Trabalho descrito neste protocolo foi possível graças ao financiamento do Governo de Victoria, como parte de uma aliança de colaboração com o Instituto de Medicina Regenerativa da Califórnia (CIRM).

Todos os procedimentos são realizados numa câmara de fluxo laminar estéril. Todos os meios e as soluções são equilibradas a 37 ° C, salvo especificação em contrário. 1 Expansão de unidades Humanos (hESCs e hiPSCs, WA-09 utilizado no presente protocolo) para transfecção Nota: Não é necessário ampliar hESCs sobre Matrigel ou Geltrex. hESCs expandidas em fibroblastos embrionários de ratinho (MEFs) pode ser utilizado para a electroporação ou nucleofection seguir um passo de remoção de MEF (ver secção 2.8). <ol><li> Preparar uma placa de 100 mm x 1 e x frascos de 75cm2 DR4 MEFs a 2,0 x 10 4 culas por cm 2 em meio de MEF (ver Tabela 1) em placas pré-revestidas com 0,1% w / v de gelatina. Nota: CF1, BLK6 ou MF1 MEFs pode ser utilizado, no entanto, recomenda-se que as linhas de MEF resistentes a antibióticos são usados, por exemplo, DR410. </li><li> No dia seguinte, hESCs passagem num prato 100 milímetros pré-revestida com MEFs preparados na seção 1.1. Para fazer isso aspitaxa hESC meios de culturas pratos, lavar hESCs com solução salina balanceada Ca2 + / Mg2 + Livre de Hanks (HBSS), adicione Dispase (ver Tabela 2 para as quantidades adequadas) e coloque em uma incubadora umidificada a 37 ° C / 5% de CO2. Após a incubação de 3-5 minutos, aspirado e Dispase lavar cuidadosamente 1-2 vezes com HBSS para remover MEFs. Adicionar meios de células estaminais embrionárias humanas (ver Tabela 3) e utilizando um raspador de células, ou 5 ml de pipeta, raspe as colónias para fora da superfície da placa de cultura. </li><li> Colete os fragmentos de colônias em suspensão da placa de cultura para um tubo de centrífuga de 15 ml. Placa de cultura Enxaguar com media hESC e transferência para o tubo de 15 ml. Tenha cuidado para não quebrar aglomerados em células individuais ou em pequenos fragmentos. </li><li> Centrifugar durante 5 minutos a 160 xg para sedimentar fragmentos da colônia. </li><li> Aspirar o sobrenadante. Toque fundo do tubo de 15 ml com o dedo para soltar colônia fragmento pellet. Fragmentos de colônias suavemente ressuspender em media hESC de acordo com a taxa de divisão (normallya dividir proporção entre 1: 4 e 1: 8 é o caso). Tenha muito cuidado para não tornar aglomerados em células individuais ou em pequenos fragmentos como isso vai afetar repique eficiência. </li><li> Antes replating fragmentos hES para lavar MEFs 1x com HBSS. Lentamente, adicionar uma quantidade adequada (ver Tabela 2) de suspensão de células contendo fragmentos de células estaminais embrionárias humanas em células estaminais embrionárias humanas a mídia pratos pré-revestidos a MEFs. </li><li> Coloque placas de cultura na prateleira na incubadora e mover-se lentamente para trás e para a frente e para os lados para distribuir uniformemente fragmentos da colônia. </li><li> Substituir mídia hESC diária. </li><li> Para preparar meios condicionados de MEFs (MEF-CM) lavar os 75 cm 2 frascos pré-revestida com MEFs 1 x com HBSS. Adicionar media hESC. Após 24 horas, recolher meios condicionados e substituir com media hESC fresco. Repita diariamente por um período máximo de 12 dias. Armazenar MEF-CM a 4 ° C até ser necessário. </li></ol> 2 Preparação do CES Humanos para transfecção <ol><li> Observar o crescimento de hESCssob um microscópio diariamente. Quando as colônias tornam-se 40-50% confluentes, a placa 3 x 100 mm pratos com 2,0 x 10 5 MEFs por cm 2. </li><li> Quando as colônias tornam-se 60-70% confluentes eles estão prontos para ser transfectados. colônias &#39;noivo&#39;, removendo colônias diferenciados ou para núcleos de colônia. Observação: Como acreditamos maior eficiência de transfecção e segmentação ocorrer quando as células estão na fase de crescimento logarítmico, é sugerido que a electroporação ser conduzida antes de chegar hESCs ≥ 70% de confluência. </li><li> Lave colônias hESC com HBSS e adicionar Accutase. Nota: Não é necessário hESCs para o pré-tratamento com inibidor ROCHA Y-27632 inibição suficiente ocorrerá quando incubadas com Y-27632 durante a etapa 2.7 </li><li> Incuba-se durante 10 - 20 min a 37 ° C / 5% de CO 2 até colónias são processados ​​células individuais como visto sob um microscópio. Tritura-se com células de uma pipeta de 1 ml. </li><li> Adicionar media hESC e filtro em um tubo de 15 ml utilizando uma straine 40 um celularr para remover aglomerados de células. </li><li> Centrifugar a 160 xg por 5 min. Ressuspender pellet celular em media hESC frescos e repita para remover qualquer solução Accutase residual. </li><li> Ressuspender as células em meio contendo 10 uM de hES Y-27632 e transferir a suspensão de células totais de uma placa de 100 mm Pré-revestidas com gelatina. </li><li> Incubar a 37 ° C / 5% de CO 2 durante um período mínimo de 30 min. </li><li> Durante este tempo MEFs vai aderir ao prato revestido de gelatina. Recolhe hESCs não aderentes utilizando uma pipeta de 1 ml em 15 ml de um novo tubo de centrífuga e determinar a densidade de células utilizando um hemocitómetro. </li></ol> 3. Eletroporação de hESCs <ol><li> Meio Filtrante CM-MEF usando um filtro de 0,22 um e adicionar 10 fator de crescimento de fibroblastos humana recombinante ml / ng 2 (rhFGF2). </li><li> Transferir 7,5 x 106 hESCs de secção 2.9 para um novo tubo de 15 ml e centrifugar a 160 xg durante 5 min. </li><li> Durante esse tempo, criou o electroporator: Select programa para ELE exponencialctroporation e definir os seguintes parâmetros, Tensão: 250 V, Capacidade: 500 mF, e Resistance: ∞-. </li><li> Aspirar o sobrenadante e re-suspensão da pelota celular em 0,8 ml de gelado de 0,22 um filtrado HBSS. Transferir a solução para um estéril 0,4 centímetros de eletroporação cuvete. </li><li> Adicione-TV-hPITX3 frente segmentação construção (30 mg DNA) e misture delicadamente com uma pipeta de 200 mL. Incubar em gelo por 5 min. Durante este tempo, retire uma alíquota de PITX3 ZFN mRNA e descongelar em gelo. Quando descongeladas transferência 7,5 ul de ADN de ARNm de ZFN mistura / célula em cuvete de electroporação. Misture delicadamente com uma pipeta de 200 mL. Nota: O local a ser alvo é o principal fator que contribui para o direcionamento eficiência. Codificação Loci genes silenciosos, genes não expressos na CES, como PITX3 são difíceis de atingir usando recombinação homóloga convencional 6. Assim, este protocolo utiliza costume ZFNs projetado para o locus PITX3 humano para induzir um DNA dupla vertente break. </li><li> Electroporate, seguindo as instruções na tela no electroporator. </li><li> Usando uma pipeta de 200 uL transferir o conteúdo da cuveta de electroporação com um tubo de 15 ml contendo 10 ml de meio de células estaminais embrionárias humanas. Lave a cuba duas vezes com 200 mL de mídia hESC cada vez e transferir para um tubo de 15 ml. Haverá &quot;muco-like&quot; detritos que consiste em DNA e proteínas das células lisadas que irá impactar negativamente a sobrevivência das células. Centrifugar a 160 xg por 5 min para remover os entulhos. </li><li> Aspirar o sobrenadante e bata suavemente pellet celular para soltar. Re-suspender em 30 ml suplementados MEF-CM contendo 10 mM Y-27632 e replate para 3 x 100 mm pratos preplated com MEFs. </li><li> Troque a mídia diariamente. No dia 2, Y-27632 pode ser retirado e as células cultivadas em apenas media hESC. </li><li> Depois de 2-3 dias o hESCs deverá ser de 50-70% confluentes. Neste ponto começa selecção de antibiótico (por exemplo, 0,5 ug / ml de puromicina). </li><li> Manter selexão adicionando fresco media hESC / ï¿½puromicina diária. Depois de ~ 7 dias pequenas colônias devem ser visíveis. Se MEFs resistentes a antibióticos não são utilizados, MEFs pode ser suplementada pela adição de um adicional de 1,0 x 10 células por 4 cm2. </li></ol> 4. Picking Clones Transgênicos hESC <ol><li> Cerca de 14-21 dias após a seleção (quando as colônias atingiram ~ 1 milímetro de diâmetro) para preparar as placas de expansão e de triagem. Começar por descongelamento de uma alíquota de Matrigel ou Geltrex a 4 ° C durante um mínimo de 5 horas. Dilui-se de acordo com as instruções dos fabricantes e adicionar 75 ul a cada poço de placas de 3 x 96 poços. Prepare pratos 3 x 48 poços por plaqueamento MEFs a 2.0 x 10 4 células por cm 2. Incubar as duas placas O / N a 37 ° C / 5% de CO 2. </li><li> No dia seguinte dissecar colónias em 16-25 peças usando uma agulha 21 G na extremidade de uma pipeta de 2 ml por meio de corte de uma grade. </li><li> Aspirar Matrigel a partir de placas de 96 poços e substituir com Supplemmídia entadas CM-MEF. Lave MEFs em placas de 48 poços 1 x com HBSS e add media hESC. </li><li> Usando uma pipeta de 200 uL suavemente transferir uma terços da colónia dissecado em uma placa de 48 poços para expansão. Transferir o outro dois terços da colónia dissecado em uma placa de 96 poços contendo meio correspondente CM-MEF suplementados. </li><li> Manter ambas as placas, alterando os meios de comunicação diária (suplementado meios de CM-MEF para placas revestidas matrigel 96 poços e meios de células estaminais embrionárias humanas para placas de 48 poços contendo MEFs; ambos suplementados com 0,5 ug / ml de puromicina). </li><li> Expandir até placas de 96 poços são 100% confluentes e, em seguida, inicialmente através de rastreio por PCR. </li></ol> 5. Triagem e Expansão das clones positivos <ol><li> Para preparar DNA genômico (método baseado em 11) Remova todas as mídias placas invertendo, em seguida, seque em papel toalha. </li><li> Lavar cada poço duas vezes com PBS temperatura ambiente (100 ul / poço de cada lavagem), inverter e blot como no passo 5.1. Coloque as placas a -80 ° C fou 1 - 2 h para auxiliar na lise celular (placas podem ser armazenadas indefinidamente como este). </li><li> Enquanto as células são uma temperatura entre -80 ° C fazer sarcosil Tampão de Lise (ver Tabela 4) (50 uL / poço). Para lisar as células, as placas quentes durante 5 min à temperatura ambiente, em seguida tampão de lise pipeta em cada cavidade. Selar as bordas de cada placa com fita, coloque em um recipiente lacrado contendo papel toalha umedecido para criar umidade, e incubar O / N a 60 ° C. </li><li> Após a incubação, adicionar 150 ul de NaCl 5 M a 10 ml de -20 ° C de etanol absoluto, misturar bem e adicionar 100 ul a cada poço (Nota: etanol vai turva quando é adicionado NaCl). Placas Toque suavemente para misturar (não pipeta) e deixe por um mínimo de 30 minutos em temperatura ambiente. Durante este tempo, a solução irá clara e o ADN precipitar. </li><li> Remova a solução tal como no passo 5.1, em seguida adicionar 150 ul de etanol a 70% a cada poço. Inverta placa suavemente e apaga como antes. Repetir esta etapa umas 2x. Nota: Como o DNA precipitado naturalmente Adheres para a cultura de tecidos de plástico não se soltar durante essas etapas de lavagem.) </li><li> Após a lavagem final, as placas brevemente centrífuga a uma velocidade superior a concentrar-se o DNA para o fundo de cada poço em seguida secar ao ar à temperatura ambiente (ou 37 ° C) durante pelo menos 30 min. </li><li> Adicionar 40-50 uL T0.1E (pH 8,0) (ver Tabela 5) ou TE (pH 8,0) a cada poço e colocam as placas a 65 ° C durante 1 h ou a 4 ° CO / N antes de usar para a PCR. Ressuspender o ADN batendo suavemente os lados da placa. Use 1-2 uL da re-suspensão de ADN / 10 uL da reacção de PCR. </li><li> Usando o Modelo longo PCR System Expandir com hPITX3 L braço gen. F e G hPITX3 braço GFP R primers realizar a triagem inicial de clones a 58 ° C de recozimento, 45 seg de extensão, 35 ciclos. </li><li> Amostras de electroforese com 1kb Hyperladder em um gel de agarose a 1% contendo GelRed a 100 V durante 45 min e detecção de clones positivos por meio de iluminação UV. </li><li> Validar clones positivos de PCR por digestão de ADN genómico a partir de expaclones NDED (ver abaixo) com HindIII e hibridação de sondas de 5 &#39;e 3&#39; dos braços de vector de homologia para uma mancha de Southern (conforme anteriormente descrito em 1). As sondas são gerados por PCR utilizando os pares de iniciadores hPITX3 sonda 5 &#39;F e R, e hPITX3 3&#39; da sonda F e I, digerido com EcoRI e ligado num vector de clonagem geral. </li><li> Dependendo do número de clones positivos, preparar duas cavidades de uma placa de 6 poços por pré-plaqueamento (MEFs com 2,0 x 10 células por 4 cm2). </li><li> No dia seguinte, pré-tratamento de clones positivos na placa de 48 poços com 10 uM Y-27632 por um período mínimo de 1 hora. </li><li> Lave clones positivos com HBSS e adicione 300 ml de Accutase. </li><li> Quando as colônias são prestados células individuais, adicionar 1 ml de mídia hESC e recolher em um tubo de 15 ml. </li><li> Troque a mídia diariamente. No dia 2, Y-27632 pode ser retirado e as células cultivadas em meio hESC. </li><li> Quando as colônias são 70-80% confluentes, subcultura e congelar o resto do colofragmentos NY. </li></ol>

<ol>
	<li>Nefzger, C. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lmx1a+Allows+Context-Specific+Isolation+of+Progenitors+of+GABAergic+or+Dopaminergic+Neurons+During+Neural+Differentiation+of+Embryonic+Stem+Cells.">Lmx1a Allows Context-Specific Isolation of Progenitors of GABAergic or Dopaminergic Neurons During Neural Differentiation of Embryonic Stem Cells.</a> Stem Cells. 30 (7), 1349-1361 (2012).</li><li>Zeng, W. R., Fabb, S. R. A., Haynes, J. M., Pouton, C. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Extended+periods+of+neural+induction+and+propagation+of+embryonic+stem+cell-derived+neural+progenitors+with+EGF+and+FGF2+enhances+Lmx1a+expression+and+neurogenic+potential.">Extended periods of neural induction and propagation of embryonic stem cell-derived neural progenitors with EGF and FGF2 enhances Lmx1a expression and neurogenic potential.</a> Neurochemistry International. 59 (3), 394-403 (2011).</li><li>Collin, J., Lako, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Concise+review:+putting+a+finger+on+stem+cell+biology:+zinc+finger+nuclease-driven+targeted+genetic+editing+in+human+embryonic+stem+cells.">Concise review: putting a finger on stem cell biology: zinc finger nuclease-driven targeted genetic editing in human embryonic stem cells.</a> Stem Cells. 29 (7), 1021-1033 (2011).</li><li>Carroll, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Progress+and+prospects:+zinc-finger+nucleases+as+gene+therapy+agents.">Progress and prospects: zinc-finger nucleases as gene therapy agents.</a> Gene Therapy. 15 (22), 1463-1468 (2008).</li><li>Urnov, F. D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+endogenous+human+gene+correction+using+designed+zinc-finger+nucleases.">Highly efficient endogenous human gene correction using designed zinc-finger nucleases.</a> Nature. 435 (7042), 646-651 (2005).</li><li>Hockemeyer, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+targeting+of+expressed+and+silent+genes+in+human+ESCs+and+iESCs+using+zinc-finger+nucleases.">Efficient targeting of expressed and silent genes in human ESCs and iESCs using zinc-finger nucleases.</a> Nature Biotechnology. 27 (9), 851-857 (2009).</li><li>Lombardo, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+editing+in+human+stem+cells+using+zinc+finger+nucleases+and+integrase-defective+lentiviral+vector+delivery.">Gene editing in human stem cells using zinc finger nucleases and integrase-defective lentiviral vector delivery.</a> Nature Biotechnology. 25 (11), (2007).</li><li>Boch, J., Bonas, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Xanthomonas+AvrBs3+family-type+III+effectors:+discovery+and+function.">Xanthomonas AvrBs3 family-type III effectors: discovery and function.</a> Annual Review of Phytopathology. 48, 419-436 (2010).</li><li>Hockemeyer, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genetic+engineering+of+human+embryonic+cells+using+TALE+nucleases.">Genetic engineering of human embryonic cells using TALE nucleases.</a> Nature Biotechnology. 29 (8), 731-734 (2011).</li><li>Tucker, K. L., Wang, Y., Dausman, J., Jaenisch, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+transgenic+mouse+strain+expressing+four+drug-selectable+marker+genes.">A transgenic mouse strain expressing four drug-selectable marker genes.</a> Nucleic Acids Research. 25 (18), 3745-3746 (1997).</li><li>Ram&#237;rez-Solis, R., Rivera-P&#233;rez, J., Wallace, J. D., Wims, M., Zheng, H., Bradley, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genomic+DNA+microextraction:+a+method+to+screen+numerous+samples.">Genomic DNA microextraction: a method to screen numerous samples.</a> Analytical Biochemistry. 201 (2), 331-335 (1992).</li><li>Kawasaki, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+midbrain+dopaminergic+neurons+from+ES+cells+by+stromal+cell-derived+inducing+activity.">Induction of midbrain dopaminergic neurons from ES cells by stromal cell-derived inducing activity.</a> Neuron. 28 (1), 31-40 (2000).</li><li>Denham, M., Thompson, L. H., Leung, J., P&#233;bay, A., Bj&#246;rklund, A., Dottori, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gli1+is+an+inducing+factor+in+generating+floor+plate+progenitor+cells+from+human+embryonic+stem+cells.">Gli1 is an inducing factor in generating floor plate progenitor cells from human embryonic stem cells.</a> Stem Cells. 28 (10), 1805-1815 (2010).</li><li>Smidt, M. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+homeodomain+gene+Ptx3+has+highly+restricted+brain+expression+in+mesencephalic+dopaminergic+neurons.">A homeodomain gene Ptx3 has highly restricted brain expression in mesencephalic dopaminergic neurons.</a> Proceedings of the National Academy of Sciences U.S.A. 94, 13305-13310 (1997).</li></ol>

Os autores não têm nada a revelar.

A geração de linhas celulares repórter oferece um meio poderoso para rastrear, visualizar e isolar as células de interesse de uma população heterogênea derivado de hESCs. No entanto, a abordagem selectiva de genes através de recombinação homóloga convencional provou ser extremamente ineficiente para o CES humanos 3. Neste protocolo, descrevem uma técnica relativamente simples para a introdução de uma RP para um exão do locus PITX3, em hESCs utilizando um vector de direccionamento ampla...

Current células estaminais embrionárias (ESC) protocolos de diferenciação resultar em populações celulares heterogéneas, em particular no que diz respeito à determinação de fenótipos neuronais específicas. Assim, embora as culturas contêm o fenótipo celular desejado, outro neuronal, tipos de células não-neuronais e não-diferenciados estão freqüentemente presentes 1. Estas características de limitar a aplicação da CES derivado de fontes celulares para utilização na terapia de substituição de células e em modelos in vitro da doença. Linhas de células repórteres genéticos oferecer um meio para visualizar, rastrear e isolar as células de interesse, desde que a expressão da proteína repórter (RP) reproduz expressão endógena. A utilização de promotores imediatamente a montante de uma região codificante do gene podem ser utilizados para derivar os repórteres genéticos bruto mas tais construções não possuem os elementos reguladores que controlam a expressão precisos gene endógeno. Em contraste, a recombinação homóloga ofereceoportunidade de assegurar a expressão de alta fidelidade da RP. No passado, os vectores de direccionamento concebidos para a recombinação homóloga no locus específico de interesse foram utilizados para direccionar RPS em rato (CES mESCs) utilizando electroporação, como um meio de entrega de ADN de 1,2. No entanto, a geração de linhas de células repórteres via recombinação homóloga convencional é extremamente ineficiente para humanos (CES hESCs), e, assim, só tem sido documentada em diversos casos (revista em 3). Ao utilizar uma proteína quimérica engenharia contendo uma fusão de uma nuclease Fok I com motivos de dedos de zinco específicas do local, conhecidos colectivamente como nucleases de dedos de zinco (ZFNs), quebras de ADN de cadeia dupla pode ser introduzida no locus genómico pre-determinado. Quando um vector de ADN com homologia com ambos os lados da ruptura de DNA de cadeia dupla é adicionado, o sítio genómico pode ser reparada por recombinação homóloga, permitindo a incorporação da sequência de ADN dador. Esta técnica provou ser útil fou edição genômica em células primárias humanas 4,5 e 6,7 hESCs. Trabalhos mais recentes tem utilizados activadores de transcrição, como efectoras nucleases (TALENS), factores de transcrição utilizadas por agentes patogénicos 8, para auxiliar na criação de site-specific nucleases 9. No seguinte protocolo que demonstram a geração de uma linha celular de células estaminais embrionárias humanas repórter por electroporação de um vector de EGFP contendo homólogo direccionamento 6 em conjunto com ZFNs para a homeobox pituitária humana 3 (PITX3) local. Após a seleção de antibióticos por 2-3 semanas, hESCs com DNA corretamente integrado pode ser escolhido manualmente, expandiu e selecionados, inicialmente, via PCR, e posteriormente validada por Southern blotting.

<table border="0" cellpadding="0" cellspacing="0" width="883">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Mouse Embryonic Fibroblasts (DR4)</td>
			<td style="width:207px;">GlobalStem</td>
			<td style="width:119px;">GSC-6004G</td>
			<td style="width:67px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Gelatin</td>
			<td style="width:207px;">Sigma</td>
			<td style="width:119px;">G1393-100ML</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">HBSS, no Calcium, no Magnesium, no Phenol Red (HBSS)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">14175-095</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Dispase</td>
			<td style="width:207px;">StemCell Technologies</td>
			<td style="width:119px;">7923</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Cell Scraper</td>
			<td style="width:207px;">Corning</td>
			<td style="width:119px;">3008</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Accutase</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">A11105-01</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Y27632</td>
			<td style="width:207px;">Axon Medchem</td>
			<td style="width:119px;">Axon 1683</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Cell Strainer - 40um</td>
			<td>BD Biosciences</td>
			<td>352340</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">33mm - 0.22 um filter</td>
			<td style="width:207px;">Millipore</td>
			<td style="width:119px;">SLGP033RS</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">rhFGF2</td>
			<td style="width:207px;">R&#38;D Systems</td>
			<td>233-FB-025/CF</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Electroporator</td>
			<td style="width:207px;">BioRad</td>
			<td style="width:119px;">165-2661</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">0.4cm electroporation cuvette</td>
			<td style="width:207px;">BioRad</td>
			<td style="width:119px;">165-2088</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Human TV-hPITX3-forward targeting construct</td>
			<td style="width:207px;">Addgene</td>
			<td style="width:119px;">31942</td>
			<td></td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:491px;">ZFN Kit; Human PITX3</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td style="width:119px;">CKOZFN1050-1KT</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Puromycin</td>
			<td style="width:207px;">Invivogen</td>
			<td style="width:119px;">ant-pr-1</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Matrigel</td>
			<td style="width:207px;">BD Biosciences</td>
			<td>354277</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Geltrex</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">A1569601</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">NaCl</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td>S3014</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td style="width:207px;">Life Technologies</td>
			<td>10566-016</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Fetal Bovine Serum, Qualified, Heat Inactivated, US Origin (FBS)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">16140-071</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Pen/Strep</td>
			<td style="width:207px;">Life Technologies</td>
			<td>15070-063</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Dulbecco&#39;s Modified Eagle Medium/Nutrient Mixture F-12 (DMEM/F12)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">11320-033</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">KnockOut Serum Replacement (KSR)</td>
			<td style="width:207px;">Life Technologies</td>
			<td>10828-028</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">MEM Non-Essential Amino Acids&#160; (NEAA)</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">11140-050</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">GlutaMAX</td>
			<td style="width:207px;">Life Technologies</td>
			<td style="width:119px;">35050-061</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">&#223;-mercaptoethanol</td>
			<td style="width:207px;">Life Technologies</td>
			<td>21985-023</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">N-Lauroylsarcosine sodium salt solution (Sarcosyl) (30%)</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td style="width:119px;">61747</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">EDTA</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td><a href="http://www.sigmaaldrich.com/catalog/product/sial/e9884?lang=en&amp;region=US">E9884</a></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Trizma Hydrochloride</td>
			<td style="width:207px;">Sigma-Aldrich</td>
			<td>T3253</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;">Proteinase K solution (20mg/ml)</td>
			<td style="width:207px;">Bioline Australia</td>
			<td>BIO-37084</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">Expand Long Template PCR System</td>
			<td style="width:207px;">Roche Australia</td>
			<td style="width:119px;">11681834001</td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">hPITX3 L arm gen. F (primer): 5&#8217; TGTCCTAAGGAGAATGGGTAACAGACA 3&#8217;</td>
			<td style="width:207px;">GeneWorks, Australia</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:491px;">hPITX3 L arm GFP R (primer): 5&#8217; ACACGCTGAACTTGTGGCCGTTTA 3&#8217;</td>
			<td style="width:207px;">GeneWorks, Australia</td>
			<td style="width:119px;"></td>
			<td></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:491px;">HyperLadder 1kb&#160;</td>
			<td style="width:207px;">Bioline Australia</td>
			<td>BIO-33025</td>
			<td></td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;width:491px;">GelRed</td>
			<td style="width:207px;">Jomar Bioscience, Australia</td>
			<td style="width:119px;">41003</td>
			<td></td>
		</tr>
	</tbody>
</table>

zinc-finger nuclease enhanced gene targeting in human embryonic stem cells

Uma grande limitação com células-tronco embrionárias (ESC) protocolos de diferenciação atuais é a geração de populações de células heterogêneas. Estas culturas contêm as células de interesse, mas também estão contaminados com CES indiferenciadas, derivados não-neuronais e outros subtipos neuronais. Isto limita a sua utilização in vitro e in vivo em aplicações, tais como em modelagem vitro para a descoberta de drogas ou terapia de substituição de células. Para ajudar a superar isso, linhas de células repórter, que oferecem um meio de visualizar, monitorar e isolar as células de interesse, podem ser projetados. No entanto, para alcançar este objectivo em células-tronco embrionárias humanas por meio de recombinação homóloga convencional é extremamente ineficiente. Este protocolo descreve a segmentação do homeobox Hipófise 3 (PITX3) lugar em células estaminais embrionárias humanas usando nucleases zinc-finger projetados, que introduzem quebras de DNA de cadeia dupla específicas do local, juntamente com umaPITX3 - EGFP -específico vector dador de DNA. Após a geração da linha celular PITX3 repórter, que podem então ser diferenciadas usando protocolos publicados para a utilização em estudos in vitro, tais como a doença ou modelos de substituição de células terapia de Parkinson.

Após a co-electroporação do projetado PITX3 par dedo de zinco, juntamente com o PITX3 - ADN de EGFP -específico doador vector e subsequente selecção de puromicina, os clones de células estaminais embrionárias humanas positivas foram inicialmente detectadas por meio de rastreio por PCR genómico (Figura 1). Hibridação de mancha de Southern destes clones positivos de PCR com 5 &#39;e 3&#39; de sondas específicas confirmada direccionamento correcto ao exão 1 do locus ...

Watch this Scientific Journal Video about Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells at JoVE.com

Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells

Linhas celulares Repórter oferecer um meio de visualizar, monitorar e isolar as células de interesse de populações heterogêneas. No entanto, utilizando a recombinação homóloga convencional em células estaminais embrionárias humanas-alvo do gene é extremamente ineficiente. Relata-se alvo CNS mesencéfalo específico fator de transcrição PITX3 loco com EGFP usando zinc-finger nuclease reforçada recombinação homóloga.

Zinc-finger nucleases Gene maior focalização em células estaminais embrionárias humanas

One major limitation with current human embryonic stem cell (ESC) differentiation protocols is the generation of heterogeneous cell ...

zinc-finger-nuclease-enhanced-gene-targeting-human-embryonic-stem

Research

JoVE Journal

Biology

10.7K visualizações.  Monash University.  Linhas celulares Repórter oferecer um meio de visualizar, monitorar e isolar as células de interesse de populações heterogêneas. No entanto, utilizando a recombinação homóloga convencional em células estaminais embrionárias humanas-alvo do gene é extremamente ineficiente. Relata-se alvo CNS mesencéfalo específico fator de transcrição PITX3 loco com EGFP usando zinc-finger nuclease reforçada recombinação homóloga. 

Vídeo: Zinc-finger Nuclease Enhanced Gene Targeting in Human Embryonic Stem Cells

Propagation of Human Embryonic Stem (ES) Cells

Propagation of Human Embryonic Stem ES Cells

Propagação de-tronco embrionárias humanas (ES) Células

Biologia

Derivation of Human Embryonic Stem Cells by Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass. 


The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both medical applications and as a research 
tool for addressing fundamental questions in development and disease. Here, we provide a 
concise, step-by-step protocol for the derivation of human embryonic stem cells from embryos 
by immunosurgical isolation of the inner cell mass.

Derivação de células estaminais embrionárias humanas por Immunosurgery

The ability of human embryonic stem cells to self-renew and differentiate into all cell types of 
the body suggests that they hold great promise for both ...

Probing for Mitochondrial Complex Activity in Human Embryonic Stem Cells

Mitochondria are cytoplasmic organelles that have a primary role in cellular metabolism and homeostasis, regulation of the cell signaling network, and programmed cell death. Mitochondria produce ATP, regulate the cytoplasmic redox state and Ca2+ balance, catabolize fatty acids, synthesize heme, nucleotides, steroid hormones, amino acids, and help assemble iron-sulfur clusters in proteins. Mitochondria also have an essential role in heat production. Mutations of the mitochondrial genome cause several types of human disorder. The accumulation of mtDNA mutations correlates with aging and is suspected to have an important role in the development of cancer. Due to their vitally important role in all cell types, the function of mitochondria must also be critical for stem cells. Key advances have been made in our understanding of stem cell viability, proliferation, and differentiation capacity. But the functional activity of stem cells, in particular their energy status, was not yet been studied in detail. Almost nothing is known about the mitochondrial properties of human embryonic stem cells (hESCs) and their differentiated precursor progeny. One way to understand and evaluate the role of mitochondria in hESC function and developmental potential is to directly measure the activity of mitochondrial respiratory complexes. Here, we describe high resolution clear native gel electrophoresis and subsequent in gel activity visualization as a method for analyzing the five respiratory chain complexes of hESCs.

In this video, we will show you how the mitochondrial respiratory chain complexes of human embryonic stem cells can be analyzed using in gel activity assays.

Sondagem para a Atividade Complexo mitocondrial em células estaminais embrionárias humanas

Mitochondria are cytoplasmic organelles that have a primary role in cellular metabolism and homeostasis, regulation of the cell signaling network, and ...

In vitro and in vivo Bioluminescence Reporter Gene Imaging of Human Embryonic Stem Cells

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative medicine. However, direct injection of hESCs, and cells differentiated from hESCs, into living organisms has thus far been hampered by significant cell death, teratoma formation, and host immune rejection. Understanding the in vivo hESC behavior after transplantation requires novel imaging techniques to longitudinally monitor hESC localization, proliferation, and viability. Molecular imaging has given investigators a high-throughput, inexpensive, and sensitive means for tracking in vivo cell proliferation over days, weeks, and even months. This advancement has significantly increased the understanding of the spatio-temporal kinetics of hESC engraftment, proliferation, and teratoma-formation in living subjects.

A major advance in molecular imaging has been the extension of noninvasive reporter gene assays from molecular and cellular biology into in vivo multi-modality imaging platforms. These reporter genes, under control of engineered promoters and enhancers that take advantage of the host cell s transcriptional machinery, are introduced into cells using a variety of vector and non-vector methods. Once in the cell, reporter genes can be transcribed either constitutively or only under specific biological or cellular conditions, depending on the type of promoter used. Transcription and translation of reporter genes into bioactive proteins is then detected with sensitive, noninvasive instrumentation (e.g., CCD cameras) using signal-generating probes such as D-luciferin.

To avoid the need for excitatory light to track stem cells in vivo as is required for fluorescence imaging, bioluminescence reporter gene imaging systems require only an exogenously administered probe to induce light emission. Firefly luciferase, derived from the firefly Photinus pyralis, encodes an enzyme that catalyzes D-luciferin to the optically active metabolite, oxyluciferin. Optical activity can then be monitored with an external CCD camera. Stably transduced cells that carry the reporter construct within their chromosomal DNA will pass the reporter construct DNA to daughter cells, allowing for longitudinal monitoring of hESC survival and proliferation in vivo. Furthermore, because expression of the reporter gene product is required for signal generation, only viable parent and daughter cells will create bioluminescence signal; apoptotic or dead cells will not. 

In this video, the specific materials and methods needed for tracking stem cell proliferation and teratoma formation with bioluminescence imaging will be described.

With the growing interest in stem cell therapies, molecular imaging techniques are ideal for monitoring stem cell behavior after transplantation. Luciferase reporter genes have enabled non-invasive, repetitive assessment of cell survival, location, and proliferation in vivo. This video will demonstrate how to track hESC proliferation in a living mouse.

In vitro e in vivo de imagens Gene Reporter bioluminescência de células estaminais embrionárias humanas

The discovery of human embryonic stem cells (hESCs) has dramatically increased the tools available to medical scientists interested in regenerative ...

Chromatin Immunoprecipitation from Human Embryonic Stem Cells

The functional and structural complexity of the myriad of cells in metazoan organisms arises from a small number of stem cells. Stem cells are characterized by two fundamental properties: self-renewal and multipotency that allows a stem cell to differentiate into virtually any cell type 1. The progression stem cell to differentiated cell is characterized by loss of multipotency, structural and morphological changes and the hierarchic activity of transcription factors and signaling molecules, whose activities establish and maintain cell-type specific gene expression patterns. At the molecular level, cell differentiation involves dynamic changes of the structure and composition of chromatin and the detection of those dynamic changes can provide valuable insights into the functional features of stem cells and the cell differentiation process 2,3. Chromatin is a highly compacted DNA-protein complex that forms when cells package chromosomal DNA with proteins, mainly histones 4. Stemcellness and cell differentiation has been correlated with the presence of specific arrays of regulatory proteins such as epigenetic factors, histone variants, and transcription factors 2,3,5.
 Chromatin immunoprecipitation (ChIP) provides a valuable method to monitor the presence of RNA, proteins, and protein modifications in chromatin 6,7. The comparison of chromatin from different cell types can elucidate dynamic changes in protein-chromatin associations that occur during cell differentiation.
Chromatin immunoprecipitation involves the purification of in vivo cross-linked chromatin. The isolated chromatin is reduced to smaller fragments by enzymatic digestion or mechanical force. Chromatin fragments are precipitated using specific antibodies to target proteins or protein and DNA modifications. The precipitated DNA or RNA is purified and used as a template for PCR or DNA microarray based assays. Prerequisites for a successful ChIP are high quality antibodies to the desired antigen and the availability of chromatin from control cells that do not express the target molecule. ChIP can correlate the presence of proteins, protein and RNA modifications, and RNA with specific target DNA, and depending on the choice of outread tool, detects the association of target molecules at specific target genes or in the context of an entire genome. The comparison of the distribution of proteins in the chromatin of differentiating cells can elucidate the dynamic changes of chromatin composition that coincide with the progression of cells along a cell lineage.

The differentiation of ESC coincides with cell-type specific changes in the structure and composition of chromatin. The detection of those changes provides valuable insights into the mechanisms that define stemcellness and cell differentiation. Chromatin immunoprecipitation (ChIP) represents a valuable method to dissect the molecular mechanisms underlying stem cell differentiation.

Cromatina imunoprecipitação de células estaminais embrionárias humanas

The functional and structural complexity of the myriad of cells in metazoan organisms arises from a small number of stem cells. Stem cells are ...

In vitro Labeling of Human Embryonic Stem Cells for Magnetic Resonance Imaging

Human embryonic stem cells (hESC) have demonstrated the ability to restore the injured myocardium. Magnetic resonance imaging (MRI) has emerged as one of the predominant imaging modalities to assess the restoration of the injured myocardium. Furthermore, ex-vivo labeling agents, such as iron-oxide nanoparticles, have been employed to track and localize the transplanted stem cells. However, this method does not monitor a fundamental cellular biology property regarding the viability of transplanted cells. It has been known that manganese chloride (MnCl2) enters the cells via voltage-gated calcium (Ca2+) channels when the cells are biologically active, and accumulates intracellularly to generate T1 shortening effect. Therefore, we suggest that manganese-guided MRI can be useful to monitor cell viability after the transplantation of hESC into the myocardium.
In this video, we will show how to label hESC with MnCl2 and how those cells can be clearly seen by using MRI in vitro. At the same time, biological activity of Ca2+-channels will be modulated utilizing both Ca2+-channel agonist and antagonist to evaluate concomitant signal changes.

In this video, we are showing how to label human embryonic stem cells (hESC) with manganese chloride (MnCl2) which can enter cells via voltage-gated calcium channels when the cells are biologically active. Additionally, we show the use of MnCl2 as cellular MRI contrast agent to determine the in vitro viability of hESC.

Na rotulagem in vitro de células estaminais embrionárias humanas para Ressonância Magnética

Human embryonic stem cells (hESC) have demonstrated the ability to restore the injured myocardium. Magnetic resonance imaging (MRI) has emerged as one of ...

Culture and Maintenance of Human Embryonic Stem Cells  

Human embryonic stem (hES) cells must be monitored and cared for in order to maintain healthy, undifferentiated cultures. At minimum, the cultures must be  fed  every day by performing a complete medium change to replenish lost nutrients and to keep the cultures free of unwanted differentiation factors. Although a small amount of differentiation is normal and expected in stem cell cultures, the culture should be routinely cleaned up by manually removing, or "picking" differentiated areas. Identifying and removing excess differentiation from hES cell cultures are essential techniques in the maintenance of a healthy population of cells.

Culture and Maintenance of Human Embryonic Stem Cells

This protocol demonstrates how to maintain healthy, undifferentiated human embryonic stem (ES) cells.

Cultura e Manutenção de células estaminais embrionárias humanas

Human embryonic stem (hES) cells must be monitored and cared for in order to maintain healthy, undifferentiated cultures. At minimum, the cultures must be ...

Freezing and Thawing Human Embryonic Stem Cells

Since James Thomson et al developed a technique in 1998 to isolate and grow hES in culture, freezing cells for later use and thawing and expanding cells from a frozen stock have become important procedures performed in routine hES cell culture. Since hES cells are very sensitive to the stresses of freezing and thawing, special care must taken. Here we demonstrate the proper technique for rapidly thawing hES cells from liquid nitrogen stocks, plating them on mouse embryonic feeder cells, and slowly freezing them for long-term storage.

Since James Thomson et al developed a technique in 1998 to isolate and grow hES in culture, freezing cells for later use and thawing and expanding cells from a frozen stock have become important procedures performed in routine hES cell culture. Since hES cells are very sensitive to the stresses of freezing and thawing, special care must taken. Here we demonstrate the proper technique for rapidly thawing hES cells from liquid nitrogen stocks, plating them on mouse embryonic feeder cells, and slowly freezing them for long-term storage.

Congelamento e descongelamento, células estaminais embrionárias humanas

Since James Thomson et al developed a technique in 1998 to isolate and grow hES in culture, freezing cells for later use and thawing and expanding cells ...

Differentiation of Embryonic Stem Cells into Oligodendrocyte Precursors

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant interest in deriving a pure population of lineage-committed oligodendrocyte precursor cells (OPCs) for transplantation. OPCs are characterized by the activity of the transcription factor Olig2 and surface expression of a proteoglycan NG2. Using the GFP-Olig2 (G-Olig2) mouse embryonic stem cell (mESC) reporter line, we optimized conditions for the differentiation of mESCs into GFP+Olig2+NG2+ OPCs. In our protocol, we first describe the generation of embryoid bodies (EBs) from mESCs. Second, we describe treatment of mESC-derived EBs with small molecules: (1) retinoic acid (RA) and (2) a sonic hedgehog (Shh) agonist purmorphamine (Pur) under defined culture conditions to direct EB differentiation into the oligodendroglial lineage. By this approach, OPCs can be obtained with high efficiency (&gt;80%) in a time period of 30 days. Cells derived from mESCs in this protocol are phenotypically similar to OPCs derived from primary tissue culture. The mESC-derived OPCs do not show the spiking property described for a subpopulation of brain OPCs in situ. To study this electrophysiological property, we describe the generation of spiking mESC-derived OPCs by ectopically expressing NaV1.2 subunit. The spiking and nonspiking cells obtained from this protocol will help advance functional studies on the two subpopulations of OPCs.

We describe a small molecule-based protocol for differentiation of mouse embryonic stem cells into oligodendrocyte precursor cells (OPCs). This protocol generates Olig2+NG2+ OPCs with high efficiency by 30 days of differentiation. We also describe a method to generate "spiking" OPCs that can fire action potentials.

Diferenciação de células-tronco embrionárias em precursores oligodendroglial

Oligodendrocytes are the myelinating cells of the central nervous system. For regenerative cell therapy in demyelinating diseases, there is significant ...

Fate Mapping of Human Embryonic Stem Cells by Teratoma Formation

Human embryonic stem cells (hESCs) have an unlimited capacity for self-renewal, and the ability to differentiate into cells derived from all three embryonic germ layers (1). Directed differentiation of hESCs into specific cell types has generated much interest in the field of regenerative medicine (e.g., (2-5)), and methods for determining the in vivo fate of selected or manipulated hESCs are essential to this endeavor. We have adapted a highly efficient teratoma formation assay for this purpose. A small number of specifically selected hESCs is mixed with undifferentiated wild type hESCs and Phaseolus vulgaris lectin to form a cell pellet. This is grafted beneath the kidney capsule in an immunodeficient mouse. As few as 2.5 x 105 hESCs are needed to form a 16 cm3 teratoma within 8-12 weeks. The fate of the originally selected hESCs can then be determined by immunohistochemistry. This method provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.

Directed differentiation of hESCs into specific cells has generated much interest in regenerative medicine. We provide a concise, step-by-step protocol for determining the in vivo fate of selected hESCs that provides a valuable tool for characterizing tissue-specific reagents for cell-based therapy.