelo. Adicionar 10 ml de PBS frio por tubo e girar para baixo. </li><li> Para cada um dos tubos a serem coradas preparar 200 mL de meio de marcação suplementados com 1 ul de estreptavidina-PeCy7 (1: 200) por 5 milhões de células. Quando as células foram sedimentadas, aspirar cuidadosamente o sobrenadante e ressuspender em um volume apropriado de meio de marcação suplementados com Estreptavidina-PeCy7. </li><li> Manter as células em gelo por 10 min, toque para voltar a suspender, incubar por mais 10 minutos no gelo, adicione 10 ml de PBS frio por tubo, girar e aspirar o sobrenadante. </li><li> Os sedimentos de células em meio de marcação Ressuspender suplementado com iodeto de propídio (PI) (2 ug / ml) a cerca de 1 x 10 7 células / ml. Remover aglomerados de células fazendo passar a suspensão através de um filtro de 70 ^ m. Transferir as células para um tubo de FACS apropriado e mantê-los em gelo. </li><li> Preparar amostras separadas com anticorpos individuais (anti-Thy-1.2, anti-SSEA-1 e anti-EpCAM). NOTA: Estes são necessários para executar a compensação de cor nos três canais utilizados na análise. Além disso, as células não marcadas são necessários para definir as tensões e portões para a classificação. Idealmente as células iPS são utilizados para compensação: as existências de 0,5-1 x 10 6 células iPS mantidos em MEFs irradiados são armazenados em criotubos em nitrogênio líquido. A presença de MEFs é essencial para obter um sinal no canal de Thy-1.2. </li><li> Descongele a cryovial de células iPS como descrito para MEFs (Seção 3). Após a centrifugação, Ressuspender as células em 800 mL de tampão de rotulagem e 200 mL desta amostra é deixada de lado como o controle sem rótulo. </li><li> Use as células restantes como controles de compensação. As células se dividem entre três tubos de 15 mL e anticorpos adicionarda seguinte forma: Pacific Blue Control compensação: adicionar 0,5 mL do anticorpo anti-Thy-1.2 Pacific Blue. Tubo de compensação Fitc: adicionar 0,5 mL de anticorpo anti-EpCAM-FITC. Pe-Cy7 controlo de compensação: 0,5 ul do anticorpo anti SSEA-1-Biotina. </li><li> Manter as amostras de células-anticorpo no gelo por 10 min, misture tocando e incubar por 10 min no gelo. </li><li> Lavar as amostras com 10 ml PBS fria para remover o anticorpo não ligado, girar células para baixo e aspirar o sobrenadante. Ressuspender as células em pelotas a 200 ul de meio de marcação de FACS. </li><li> Para os anti-sseA-1-biotina amostras marcadas, adicione um conjugado estreptavidina-PeCy7 (1 ml por 200 células ul). Etiqueta de células como descrito para o anticorpo primário (SSEA-1-Biotina). </li><li> Passar todas as amostras, incluindo o controlo não marcado através de um filtro de 70 ^ m e adicionar PI (2 ug / ml). Transfira as células para tubos de FACS e manter em gelo até serem necessárias. </li></ol> 5. FACS isolamento de intermediários Nota:As células são classificadas usando um classificador de células activadas por fluorescência com 405 nm, 488 nm e 560 nm de excitação laser e um bocal de 100 um. <ol><li> Configure tensões para dispersão frontal e lateral, para que a população de células é correctamente visualizado. Desenhar uma porta em torno das células, tal como indicado na Figura 5A a excluir detritos. Nota: A configuração correcta das tensões sobre a separação de células pode ser complexo e requer um operador experiente FACS. </li><li> Use dispersão frontal (FSC) de altura em relação área FSC para excluir agregados (Figura 5B). </li><li> Visualize o canal PI contra FSC para portão nas células vivas negativos PI (Figura 5C). </li><li> Utilize as células não marcadas para ajustar as voltagens para os canais fluorescentes de PB, Fitc / GFP, Pe-Cy7. Idealmente posicionar a população de células na extremidade inferior do respectivo canal. </li><li> Definir portas com as células de controlo não marcados como se mostra na Figura 6A, B a fracção sub culto reprogramaçãoUres para o dia 3, 6 e 9 populações: células + sseA-1 / Thy-1.2; SseA-1 / Thy-1.2-células; ea reprogramação intermedeia sseA-1 + / Thy-1.2-células. </li><li> Além disso subdividir o dia 9 sseA-1 + / Thy-1.2- fração usando o Pe-Cy7 contra Fitc blot; desenhar portas em todo o SSE-a1 + / + EPCAM células e os sseA-1 + / células Epcam-. Definir portas com as células de controlo não marcados como se mostra na Figura 6C, D. </li><li> Prefill tubos de coleta adequados com media de células iPS (1-2 ml) antes de classificar as subpopulações desejadas (veja a Figura 7 para perfis FACS representativos para MEFs, Dia 3 / Dia 6 / Dia 9 / Dia 12 culturas e células iPS). </li><li> Efectuar a triagem FACS de acordo com o protocolo de fabrica. </li><li> Após isolamento FACS submeter células a um perfil molecular (ARN / extracção de proteínas, a imunoprecipitação da cromatina, o DNA methylome análise etc). Alternativamente, as diferentes fracções de células podem ser cultivadas. </li></ol>

<ol>
	<li>Matsui, Y., Zsebo, K., Hogan, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivation+of+pluripotential+embryonic+stem+cells+from+murine+primordial+germ+cells+in+culture.">Derivation of pluripotential embryonic stem cells from murine primordial germ cells in culture.</a> Cell. 70, 841-847 (1992).</li><li>Takahashi, K., Yamanaka, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+pluripotent+stem+cells+from+mouse+embryonic+and+adult+fibroblast+cultures+by+defined+factors.">Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors.</a> Cell. 126, 663-676 (2006).</li><li>Stadtfeld, M., Maherali, N., Borkent, M., Hochedlinger, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reprogrammable+mouse+strain+from+gene-targeted+embryonic+stem+cells.">A reprogrammable mouse strain from gene-targeted embryonic stem cells.</a> Nature Methods. 7, 53-55 (2010).</li><li>Ebert, A. D., Svendsen, C. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+stem+cells+and+drug+screening:+opportunities+and+challenges.">Human stem cells and drug screening: opportunities and challenges.</a> Nature Reviews. Drug Discovery. 9, 367-372 (2010).</li><li>Zhang, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+human+iPSC+model+of+Hutchinson+Gilford+Progeria+reveals+vascular+smooth+muscle+and+mesenchymal+stem+cell+defects.">A human iPSC model of Hutchinson Gilford Progeria reveals vascular smooth muscle and mesenchymal stem cell defects.</a> Cell Stem Cell. 8, 31-45 (2011).</li><li>Samavarchi-Tehrani, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Functional+genomics+reveals+a+BMP-driven+mesenchymal-to-epithelial+transition+in+the+initiation+of+somatic+cell+reprogramming.">Functional genomics reveals a BMP-driven mesenchymal-to-epithelial transition in the initiation of somatic cell reprogramming.</a> Cell Stem Cell. 7, 64-77 (2010).</li><li>Celi&#224;-Terrassa, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epithelial-mesenchymal+transition+can+suppress+major+attributes+of+human+epithelial+tumor-initiating+cells.">Epithelial-mesenchymal transition can suppress major attributes of human epithelial tumor-initiating cells.</a> The Journal of Clinical Investigation. 122, 1849 (2012).</li><li>Liao, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=MicroRNA+cluster+302&#8211;367+enhances+somatic+cell+reprogramming+by+accelerating+a+mesenchymal-to-epithelial+transition.">MicroRNA cluster 302&#8211;367 enhances somatic cell reprogramming by accelerating a mesenchymal-to-epithelial transition.</a> Journal of Biological Chemistry. 286, 17359-17364 (2011).</li><li>Cie&#347;lik, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epigenetic+coordination+of+signaling+pathways+during+the+epithelial-mesenchymal+transition.">Epigenetic coordination of signaling pathways during the epithelial-mesenchymal transition.</a> Epigenetic., &amp; Chromatin. 6, 1-22 (2013).</li><li>Golipour, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+late+transition+in+somatic+cell+reprogramming+requires+regulators+distinct+from+the+pluripotency+network.">A late transition in somatic cell reprogramming requires regulators distinct from the pluripotency network.</a> Cell Stem Cell. 11, 769-782 (2012).</li><li>Maherali, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Directly+reprogrammed+fibroblasts+show+global+epigenetic+remodeling+and+widespread+tissue+contribution.">Directly reprogrammed fibroblasts show global epigenetic remodeling and widespread tissue contribution.</a> Cell Stem Cell. 1, 55-70 (2007).</li><li>Stadtfeld, M., Maherali, N., Breault, D. T., Hochedlinger, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Defining+molecular+cornerstones+during+fibroblast+to+iPS+cell+reprogramming+in+mouse.">Defining molecular cornerstones during fibroblast to iPS cell reprogramming in mouse.</a> Cell Stem Cell. 2, 230-240 (2008).</li><li>Brambrink, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequential+expression+of+pluripotency+markers+during+direct+reprogramming+of+mouse+somatic+cells.">Sequential expression of pluripotency markers during direct reprogramming of mouse somatic cells.</a> Cell Stem Cell. 2, 151-159 (2008).</li><li>Wernig, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+reprogramming+of+fibroblasts+into+a+pluripotent+ES-cell-like+state.">In vitro reprogramming of fibroblasts into a pluripotent ES-cell-like state.</a> Nature. 448, 318-324 (2007).</li><li>Polo, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+molecular+roadmap+of+reprogramming+somatic+cells+into+iPS+cells.">A molecular roadmap of reprogramming somatic cells into iPS cells.</a> Cell. 151, 1617-1632 (2012).</li><li>Wright, A. J., Andrews, P. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Surface+marker+antigens+in+the+characterization+of+human+embryonic+stem+cells.">Surface marker antigens in the characterization of human embryonic stem cells.</a> Stem Cell Research. 3, 3-11 (2009).</li><li>O'Malley, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-resolution+analysis+with+novel+cell-surface+markers+identifies+routes+to+iPS+cells.">High-resolution analysis with novel cell-surface markers identifies routes to iPS cells.</a> Nature. , (2013).</li><li>Hansson, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+coordinated+proteome+dynamics+during+reprogramming+of+somatic+cells+to+pluripotency.">Highly coordinated proteome dynamics during reprogramming of somatic cells to pluripotency.</a> Cell Reports. 2, 1579-1592 (2012).</li><li>Stadtfeld, M., Maherali, N., Breault, D. T., Hochedlinger, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Defining+molecular+cornerstones+during+fibroblast+to+iPS+cell+reprogramming+in+mouse.">Defining molecular cornerstones during fibroblast to iPS cell reprogramming in mouse.</a> Cell Stem Cell. 2, 230-240 (2008).</li><li>Stadtfeld, M., Maherali, N., Borkent, M., Hochedlinger, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reprogrammable+mouse+strain+from+gene-targeted+embryonic+stem+cells.">A reprogrammable mouse strain from gene-targeted embryonic stem cells.</a> Nature Methods. 7, 53-55 (2009).</li><li>Sommer, C. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induced+pluripotent+stem+cell+generation+using+a+single+lentiviral+stem+cell+cassette.">Induced pluripotent stem cell generation using a single lentiviral stem cell cassette.</a> Stem Cells. 27, 543-549 (2009).</li><li>Takahashi, K., Okita, K., Nakagawa, M., Yamanaka, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+pluripotent+stem+cells+from+fibroblast+cultures.">Induction of pluripotent stem cells from fibroblast cultures.</a> Nature Protocols. 2, 3081-3089 (2007).</li><li>Utikal, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immortalization+eliminates+a+roadblock+during+cellular+reprogramming+into+iPS+cells.">Immortalization eliminates a roadblock during cellular reprogramming into iPS cells.</a> Nature. 460, 1145-1148 (2009).</li><li>Stadtfeld, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ascorbic+acid+prevents+loss+of+Dlk1-Dio3+imprinting+and+facilitates+generation+of+all-iPS+cell+mice+from+terminally+differentiated+B+cells.">Ascorbic acid prevents loss of Dlk1-Dio3 imprinting and facilitates generation of all-iPS cell mice from terminally differentiated B cells.</a> Nature Genetics. 44, 398-405 (2012).</li><li>Carey, B. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reprogramming+factor+stoichiometry+influences+the+epigenetic+state+and+biological+properties+of+induced+pluripotent+stem+cells.">Reprogramming factor stoichiometry influences the epigenetic state and biological properties of induced pluripotent stem cells.</a> Cell Stem Cell. 9, 588-598 (2011).</li></ol>

Os autores não têm nada a revelar.

A fim de reprogramar com êxito MEFs em células iPS e purificar intermediários reprogramação em grande quantidade, é essencial estar ciente dos fatores que têm um impacto sobre a eficiência global. Em particular, o lote de FBS utilizada para suplementar meios iPS pode ter um efeito prejudicial. Em experiências positivas gerais foram feitas com tronco embrionárias FBS qualificados (ES) celulares, mas ensaios de lotes de soros a partir de uma variedade de fornecedores pode identificar uma alternativa mais barata. Outro fator que impacta na eficiência reprogramação é o genótipo de MEFs 15,20. Embora MEFs derivadas de ratinhos heterozigóticos (het), tanto para o OKSM e o locus que m2rtTA reprogramar, homozygousity em um ou em ambos os loci resultados em maiores eficiências de reprogramação. Na verdade, MEFs derivados da descendência de OKSM e m2rtTA cruzes mostram um aumento na eficiência de reprogramação na seguinte ordem (OKSM / m2rtTA): het / het &lt;homo / het &lt;het / homo &lt;homo /homo (por favor, note que os números apresentados na Tabela 1 são para animais het / HET). Nas raras ocasiões em um macho animais homo / homo é identificado, um harém acasalar com várias fêmeas m2rtTA pode ser configurado. Todos os descendentes de cruzamentos estes serão het / homo para o OKSM / m2rtTA loci, respectivamente. Além disso, a rápida genotipagem de ninhadas é recomendado como ninhadas maiores são obtidos quando se utiliza ratos mais jovens para reprodução (6-15 semanas de idade). Além disso, o uso de baixas MEFs passagem para a reprogramação é enfatizado 23. Se MEFs foram derivados e ampliado em um normóxica incubadora de cultura de tecidos é altamente recomendável usar apenas essas células até passagem 2. No entanto, se o pesquisador tem acesso a uma incubadora de baixo oxigênio (5% de oxigênio) para a derivação e expansão de MEFs, números tão elevados como 3 ainda vai render bons resultados 23 de Passagem. No caso de o experimentador encontra problemas associados com a reprogramação,<html> , conforme descrito, as explicações mais prováveis ​​são números elevados de passagem, no momento da adição de dox, genótipo incorrecta dos ratinhos ou a utilização de FBS que não é favorável para a geração de células iPS. No entanto, em casos raros, observou-se que MEFs não foram capazes de reprogramar mesmo em condições ideais. Nestes casos, uma supressão espontânea de novo dentro do quadro de leitura aberto do m2rtTA foi identificado como o motivo subjacente. Esta metodologia foi adaptada com sucesso para extrair sseA-1 + intermediários através de isolamento de células magnética (MACS). Há uma clara vantagem em tempo utilizando MACS, no entanto, a pureza dos SSEA-1 + populações de células &quot;é reduzido a 80-90%, em vez de mais do que 95%, o que, dependendo do tipo de experiência, as células são destinados a pode representar um problema. Deste modo, uma opção é usar MACS para enriquecer para SSEA-1 + células seguido de FACS para aumentar a pureza e / ou fracção de + /-las em células Epcam- SSEA-1 + / + de EpCAM e SSEA-1. &quot;&gt; Enquanto as células iPS produzidos pelo protocolo descrito e modelo de rato ter demonstrado ser eficaz pluripotentes e contribuir para todos os tecidos dos animais quiméricos 15,20, uma capacidade reduzida para produzir embriões inteiramente compostas por estas células iPS via complementação foi tetraplóide demonstrada 24. padrões de metilação aberrante do gene cluster Dlk-DIO3 foram identificados como a causa subjacente 24. Contudo, a adição de ácido ascórbico a uma concentração de 50 ug / ml para os meios de comunicação durante a reprogramação de complementação produzirá tetraplóide iPS células competentes 24. Informamos que um modelo alternativo do mouse reprogramável projetado para expressar os fatores de reprogramação em uma estequiometria diferente pode produzir células iPS competentes tetraplóides, mesmo na ausência de tratamento com ácido ascórbico 25. No entanto, em nossas células mãos deste reprogramar tensão na freqüência consideravelmente menor em comparação para o modo de rato aqui usadol. A metodologia descrita neste manuscrito permite a separação de produtos intermédios de reprogramação a partir do volume da população refractário e deve ser visto como uma ferramenta valiosa para dissecar e compreender o processo de reprogramação, removendo as limitações anteriores de ter de utilizar uma população não fraccionada por perfis (por exemplo, alto ruído do sinal das células refratários). A combinação de anticorpo aqui descrito permite o isolamento de produtos intermédios a partir de células de ratinho em elevado grau de pureza, no entanto, é possível que os marcadores da superfície da célula adicionais serão descobertos no futuro, que irá permitir a obtenção de produtos intermédios em ainda maior pureza. Por favor, note que sseA-1 expressão não é uma característica de células-tronco pluripotentes induzidas pelo homem e, como tal, este protocolo não pode ser usado em reprogramação de células de origem humana. Em conclusão, uma vez isolados os intermediários de reprogramação com o método descrito pode ser usado para análises moleculares, incluindo a expressão profilinag, cromatina imunoprecipitação, methylome análise e ensaios de proteína.

Estaminais embrionárias (ES), as células são derivadas da massa celular interna de embriões em fase de blastocisto 1. Sob condições de cultivo adequadas que se auto-renovar e permanecer pluripotentes. Em 2006, Yamanaka e seus colegas demonstraram que as células maduras podem ser reprogramadas para chamada tronco pluripotentes induzidas (iPS) células por expressão forçada de fatores de transcrição Oct-4, Klf-4, Sox-2, c-Myc (OKSM) 2. CEPi, tal como as células ES, pode dar origem a todos os tipos de células do corpo, no entanto, eles são livres das restrições éticas que cercam a geração de células ES 3. Além disso, as células iPS realizar a promessa da medicina regenerativa personalizado e mantenha um enorme potencial para aplicações como modelagem de doenças e drogas vitro triagem 4,5. Para reprogramar a tecnologia para cumprir esse potencial, o mecanismo básico de reprogramação nuclear precisa ser totalmente compreendido. No entanto, os esforços para dissecar o pat reprogramaçãoHWAY têm sido dificultados pelo fato de que apenas um número muito pequeno de células reprogramar (0,1-1%). Fibroblastos reprogramação êxito Tem sido relatado que passam por uma série de acontecimentos distintos incluindo um mesenquimais a transição epitelial e 6-10, nas fases finais de reprogramação, a activação da rede de pluripotência núcleo endógeno 11-14. Nós e outros 12,13,15-17 recentemente identificado um conjunto de marcadores de superfície celular que permite a separação de produtos intermédios raras a partir da população de massa refractária. Reprogramação fibroblastos embrionários (MEFs) sofrem alterações na expressão de Thy-1.2, Ssea1 e EpCAM (entre outros), durante o processo de reprogramação duas semanas de duração 15. Logo no início reprogramar um subconjunto de MEFs para baixo-regular a expressão do marcador de identidade fibroblastos (Thy-1.2) e, em seguida, começar a expressar o marcador associado à pluripotência sseA-1 12. Durante os estágios finais de reprogramação de células Ssea1 positivos Reactivcomeu genes de pluripotência endógenos, como Oct-4 10-13,15. Esta última transição é marcada sobre a superfície da célula através de expressão detectável de EpCAM (ver Figura 1) ou numa fase posterior PECAM 15. Recentemente, O&#39;Malley et ai. Relatado o uso de CD44 e ICAM1 como alternativas ou complementares para Thy-1.2 e SSEA-1 para a identificação de compostos intermédios de reprogramação. Nós já FACS extraído intermediários reprogramação do dia 0, Dia 3, Dia 6, culturas dia 9 e dia 12 de reprogramação, bem como a partir de linhagens de células iPS estabelecidas com base nesses marcadores de superfície celular 15,18. Para o sistema de reprogramação abaixo descrito e as condições que demonstraram ao nível de uma única célula que, embora as populações são silenciosos homogénea, existe um determinado grau de heterogeneidade das populações intermediários identificados. Deve notar-se que apenas um subconjunto de células dentro dessas populações são capazes de passar para o respectivo lado stage do processo de reprogramação e dão origem a colônias de células iPS em diferentes eficiências, que têm sido amplamente caracterizadas previamente 15,19. Além disso, a eficiência de reprogramação dessas populações depende, bem como sobre as condições de re-revestimento e cultura. Para aumentar a reprodutibilidade experimental usamos uma estirpe de ratinho reprogramável que foi manipulada para expressar um transactivador transcricional (m2rtTA) sob o controlo do locus Rosa26 e uma cassete policistrónica OKSM sob o controlo de um promotor responsivo a doxiciclina 20,21. Usando esse modelo de mouse contorna os efeitos colaterais indesejados dos métodos tradicionais de produção de virais células iPS, ou seja, uma população heterogênea de partida com célula a célula variabilidade no número e localização dos locais de integração de inserções virais. Duas linhagens de camundongos transgênicos (OKSM, m2rtTA), disponíveis como animais fundadores homozigotos no Laboratório Jackson, tem que ser cruzado, a fim de estabelecer a reprogramodelo de ratinho mmable (ver Figura 2). Nesse artigo, procuramos descrever em detalhes como derivar MEFs, gerar células iPS, e isolar os intermediários de reprogramação em vários estágios do processo de conversão por FACS.

<table border="0" cellpadding="0" cellspacing="0" width="638">
	<tbody>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Anti-mouse CD90.2 (Thy1.2) Pacific Blue&#160;</td>
			<td dir="LTR" style="width:191px;">eBioscience&#160;</td>
			<td dir="LTR" style="width:171px;">48-0902-82&#160;</td>
			<td style="width:64px;"></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Anti-Human/Mouse SSEA-1 Biotin&#160;</td>
			<td dir="LTR" style="width:191px;">eBioscience&#160;</td>
			<td dir="LTR" style="width:171px;">13-8813&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Streptavidin PE-Cy 7&#160;</td>
			<td dir="LTR" style="width:191px;">eBioscience&#160;</td>
			<td dir="LTR" style="width:171px;">25-4317-82&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Anti- Mouse CD326(Epcam) Fitc&#160;</td>
			<td dir="LTR" style="width:191px;">eBioscience&#160;</td>
			<td dir="LTR" style="width:171px;">48-5791-82&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Sodium pyruvate&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">11360-070&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">MEM Non-Essential Amino Acids (NEAA)&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">11140-050&#160;</td>
			<td></td>
		</tr>
		<tr height="25">
			<td dir="LTR" height="25" style="height:25px;width:212px;">Embryonic Stem Cell qualified Foetal Bovine Serum (FBS)&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">10439024</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Trypsin-EDTA (0.25%)&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">25200-056&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">GlutaMAX</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">35050-070&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">&#946;-Mercaptoethanol&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">21985-023&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">DMSO (Dimethyl Sulfoxide)&#160;</td>
			<td dir="LTR" style="width:191px;">Sigma-Aldrich&#160;</td>
			<td dir="LTR" style="width:171px;">D8418&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Penicillin/streptomycin&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">15140</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:212px;"></td>
			<td style="width:191px;"></td>
			<td style="width:171px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Propidium Iodide solution (PI)&#160;</td>
			<td dir="LTR" style="width:191px;">Sigma-Aldrich&#160;</td>
			<td dir="LTR" style="width:171px;">P4864-10ML&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Gelatine from porcine skin&#160;</td>
			<td dir="LTR" style="width:191px;">Sigma-Aldrich&#160;</td>
			<td dir="LTR" style="width:171px;">G1890&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Doxycyclin hyclate&#160;</td>
			<td dir="LTR" style="width:191px;">Sigma-Aldrich&#160;</td>
			<td dir="LTR" style="width:171px;">33429-100MG-R&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Leukemia Inhibitory Factor (LIF)&#160;</td>
			<td dir="LTR" style="width:191px;">Millipore&#160;</td>
			<td dir="LTR" style="width:171px;">ESG1107&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">DMEM High Glucose&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">11960-044&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">DPBS (Dulbecco s phosphate buffer saline)&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">14190-144&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">KnockOut DMEM&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">10829-018&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Irradiated MEFs&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">S1520-100&#160;</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">75-cm2 Tissue culture flasks&#160;</td>
			<td dir="LTR" style="width:191px;">Corning/BD Bioscience&#160;</td>
			<td dir="LTR" style="width:171px;">430641</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">15-ml centrifuge tubes&#160;</td>
			<td dir="LTR" style="width:191px;">Corning/BD Bioscience&#160;</td>
			<td dir="LTR" style="width:171px;">430791</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">50-ml centrifuge tubes&#160;</td>
			<td dir="LTR" style="width:191px;">Corning/BD Bioscience&#160;</td>
			<td dir="LTR" style="width:171px;">430829</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Disposable surgical blades&#160;</td>
			<td dir="LTR" style="width:191px;">Disposable surgical blades&#160;</td>
			<td dir="LTR" style="width:171px;">201</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Cryogenic vials&#160;</td>
			<td dir="LTR" style="width:191px;">Corning/BD Bioscience&#160;</td>
			<td dir="LTR" style="width:171px;">430487</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">70 &#181;m Cell strainer&#160;</td>
			<td dir="LTR" style="width:191px;">BD Bioscience&#160;</td>
			<td dir="LTR" style="width:171px;">352340</td>
			<td></td>
		</tr>
		<tr height="21">
			<td dir="LTR" height="21" style="height:21px;width:212px;">Taq DNA Polymerase&#160;</td>
			<td dir="LTR" style="width:191px;">Life Technologies&#160;</td>
			<td dir="LTR" style="width:171px;">10342-020&#160;</td>
			<td></td>
		</tr>
	</tbody>
</table>

cell surface marker mediated purification of ips cell intermediates from a reprogrammable mouse model

Mature cells can be reprogrammed to a pluripotent state. These so called induced pluripotent stem (iPS) cells are able to give rise to all cell types of the body and consequently have vast potential for regenerative medicine applications. Traditionally iPS cells are generated by viral introduction of transcription factors Oct-4, Klf-4, Sox-2, and c-Myc (OKSM) into fibroblasts. However, reprogramming is an inefficient process with only 0.1-1% of cells reverting towards a pluripotent state, making it difficult to study the reprogramming mechanism. A proven methodology that has allowed the study of the reprogramming process is to separate the rare intermediates of the reaction from the refractory bulk population. In the case of mouse embryonic fibroblasts (MEFs), we and others have previously shown that reprogramming cells undergo a distinct series of changes in the expression profile of cell surface markers which can be used for the separation of these cells. During the early stages of OKSM expression successfully reprogramming cells lose fibroblast identity marker Thy-1.2 and up-regulate pluripotency associated marker Ssea-1. The final transition of a subset of Ssea-1 positive cells towards the pluripotent state is marked by the expression of Epcam during the late stages of reprogramming. Here we provide a detailed description of the methodology used to isolate reprogramming intermediates from cultures of reprogramming MEFs. In order to increase experimental reproducibility we use a reprogrammable mouse strain that has been engineered to express a transcriptional transactivator (m2rtTA) under control of the Rosa26 locus and OKSM under control of a doxycycline responsive promoter. Cells isolated from these mice are isogenic and express OKSM homogenously upon addition of doxycycline. We describe in detail the establishment of the reprogrammable mice, the derivation of MEFs, and the subsequent isolation of intermediates during reprogramming into iPS cells via fluorescent activated cells sorting (FACS).

Após o esvaziamento, a desagregação e plaqueamento de um embrião E13.5 rato, uma placa de 10 cm é esperado para a confluência em aproximadamente 1 a 2 dias. Nesta fase, é normal que a cultura de conter algumas peças aderentes de tecido que não foram celularizados corretamente. Estes irão desaparecer após passaging. Após a indução de doxiciclina, MEFs reprogramação sofrem mudanças morfológicas distintas. Por volta do dia 6, os remendos da colônia-like primeiros devem começar a surgir (Figura 4C). Estes irão continuar a crescer em tamanho com a continuação da cultura (ver Figura 4D, E). Uma boa experiência de reprogramação deve resultar em&gt; 500 colônias por T75, que inicialmente foi semeado com 5 x 10 5 células (Figura 4E). Culturas iPS estabelecidas possuem características cúpula colônias em forma e deve ser maioritariamente desprovido de células diferenciadas (Figura 4F). Ocasionalmente, passaging adicional de iPS cultures pode ser necessária para remover as células indiferenciadas / parcialmente reprogramadas; um frasco confluente de células pode ser dividida numa proporção de 01:10 para uma camada alimentadora de MEFs irradiados. Como mencionado acima, as alterações morfológicas e moleculares durante a reprogramação são refletidas por mudanças nos perfis FACS para Thy-1.2, sseA-1 e, finalmente, EPCAM (veja a Figura 7A-F). Como relatado anteriormente 12,15, enquanto MEFs são predominantemente positivos para Thy-1.2 e negativo para os outros marcadores, dia 3 culturas já parece muito diferente. Uma grande proporção de células começaram a infra-regular a expressão de Thy-1.2 e um pequeno subconjunto destes Thy-1.2 células tornaram-se negativos positivo para SSEA-1, o intermediário reprogramação real para este ponto de tempo. O número de intermediários de reprogramação que pode ser extraído a partir do dia 3 culturas é muito imprevisível como a percentagem de SSEA-1 + / Thy-1.2-encontra-se geralmente num intervalo entre 1-10% de concretizacélulas e. Nos dias 6 e 9 uma maior percentagem de células SSEA-1 +, geralmente bem acima de 10%, pode ser detectada. Por volta do dia 12 de um subconjunto de SSEA-1 células positivas pode ser detectado que também rotular positivo para EpCAM. Dia 12 culturas, como culturas do Dia 3, representa um ponto de estrangulamento para a purificação dos intermediários, como a percentagem de células SSEA-1.2 + / + EpCAM é variável e geralmente está na gama de apenas 2-4% de todas as células vivas. O número esperado de reprogramação intermediários apresentados na Tabela 1 somente serve como uma aproximação grosseira. Culturas de células estabelecidas de boa fé iPS será fortemente positivo para sseA-1 e EPCAM. <img alt="Figura 1" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig1highres.jpg" width="500" /> Figura 1 superfície marcador muda durante o caminho reprogramação: Down-regulação do marcador identidade fibroblastos Thy-1.2 é seguido por aumento da regulação doSseA-1. A transição de um subconjunto de sseA-1 células positivas para um estado pluripotente é indicado pela aquisição de EPCAM por volta do dia 12. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig1large.jpg" target="_blank">Clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 2" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig2highres.jpg" width="500" /> Figura 2 representação esquemática do modelo de rato reprogramável:. M2rtTA expressão está sob o controlo do locus Rosa26 ubiquamente activo na presença de doxiciclina (DOX) a proteína se liga a um m2rtTA tetraciclina promotor dependente (tetOP) ao colagénio 1a1 (COL1A1) lócus resultando na expressão da cassete de quatro factores. Duas cassetes bicistrônico estão ligados por uma entrada site ribossoma (IRES). Quadros de leitura abertos para Oct-4 / Klf-4 e Sox-2 / c-Myc são fu<html> sed por seqüências F2A e E2A de auto-clivagem, respectivamente. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig2large.jpg" target="_blank">Clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 3" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig3highres.jpg" width="500" /> Figura 3. Embrião dissecção: trompa uterina (A) para uma placa de transferência de 10 centímetros cheio com 10 ml de PBS e (B), cortadas em pedaços contendo um embrião. (C) Utilizando uma pinça libertar os embriões de tecido embrionário extra e remover cabeça, membros, cauda e órgãos internos. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig3large.jpg" target="_blank">Clique aqui para ver uma versão maior desta figura.</a> les / ftp_upload / 51728 / 51728fig4highres.jpg &quot;width =&quot; 500 &quot;/&gt; Manchas Figura 4 Alterações morfológicas durante a reprogramação. Colônias de como tornar-se evidente nas culturas a partir do dia 6 em diante. IPSCs Bona fide são caracterizados por uma morfologia em forma de cúpula. (A) Dia 0 / MEFs, (B) Dia 3, (C) Dia 6, (D) Dia 9, (E) Dia 12, (F) iPS cultura celular. Barra de escala:. 200 um <a href="https://www.jove.com/files/ftp_upload/51728/51728fig4large.jpg" target="_blank">por favor, clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 5" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig5highres.jpg" width="500" /> Figura 5 configuração FACS Basic. (A) Excluir detritos com Side Scatter contra Forward Scatter Área blot. (B)Excluir agregados de não-detritos pela passagem sobre a população de uma única célula com Forward Scatter Área contra Forward Scatter alta blot. (C) Excluir células mortas da população de uma única célula por gating no PI baixos eventos com PI canal contra Forward Scatter Área Blot. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig5large.jpg" target="_blank">Clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 6" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig6highres.jpg" width="500" /> Figura 6 gating. (A, B) Usando as células controle sem rótulos criados portões para Thy-1.2 + / sseA-1 células, Thy-1.2- / sseA-1 células e Thy-1.2- / sseA-1 + células. (C) Use as células controle não marcados para definir portas para as células positivos e negativos EPCAM EPCAM. (D) SSEA-1 + / Thy-1.2-células podem ser separadasem um EPCAM positivo e em uma população negativa EPCAM. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig6large.jpg" target="_blank">Clique aqui para ver uma versão maior desta figura.</a> <img alt="Figura 7" fo:content-width="5in" src="/files/ftp_upload/51728/51728fig7highres.jpg" width="500" /> Figura 7 Thy-1.2 contra sseA-1 FACS manchas em várias fases do processo de reprogramação. (A) Dia 0 / MEFs, (B) Dia 3, (C) Dia 6, (D) Dia 9, (E) Day 12, de cultura de células (F) iPS. Tabela 1 sugestão de densidade de semeadura, número frasco eo resultado esperado para P1 MEFs de um heterozigoto embrião para OKSM e m2rtTA. <a href="https://www.jove.com/files/ftp_upload/51728/51728fig7large.jpg" target="_blank">Clique h</a>ere para ver uma versão maior desta figura. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Dia </td><td> Número de frascos T75 semeadas no dia 0 </td><td> Número total de células Ssea1 + após FACS </td><td> Número total de Ssea1 + / + EpCAM células após FACS </td></tr><tr><td> 3 </td><td> 8 </td><td> 2000000 </td><td></td></tr><tr><td> 6 </td><td> 4 </td><td> 2000000 </td><td></td></tr><tr><td> 9 </td><td> 4 </td><td> 2000000 </td><td></td></tr><tr><td> 12 </td><td> 10 </td><td> 10 milhões </td><td> 2000000 </td></tr></tbody></table>

Watch this Scientific Journal Video about Cell Surface Marker Mediated Purification of iPS Cell Intermediates from a Reprogrammable Mouse Model at JoVE.com

Cell Surface Marker Mediated Purification of iPS Cell Intermediates from a Reprogrammable Mouse Model

Mouse embryonic fibroblast can be reprogrammed into induced pluripotent stem cells at low efficiency by the forced expression of transcription factors Oct-4, Sox-2, Klf-4, c-Myc. The rare intermediates of the reprogramming reaction are FACS isolated via labeling with antibodies against cell surface makers Thy-1.2, Ssea-1, and Epcam.

Marcador de superfície celular Purificação Mediada de iPS Intermediários celulares a partir de um modelo Reprogramável mouse

Mature cells can be reprogrammed to a pluripotent state. These so called induced pluripotent stem (iPS) cells are able to give rise to all cell types of ...

cell-surface-marker-mediated-purification-ips-cell-intermediates-from

Research

JoVE Journal

Biology

12.2K visualizações.  Monash University. Mouse embryonic fibroblast can be reprogrammed into induced pluripotent stem cells at low efficiency by the forced expression of transcription factors Oct-4, Sox-2, Klf-4, c-Myc. The rare intermediates of the reprogramming reaction are FACS isolated via labeling with antibodies against cell surface makers Thy-1.2, Ssea-1, and Epcam. 

Vídeo: Cell Surface Marker Mediated Purification of iPS Cell Intermediates from a Reprogrammable Mouse Model

Chromatographic Purification of Highly Active Yeast Ribosomes

Eukaryotic ribosomes are much more labile as compared to their eubacterial and archael counterparts, thus posing a significant challenge to researchers. Particularly troublesome is the fact that lysis of cells releases a large number of proteases and nucleases which can degrade ribosomes. Thus, it is important to separate ribosomes from these enzymes as quickly as possible. Unfortunately, conventional differential ultracentrifugation methods leaves ribosomes exposed to these enzymes for unacceptably long periods of time, impacting their structural integrity and functionality. To address this problem, we utilize a chromatographic method using a cysteine charged Sulfolink resin. This simple and rapid application significantly reduces co-purifying proteolytic and nucleolytic activities, producing high yields of intact, highly biochemically active yeast ribosomes. We suggest that this method should also be applicable to mammalian ribosomes. The simplicity of the method, and the enhanced purity and activity of chromatographically purified ribosome represents a significant technical advancement for the study of eukaryotic ribosomes.

Contamination of preparations of eukaryotic ribosomes purified by traditional methods by co-purifying nucleases and proteases negatively impacts on downstream biochemical and structural analyses. A rapid and simple chromatographic purification method is used to solve this problem using yeast ribosomes as a model system.

Purificação cromatográfica de Ribossomos Yeast Highly Active

Eukaryotic ribosomes are much more labile as compared to their eubacterial and archael counterparts, thus posing a significant challenge to researchers.  ...

Biologia

Isolation and Purification of Kinesin from Drosophila Embryos

Motor proteins move cargos along microtubules, and transport them to specific sub-cellular locations. Because altered transport is suggested to underlie a variety of neurodegenerative diseases, understanding microtubule based motor transport and its regulation will likely ultimately lead to improved therapeutic approaches. Kinesin-1 is a eukaryotic motor protein which moves in an anterograde (plus-end) direction along microtubules (MTs), powered by ATP hydrolysis. Here we report a detailed purification protocol to isolate active full length kinesin from Drosophila embryos, thus allowing the combination of Drosophila genetics with single-molecule biophysical studies. Starting with approximately 50 laying cups, with approximately 1000 females per cup, we carried out overnight collections. This provided approximately 10 ml of packed embryos. The embryos were bleach dechorionated (yielding approximately 9 grams of embryos), and then homogenized. After disruption, the homogenate was clarified using a low speed spin followed by a high speed centrifugation. The clarified supernatant was treated with GTP and taxol to polymerize MTs. Kinesin was immobilized on polymerized MTs by adding the ATP analog, 5'-adenylyl imidodiphosphate at room temperature. After kinesin binding, microtubules were sedimented via high speed centrifugation through a sucrose cushion. The microtubule pellet was then re-suspended, and this process was repeated. Finally, ATP was added to release the kinesin from the MTs. High speed centrifugation then spun down the MTs, leaving the kinesin in the supernatant. This kinesin was subjected to a centrifugal filtration using a 100 KD cut off filter for further purification, aliquoted, snap frozen in liquid nitrogen, and stored at -80 &deg;C. SDS gel electrophoresis and western blotting was performed using the purified sample. The motor activity of purified samples before and after the final centrifugal filtration step was evaluated using an in vitro single molecule microtubule assay. The kinesin fractions before and after the centrifugal filtration showed processivity as previously reported in literature. Further experiments are underway to evaluate the interaction between kinesin and other transport related proteins.

Isolation and Purification of Kinesin from Drosophila Embryos

This is a protocol to isolate active full length Kinesin from Drosophila embryos for single-molecule biophysical studies. We show how to collect embryos, make the embryo lysate, and then polymerize microtubules (MTs). Kinesin is purified by immobilizing it on the MTs, spinning down the Kinesin-MT complexes, and then releasing the kinesin from the MTs via ATP addition.

Isolamento e Purificação de cinesina partir Drosophila Os embriões

Motor proteins move cargos along microtubules, and transport them to specific sub-cellular locations. Because altered transport is suggested to underlie a ...

Avidity-based Extracellular Interaction Screening (AVEXIS) for the Scalable Detection of Low-affinity Extracellular Receptor-Ligand Interactions

Extracellular protein:protein interactions between secreted or membrane-tethered proteins are critical for both initiating intercellular communication and ensuring cohesion within multicellular organisms. Proteins predicted to form extracellular interactions are encoded by approximately a quarter of human genes1, but despite their importance and abundance, the majority of these proteins have no documented binding partner. Primarily, this is due to their biochemical intractability: membrane-embedded proteins are difficult to solubilise in their native conformation and contain structurally-important posttranslational modifications. Also, the interaction affinities between receptor proteins are often characterised by extremely low interaction strengths (half-lives &lt; 1 second) precluding their detection with many commonly-used high throughput methods2. 
Here, we describe an assay, AVEXIS (AVidity-based EXtracellular Interaction Screen) that overcomes these technical challenges enabling the detection of very weak protein interactions (t1/2 &le; 0.1 sec) with a low false positive rate3. The assay is usually implemented in a high throughput format to enable the systematic screening of many thousands of interactions in a convenient microtitre plate format (Fig. 1). It relies on the production of soluble recombinant protein libraries that contain the ectodomain fragments of cell surface receptors or secreted proteins within which to screen for interactions; therefore, this approach is suitable for type I, type II, GPI-linked cell surface receptors and secreted proteins but not for multipass membrane proteins such as ion channels or transporters.
The recombinant protein libraries are produced using a convenient and high-level mammalian expression system4, to ensure that important posttranslational modifications such as glycosylation and disulphide bonds are added. Expressed recombinant proteins are secreted into the medium and produced in two forms: a biotinylated bait which can be captured on a streptavidin-coated solid phase suitable for screening, and a pentamerised enzyme-tagged (&beta;-lactamase) prey. The bait and prey proteins are presented to each other in a binary fashion to detect direct interactions between them, similar to a conventional ELISA (Fig. 1). The pentamerisation of the proteins in the prey is achieved through a peptide sequence from the cartilage oligomeric matrix protein (COMP) and increases the local concentration of the ectodomains thereby providing significant avidity gains to enable even very transient interactions to be detected. By normalising the activities of both the bait and prey to predetermined levels prior to screening, we have shown that interactions having monomeric half-lives of 0.1 sec can be detected with low false positive rates3.

Avidity-based Extracellular Interaction Screening AVEXIS for the Scalable Detection of Low-affinity Extracellular Receptor-Ligand Interactions

AVEXIS is a high throughput protein interaction assay developed to systematically screen for novel extracellular receptor-ligand pairs involved in cellular recognition processes. It is specifically designed to detect transient protein interactions that are difficult to identify using other high throughput approaches.

Avidez baseado Triagem Interação Extracelular (AVEXIS) para a detecção escalável de baixa afinidade Extracelular receptor-ligante Interações

Extracellular protein:protein interactions between secreted or membrane-tethered proteins are critical for both initiating intercellular communication and ...

Generation of Mice Derived from Induced Pluripotent Stem Cells

The production of induced pluripotent stem cells (iPSCs) from somatic cells provides a means to create valuable tools for basic research and may also produce a source of patient-matched cells for regenerative therapies. iPSCs may be generated using multiple protocols and derived from multiple cell sources. Once generated, iPSCs are tested using a variety of assays including immunostaining for pluripotency markers, generation of three germ layers in embryoid bodies and teratomas, comparisons of gene expression with embryonic stem cells (ESCs) and production of chimeric mice with or without germline contribution2. Importantly, iPSC lines that pass these tests still vary in their capacity to produce different differentiated cell types2. This has made it difficult to establish which iPSC derivation protocols, donor cell sources or selection methods are most useful for different applications.
The most stringent test of whether a stem cell line has sufficient developmental potential to generate all tissues required for survival of an organism (termed full pluripotency) is tetraploid embryo complementation (TEC)3-5. Technically, TEC involves electrofusion of two-cell embryos to generate tetraploid (4n) one-cell embryos that can be cultured in vitro to the blastocyst stage6. Diploid (2n) pluripotent stem cells (e.g. ESCs or iPSCs) are then injected into the blastocoel cavity of the tetraploid blastocyst and transferred to a recipient female for gestation (see Figure 1). The tetraploid component of the complemented embryo contributes almost exclusively to the extraembryonic tissues (placenta, yolk sac), whereas the diploid cells constitute the embryo proper, resulting in a fetus derived entirely from the injected stem cell line.
Recently, we reported the derivation of iPSC lines that reproducibly generate adult mice via TEC1. These iPSC lines give rise to viable pups with efficiencies of 5-13%, which is comparable to ESCs3,4,7 and higher than that reported for most other iPSC lines8-12. These reports show that direct reprogramming can produce fully pluripotent iPSCs that match ESCs in their developmental potential and efficiency of generating pups in TEC tests. At present, it is not clear what distinguishes between fully pluripotent iPSCs and less potent lines13-15. Nor is it clear which reprogramming methods will produce these lines with the highest efficiency. Here we describe one method that produces fully pluripotent iPSCs and "all- iPSC" mice, which may be helpful for investigators wishing to compare the pluripotency of iPSC lines or establish the equivalence of different reprogramming methods.

Generating induced pluripotent stem cell (iPSC) lines produces lines of differing developmental potential even when they pass standard tests for pluripotency. Here we describe a protocol to produce mice derived entirely from iPSCs, which defines the iPSC lines as possessing full pluripotency1.

Geração de camundongos derivadas de células-tronco pluripotentes induzidas

The production of induced pluripotent stem cells (iPSCs) from somatic cells provides a means to create valuable tools for basic research and may also ...

MicroRNA Expression Profiles of Human iPS Cells, Retinal Pigment Epithelium Derived From iPS, and Fetal Retinal Pigment Epithelium

The objective of this report is to describe the protocols for comparing the microRNA (miRNA) profiles of human induced-pluripotent stem (iPS) cells, retinal pigment epithelium (RPE) derived from human iPS cells (iPS-RPE), and fetal RPE. The protocols include collection of RNA for analysis by microarray, and the analysis of microarray data to identify miRNAs that are differentially expressed among three cell types. The methods for culture of iPS cells and fetal RPE are explained. The protocol used for differentiation of RPE from human iPS is also described. The RNA extraction technique we describe was selected to allow maximal recovery of very small RNA for use in a miRNA microarray. Finally, cellular pathway and network analysis of microarray data is explained. These techniques will facilitate the comparison of the miRNA profiles of three different cell types.

The microRNA (miRNA) profiles of human induced-pluripotent stem (iPS) cells, retinal pigment epithelium (RPE) derived from human induced-pluripotent stem (iPS) cells (iPS-RPE), and fetal RPE, were compared.

Perfis de expressão de microRNA iPS Human Cells, Retinal Pigment Epithelium Derivado de Ips, e Fetal Retinal Pigment Epithelium

The objective of this report is to describe the protocols for comparing the microRNA (miRNA) profiles of human induced-pluripotent stem (iPS) cells, ...

Efficient iPS Cell Generation from Blood Using Episomes and HDAC Inhibitors

This manuscript illustrates a protocol for efficiently creating integration-free human induced pluripotent stem cells (iPSCs) from peripheral blood using episomal plasmids and histone deacetylase (HDAC) inhibitors. The advantages of this approach include: (1) the use of a minimal amount of peripheral blood as a source material; (2) nonintegrating reprogramming vectors; (3) a cost effective method for generating vector free iPSCs; (4) a single transfection; and (5) the use of small molecules to facilitate epigenetic reprogramming. Briefly, peripheral blood mononuclear cells (PBMCs) are isolated from routine phlebotomy samples and then cultured in defined growth factors to yield a highly proliferative erythrocyte progenitor cell population that is remarkably amenable to reprogramming. Nonintegrating, nontransmissible episomal plasmids expressing OCT4, SOX2, KLF4, MYCL, LIN28A, and a p53 short hairpin (sh)RNA are introduced into the derived erythroblasts via a single nucleofection. Cotransfection of an episome that expresses enhanced green fluorescent protein (eGFP) allows for easy identification of transfected cells. A separate replication-deficient plasmid expressing Epstein-Barr nuclear antigen 1 (EBNA1) is also added to the reaction mixture for increased expression of episomal proteins. Transfected cells are then plated onto a layer of irradiated mouse embryonic fibroblasts (iMEFs) for continued reprogramming. As soon as iPSC-like colonies appear at about twelve days after nucleofection, HDAC inhibitors are added to the medium to facilitate epigenetic remodeling. We have found that the inclusion of HDAC inhibitors routinely increases the generation of fully reprogrammed iPSC colonies by 2 fold. Once iPSC colonies exhibit typical human embryonic stem cell (hESC) morphology, they are gently transferred to individual iMEF-coated tissue culture plates for continued growth and expansion.

Here we describe a protocol for generating human induced pluripotent stem cells from peripheral blood using an episome based reprogramming strategy and histone deacetylase inhibitors.

Eficiente Geração células iPS a partir de sangue, utilizando epissomas e HDAC Inibidores

This manuscript illustrates a protocol for efficiently creating integration-free human induced pluripotent stem cells (iPSCs) from peripheral blood using ...

Trans-inner Cell Mass Injection of Embryonic Stem Cells Leads to Higher Chimerism Rates

In an effort to increase efficiency in the creation of genetically modified mice via ES Cell methodologies, we present an adaptation to the current blastocyst injection protocol. Here we report that a simple rotation of the embryo, and injection through Trans-Inner cell mass (TICM) increased the percentage of chimeric mice from 31% to 50%, with no additional equipment or further specialized training. 26 different inbred clones, and 35 total clones were injected over a period of 9 months. There was no significant difference in either pregnancy rate or recovery rate of embryos between traditional injection techniques and TICM. Therefore, without any major alteration in the injection process and a simple positioning of the blastocyst and injecting through the ICM, releasing the ES cells into the blastocoel cavity can potentially improve the quantity of chimeric production and subsequent germline transmission.

Here we present a protocol to increase chimera production without the use of new equipment. A simple orientation change of the embryo for injection can increase the number of embryos produced, and potentially reduce the timeline to germline transmission.

Trans-interno pilha injeção maciça de células-tronco embrionárias leva a taxas mais elevadas de quimerismo

In an effort to increase efficiency in the creation of genetically modified mice via ES Cell methodologies, we present an adaptation to the current ...

Primary Cell Cultures from the Mouse Retinal Pigment Epithelium

The retinal pigment epithelium (RPE) is a highly polarized multi-functional epithelium that is located between the neural retina and the choroid of the eye. It is a single sheet of pigmented cells that are hexagonally packed and connected by tight junctions. The main functions of the RPE include absorption of light, phagocytosis of the shed photoreceptor outer segments, spatial buffering of ions, transport of nutrients, ions and water as well as active involvement in the visual cycle. With such important and diverse functions, it is critically important to study the biology of RPE cells. A number of RPE cell lines have been established; however, passaged and immortalized cells are known to quickly lose some of the morphological and physiological characteristics of natural RPE cells. Thus, primary cells are more suitable for studying different aspects of RPE cell biology and function. Mouse primary RPE cell culture is very useful to researchers since mouse models are widely used in biological studies, however collecting RPE cells from mouse is also very challenging due to their small size. Here, we present a protocol for establishing primary mouse RPE cell cultures which includes enucleation and dissection of the eyes and isolation of the RPE sheets to yield the cells for culturing. This method enables efficient cell recovery. The RPE cells obtained from two mice&#160;can reach confluency on one 12 mm polyester membrane insert pre-loaded in culture plate after one week of culture and display some of the original properties of bona fide RPE cells such as hexagonal shape and pigmentation after two weeks of culture.

The retinal pigment epithelium (RPE) is a multi-functional epithelium of the eye. Here we present a protocol to establish primary cell cultures derived from the murine RPE.

Culturas de células primárias do Mouse epithelium Retinal do Pigment

The retinal pigment epithelium (RPE) is a highly polarized multi-functional epithelium that is located between the neural retina and the choroid of the ...

Visualization and Quantification of Mesenchymal Cell Adipogenic Differentiation Potential with a Lineage Specific Marker

Several dyes are currently available for use in detecting differentiation of mesenchymal cells into adipocytes. Dyes, such as Oil Red O, are cheap, easy to use and widely utilized by laboratories analyzing the adipogenic potential of mesenchymal cells. However, they are not specific to changes in gene transcription. We have developed a gene-specific differentiation assay to analyze when a mesenchymal cell has switched its fate to an adipogenic lineage. Immuno-labelling against fatty acid binding protein-4 (FABP4), a lineage-specific marker of adipogenic differentiation, enabled visualization and quantification of differentiated cells. The ability to quantify adipogenic differentiation potential of mesenchymal cells in a 96 well microplate format has promising implications for a number of applications. Hundreds of clinical trials involve the use of adult mesenchymal stromal cells and it is currently difficult to correlate therapeutic outcomes within and especially between such clinical trials. This simple high-throughput FABP4 assay provides a quantitative assay for assessing the differentiation potential of patient-derived cells and is a robust tool for comparing different isolation and expansion methods. This is particularly important given the increasing recognition of the heterogeneity of the cells being administered to patients in mesenchymal cell products. The assay also has potential utility in high throughput drug screening, particularly in obesity and pre-diabetes research.

Traditional methods of assessing adipogenic differentiation are cheap and easy to use, but are not specific to changes in gene expression. We have developed an assay to quantify mesenchymal cell differentiation into mature adipocytes using a lineage specific marker. This assay has diverse applications across basic research and clinical medicine.

Visualização e quantificação de células mesenquimais Adipogenic diferenciação potencial com um marcador específico da linhagem

Several dyes are currently available for use in detecting differentiation of mesenchymal cells into adipocytes. Dyes, such as Oil Red O, are cheap, easy ...

A Mouse Model of Intestinal Partial Obstruction

Intestinal obstructions, that impede or block peristaltic movement, can be caused by abdominal adhesions and most gastrointestinal (GI) diseases including tumorous growths. However, the cellular remodeling mechanisms involved in, and caused by, intestinal obstructions are poorly understood. Several animal models of intestinal obstructions have been developed, but the mouse model is the most cost/time effective. The mouse model uses the surgical implantation of an intestinal partial obstruction (PO) that has a high mortality rate if it is not performed correctly. In addition, mice receiving PO surgery fail to develop hypertrophy if an appropriate blockade is not used or not properly placed. Here, we describe a detailed protocol for PO surgery which produces reliable and reproducible intestinal obstructions with a very low mortality rate. This protocol utilizes a surgically placed silicone ring that surrounds the ileum which partially blocks digestive movement in the small intestine. The partial blockage makes the intestine become dilated due to the halt of digestive movement. The dilation of the intestine induces smooth muscle hypertrophy on the oral side of the ring that progressively develops over 2 weeks until it causes death. The surgical PO mouse model offers an in vivo model of hypertrophic intestinal tissue useful for studying pathological changes of intestinal cells including smooth muscle cells (SMC), interstitial cells of Cajal (ICC), PDGFR&#945;+, and neuronal cells during the development of intestinal obstruction.

Intestinal obstructions are a partial or complete blockage of the intestine that can cause severe abdominal pain, nausea, vomiting, and preventing the passage of stool. This procedure for creating intestinal partial obsructions in mice is reliable in studying the mechanisms underlying pathological cell growth and death in the intestine.

Um modelo do rato de obstrução Intestinal parcial

Intestinal obstructions, that impede or block peristaltic movement, can be caused by abdominal adhesions and most gastrointestinal (GI) diseases including ...