Name: systemic bacterial infection and immune defense phenotypes in drosophila melanogaster
Uploaded: 2015-05-13T13:00:00.000+00:00
Duration: 10 min 12 s
Description: Watch this Scientific Journal Video about Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster at JoVE.com

We would like to thank the entire Lazzaro lab, and especially Susan Rottschaefer, for their help in both reviewing and testing these protocols. This is a product of their cumulative expertise. Work in the Lazzaro lab is supported by grants R01 AI083932 and R01 AI064950 from the US National Institutes of Health.

<ol>
	<li>Lemaitre, B., Hoffmann, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+host+defense+of+Drosophila+melanogaster.">The host defense of Drosophila melanogaster.</a> Annual review of immunology. 25, 697-743 (2007).</li><li>Dionne, M. S., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Models+of+infectious+diseases+in+the+fruit+fly+Drosophila+melanogaster.">Models of infectious diseases in the fruit fly Drosophila melanogaster.</a> Disease models &amp; mechanisms. 1 (1), 43-9 (2008).</li><li>Rutschmann, S., Jung, A. C., Hetru, C., Reichhart, J. M., Hoffmann, J. A., Ferrandon, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Rel+protein+DIF+mediates+the+antifungal+but+not+the+antibacterial+host+defense+in+Drosophila.">The Rel protein DIF mediates the antifungal but not the antibacterial host defense in Drosophila.</a> Immunity. 12 (5), 569-580 (2000).</li><li>Ayres, J. S., Freitag, N., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+Drosophila+mutants+altering+defense+of+and+endurance+to+Listeria+monocytogenes+infection.">Identification of Drosophila mutants altering defense of and endurance to Listeria monocytogenes infection.</a> Genetics. 178 (3), 1807-1815 (2008).</li><li>Cronin, S. J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+RNAi+screen+identifies+genes+involved+in+intestinal+pathogenic+bacterial+infection.">Genome-wide RNAi screen identifies genes involved in intestinal pathogenic bacterial infection.</a> Science. 325 (5938), 340-343 (2009).</li><li>Neyen, C., Bretscher, A. J., Binggeli, O., Lemaitre, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+to+study+Drosophila+immunity.">Methods to study Drosophila immunity.</a> Methods. , (2014).</li><li>Dionne, M. S., Pham, L. N., Shirasu-Hiza, M., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Akt+and+FOXO+dysregulation+contribute+to+infection-induced+wasting+in+Drosophila.">Akt and FOXO dysregulation contribute to infection-induced wasting in Drosophila.</a> Current biology CB. 16 (20), 1977-1985 (2006).</li><li>McKean, K. a., Yourth, C. P., Lazzaro, B. P., Clark, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+evolutionary+costs+of+immunological+maintenance+and+deployment.">The evolutionary costs of immunological maintenance and deployment.</a> BMC evolutionary biology. 8 (1), 76 (2008).</li><li>Kuo, T. -. H., Pike, D. H., Beizaeipour, Z., Williams, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sleep+triggered+by+an+immune+response+in+Drosophila+is+regulated+by+the+circadian+clock+and+requires+the+NFkappaB+Relish.">Sleep triggered by an immune response in Drosophila is regulated by the circadian clock and requires the NFkappaB Relish.</a> BMC neuroscience. 11, 17 (2010).</li><li>Panayidou, S., Ioannidou, E., Apidianakis, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+pathogenic+bacteria,+fungi,+and+viruses+in+Drosophila:+disease+modeling,+lessons,+and+shortcomings.">Human pathogenic bacteria, fungi, and viruses in Drosophila: disease modeling, lessons, and shortcomings.</a> Virulence. 5 (2), 253-269 (2014).</li><li>Keebaugh, E. S., Schlenke, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insights+from+natural+host&#8211;parasite+interactions:+The+Drosophila+model.">Insights from natural host&#8211;parasite interactions: The Drosophila model.</a> Developmental &amp; Comparative Immunology. 42 (1), 111-123 (2014).</li><li>Howick, V. M., Lazzaro, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genotype+and+diet+shape+resistance+and+tolerance+across+distinct+phases+of+bacterial+infection.">Genotype and diet shape resistance and tolerance across distinct phases of bacterial infection.</a> BMC evolutionary biology. 14 (1), 56 (2014).</li><li>Babin, A., Kolly, S., Kawecki, T. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Virulent+bacterial+infection+improves+aversive+learning+performance+in+Drosophila.">Virulent bacterial infection improves aversive learning performance in Drosophila.</a> Brain, behavior, and immunity. , (2014).</li><li>Chambers, M. C., Song, K. H., Schneider, D. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Listeria+monocytogenes+infection+causes+metabolic+shifts+in+Drosophila+melanogaster.">Listeria monocytogenes infection causes metabolic shifts in Drosophila melanogaster.</a> PLoS ONE. 7 (12), e50679 (2012).</li><li>Fellous, S., Lazzaro, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Larval+food+quality+affects+adult+(but+not+larval)+immune+gene+expression+independent+of+effects+on+general+condition.">Larval food quality affects adult (but not larval) immune gene expression independent of effects on general condition.</a> Molecular ecology. 19 (7), 1462-1468 (2010).</li><li>Stone, E. F., Fulton, B. O., Ayres, J. S., Pham, L. N., Ziauddin, J., Shirasu-Hiza, M. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+circadian+clock+protein+timeless+regulates+phagocytosis+of+bacteria+in+Drosophila.">The circadian clock protein timeless regulates phagocytosis of bacteria in Drosophila.</a> PLoS pathogens. 8 (1), e1002445 (2012).</li><li>Chambers, M. C., Jacobson, E., Khalil, S., Lazzaro, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Thorax+injury+lowers+resistance+to+infection+in+Drosophila+melanogaster.">Thorax injury lowers resistance to infection in Drosophila melanogaster.</a> Infection and immunity. , (2014).</li><li>Rich, J. T., Neely, J. G., Paniello, R. C., Voelker, C. C. J., Nussenbaum, B., Wang, E. W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+practical+guide+to+understanding+Kaplan-Meier+curves.">A practical guide to understanding Kaplan-Meier curves.</a> Otolaryngology--head and neck surgery official journal of American Academy of Otolaryngology-Head and Neck Surgery. 143 (3), 331-336 (2010).</li><li>Sokal, R. R., Rohlf, F. J., Freeman, W. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Biometry. , (1995).</li><li>Frydman, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolbachia+bacterial+infection+in+Drosophila.">Wolbachia bacterial infection in Drosophila.</a> Journal of visualized experiments JoVE. (2), 158 (2007).</li><li>Kuo, T. -. H., Handa, A., Williams, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+measurement+of+the+immune+response+and+sleep+in+Drosophila.">Quantitative measurement of the immune response and sleep in Drosophila.</a> Journal of visualized experiments JoVE. (70), e4355 (2012).</li><li>Vodovar, N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Drosophila+host+defense+after+oral+infection+by+an+entomopathogenic+Pseudomonas+species.">Drosophila host defense after oral infection by an entomopathogenic Pseudomonas species.</a> Proceedings of the National Academy of Sciences of the United States of America. 102 (32), 11414-11419 (2005).</li><li>Nehme, N. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+model+of+bacterial+intestinal+infections+in+Drosophila+melanogaster.">A model of bacterial intestinal infections in Drosophila melanogaster.</a> PLoS pathogens. 3 (11), e173 (2007).</li><li>Jaenike, J., Polak, M., Fiskin, A., Helou, M., Minhas, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interspecific+transmission+of+endosymbiotic+Spiroplasma+by+mites.">Interspecific transmission of endosymbiotic Spiroplasma by mites.</a> Biology. 3 (1), 23-25 (2007).</li><li>Kanbar, G., Engels, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ultrastructure+and+bacterial+infection+of+wounds+in+honey+bee+(+Apis+mellifera)+pupae+punctured+by+Varroa+mites.">Ultrastructure and bacterial infection of wounds in honey bee ( Apis mellifera) pupae punctured by Varroa mites.</a> Parasitology research. 90 (5), 349-354 (2003).</li></ol>

None of the authors have competing interests or conflicting interests.

O procedimento descrito aqui produz infecção rigorosa e de alta qualidade de Drosophila melanogaster. Os exemplos ilustrados focado principalmente na infecção com Providencia rettgeri e E. coli, mas o protocolo é extremamente adaptável e pode ser aplicada a diversas infecções com bactérias ao longo de um intervalo de condições de criação de acolhimento e de manutenção. Os detalhes de uma abordagem experimental óptimo dependerá da bactéria utilizada para a infecção, o genótipo do hospedeiro e as condições experimentais gerais. É altamente recomendável para teste piloto quaisquer novas condições experimentais antes de iniciar projetos mais ambiciosos. Um bom ponto de partida é testar três doses de infecção ao longo de um intervalo de 100 vezes. Altamente patógenos virulentos são muitas vezes melhor introduzido em doses infecciosas muito baixos, na ordem de 10-100 células bacterianas por mosca. Agentes patogénicos mais moderadas podem ser injectados com doses mais elevadas de cerca de 1.000 bactérias por FLY, e não-patogénicos pode ser injectado em doses tão elevadas como 10.000 bactérias por mosca. Muitas vezes, é instrutivo para definir a cinética de infecções novas, acompanhando carga de patógenos, a mortalidade de acolhimento, e atividade do sistema imunológico através de uma série de tempo longitudinal. Como medida de carga de patógenos e de expressão génica do hospedeiro são ensaios destrutivos, é necessário infectar moscas distintas no início da experiência para cada ponto de tempo que é para ser medida. Ao decidir se quer usar ou picada de agulha de injeção baseada microcapilar, é importante notar que há vantagens e limitações de cada abordagem. Injecção capilar apresenta um volume de líquido para dentro da mosca, que tanto aumenta modestamente a pressão de turgescência e introduz sais ou outras moléculas que estão suspensos ou dissolvidos no veículo. Injeção capilar também exige o acesso a uma instalação de injecção ou compra do equipamento necessário. Alfinetada fossa séptica não requer nenhum equipamento especial e introduzmídia negligenciáveis ​​na mosca, e é normalmente mais eficiente para infectar um grande número de moscas. No entanto, as infecções pinprick não permitem o controlo preciso sobre a dose de infecção que pode ser conseguido com injecção capilar. O presente protocolo focada em um aparelho de injecção que regula mecanicamente volume de injecção, mas também são baseados em sistemas de injecção de pulsos discretos de ar pressurizado. 20,21 Estes são tipicamente mais caro do que o aparelho apresentado aqui e requerem calibração do impulso de ar para cada agulha, a fim de assegurar o volume de injecção consistente. Há um debate considerável, mas muito poucos dados sobre como se tornar sistemicamente moscas infectadas com a bactéria em estado selvagem. Alguns investigadores postulam que a maioria das infecções naturais ocorrem quando Drosophila ingerir bactérias patogénicas e as bactérias são capazes de escapar posteriormente do intestino para estabelecer uma infecção sistémica. No entanto, existem muito few bactérias conhecidas como sendo capazes de atravessar o intestino de D. melanogaster, e aqueles que têm essa capacidade são altamente letal para moscas 22,23. Uma teoria alternativa é que voa regularmente sustentar os ferimentos cuticulares através de fuga de tentativas fracassadas de predação ou o ataque de ácaros ectoparasitas. Esta hipótese é apoiada pela coleta frequente de D. selvagem melanogaster tendo pontos melanização que são indicativos de feridas cicatrizadas (observações não publicadas). Os ácaros foram mostrados para transmitir infecções bacterianas em Drosophila 24 e feridas deixadas por ácaros pode ser secundariamente infectadas por bactérias em abelhas de mel 25. No entanto, a freqüência na natureza da infecção do ácaro-driven ou de outra forma oportunista de D. melanogaster através de violações de cutícula não é conhecido. O protocolo descrito aqui permite introdução de bactérias diretamente na hemolinfa através de injeção quantitativo que ignora quaisquer barreiras epiteliais ou IMMU comportamentaisnidade. Métodos para a alimentação de bactérias patogénicas para D. melanogaster têm sido descritos em Vodovar et al. 22 e Nehme et ai. 23. Muitas bactérias entomopatogênicos representam pouco ou nenhum risco a saúde humana, permitindo aos pesquisadores para trabalhar com eles confortavelmente. Além disso, muito poucas bactérias têm a capacidade de infectar de Drosophila em contacto sem intervenção experimental, de modo que o risco de &quot;epidemia&quot; propagação da infecção bacteriana através de um laboratório através de superfícies contaminadas ou escapou moscas é geralmente muito baixa. No entanto, é aconselhável para assegurar que as medidas de contenção adequados estão no lugar para evitar moscas infectadas de escapar e para recapturar qualquer escapou moscas. O laboratório deve ser equipado com um nível de segurança biológica comensurável com a dos agentes patogénicos que está sendo utilizado, e melhores práticas padrão em microbiologia deve ser empregue. O infecti experimentalno método descrito aqui permite infecções de Drosophila melanogaster com qualquer dose de qualquer bactéria arbitrária. Uma vez que a infecção tenha sido estabelecido, é simples para medir a cinética de proliferação bacteriana ou recarga, para acompanhar a mortalidade hospedeiro, e a ensaio de indução do sistema imunitário do hospedeiro. Moscas infectadas podem facilmente ser submetido a outros ensaios fenotípicos, incluindo testes de funções fisiológicas que podem moldar ou ser moldados pela infecção. Os procedimentos descritos são baratos, requerem relativamente pouco equipamento especializado, e são facilmente aprendido, tornando-os propícios para o uso em diversos projetos através de uma amplitude de laboratórios de pesquisa e de ensino.

A mosca da fruta Drosophila melanogaster é um dos organismos modelo premier para estudar a função e evolução de defesa imunológica. Drosophila são baratos e fáceis de criar, são altamente passíveis de manipulação experimental, e são apoiados por uma extensa comunidade científica que desenvolveu uma ampla conjunto de ferramentas de pesquisa. Muitos aspectos da imunidade inata são conservadas entre insectos e mamíferos, incluindo a transdução de sinal mediada por receptores Toll-like e NF-kB, factores de transcrição da família de sinalização de JAK / STAT, e as respostas das vias JNK. 1,2 A função destes genes e vias lata ser consultado em D. melanogaster usando mutações ou RNAi knockdowns que as actividades de aumento ou diminuição da via. 3 - 6 Além disso, Drosophila pode ser usado para estudar as conseqüências fisiológicas de infecções e doenças, incluindo no contexto da teoria da história de vida evolutiva 7.- 9 Todos esses estudos, no entanto, depender da capacidade de infectar de forma fiável moscas experimentais sob condições de tratamento definidos. O procedimento aqui descrito apresenta um quadro metodológico para a entrega de infecções bacterianas robustos e repetíveis para Drosophila melanogaster e, posteriormente, medindo a gravidade da infecção e quantificar a resposta imune do hospedeiro. Drosophila pode ser natural e experimentalmente infectados por uma grande variedade de parasitas e organismos patogénicos, incluindo bactérias, fungos, vírus, nematóides e vespas parasitóides. O protocolo atual está focada no fornecimento infecção bacteriana sistêmica. Muitas bactérias diferentes podem ser usados ​​para infectar as moscas, e escolha do experimentador deve basear-se nas questões científicas precisas ser perguntado. Por exemplo, isolados clínicos humanos podem ser utilizados para estudar os mecanismos de virulência da bactéria 10, ou ecologicamente isolados relevantes podem ser preferred para o estudo evolutivo 11. Algumas bactérias são patógenos competentes do D. melanogaster, proliferando em cima de infecção e causando doença host ou morte. Outras bactérias são efectivamente controlado pelo sistema imunitário do hospedeiro e aclarado em poucos dias. Nesta demonstração, Providencia rettgeri vai ser utilizado como um agente patogénico proliferativa que pode causar mortalidade hospedeiro e persiste em sobreviventes hospedeiros. Escherichia coli vai ser utilizado como um agente patogénico que não é eliminado pelo sistema imunitário do hospedeiro. Infecção será estabelecido pela introdução de bactérias directamente para dentro da cavidade do corpo da mosca. Esta abordagem ignora barreiras epiteliais e comportamentos de proteção, permitindo a investigação de infecção sistêmica, independentemente do modo natural de transmissão. Existem dois métodos principais para estabelecer experimentalmente infecção sistêmica. Na primeira, uma nanoinjector capilares de vidro e puxado agulhas são utilizadas para injectar um número exacto debactérias na mosca. Este método tem a vantagem de permitir uma grande gama dinâmica de doses de infecção e de ser quantitativamente altamente repetível. A segunda abordagem é a de proporcionar a infecção com uma picada de agulha séptico. Esta abordagem tem as vantagens de ser rápida e não necessitando de equipamento especial. Uma vez estabelecidas as infecções, torna-se possível medir a carga sistêmica do patógeno, a mortalidade de acolhimento, e atividade do sistema imunológico induzível. É claro, qualquer número de fenótipos adicionais podem concebivelmente ser medidos em D. infectada melanogaster, incluindo pós-infecção fecundidade 12, capacidade de aprendizagem 13, estado metabólico 14, ou virtualmente qualquer outro traço que pode ser imaginado.

<table><tbody><tr><td>Incubator</td><td>Powers Scientific, Inc</td><td>DROS52SD</td><td></td></tr><tr><td>Paintbrush</td><td></td><td></td><td></td></tr><tr><td>CO&lt;sub&gt;2&lt;/sub&gt; Flypads</td><td>FlyStuff</td><td>59-114</td><td></td></tr><tr><td>CO&lt;sub&gt;2&lt;/sub&gt;</td><td>Airgas</td><td>CD FG50</td><td></td></tr><tr><td>Drosophila rearing mix&amp;nbsp;</td><td></td><td></td><td></td></tr><tr><td>6 oz Square Bottom Bottles, polypropylene</td><td>Genesee Scientific</td><td>32-130</td><td></td></tr><tr><td>Nosterile Extra Large Cotton Balls</td><td>Fisher brand</td><td>22-456-882</td><td></td></tr><tr><td>Microscope</td><td>Olympus Corporation</td><td>SZ51</td><td></td></tr><tr><td>Drosophila Vials polystyrene</td><td>VWR international</td><td>89092-720</td><td></td></tr><tr><td>Nosterile Large Cotton Balls</td><td>Fisher brand</td><td>22-456-883</td><td></td></tr><tr><td>2 L flask</td><td>VWR international</td><td>89000-370</td><td></td></tr><tr><td>Petri Dishes with Clear Lids, Raised Ridge; 100 x 15 mm;</td><td>VWR international</td><td>25384-302</td><td></td></tr><tr><td>LB Agar, Miller</td><td>Difco</td><td>244520</td><td></td></tr><tr><td>Innoculing Loop</td><td>VWR international</td><td>80094-488</td><td></td></tr><tr><td>Rainin Clasic Pipettes in various sizes&lt;br/&gt; 0.1 &amp;micro;l to 2 &amp;micro;l,&lt;br/&gt; 2 &amp;micro;l to 20 &amp;micro;l,&lt;br/&gt; 20 &amp;micro;l to 200 &amp;micro;l,&lt;br/&gt; 100 &amp;micro;l to 1,000 &amp;micro;l</td><td>Rainin</td><td>PR-2&lt;br/&gt; PR-20&lt;br/&gt; PR-200&lt;br/&gt; PR-1000</td><td></td></tr><tr><td>Micropipette tips (assorted sizes)</td><td>VWR international</td><td>30128-376&lt;br/&gt; 53503-810&lt;br/&gt; 16466-008</td><td></td></tr><tr><td>Luria Broth Base, Miller</td><td>Difco</td><td>241420</td><td></td></tr><tr><td>Disposable Culture Tubes Borosilicate Glass</td><td>VWR international</td><td>47729-576</td><td></td></tr><tr><td>S-500 Orbital Shaker</td><td>VWR international</td><td>14005-830</td><td></td></tr><tr><td>Centrifuge</td><td>VWR international</td><td>37001-300</td><td></td></tr><tr><td>PBS pH 7.4 10X</td><td>Invitrogen</td><td>70011044</td><td></td></tr><tr><td>SmartSpec 3000 Spectrophotometer</td><td>Bio-Rad</td><td>170-2501</td><td></td></tr><tr><td>Semimicrovolume Cuvettes</td><td>Bio-Rad</td><td>223-9955</td><td></td></tr><tr><td>Vertical Capillary Puller</td><td>Kopf Needle Pipette Puller</td><td></td><td></td></tr><tr><td>3.5&#039;&#039; Replacement glass Capillaries for Nanojet II</td><td>Drummond Sientific Company</td><td>3-000-203-G/X</td><td></td></tr><tr><td>Nanoject II</td><td>Drummond Sientific Company</td><td>3-000-204</td><td></td></tr><tr><td>Forceps</td><td>Fine Science Tools</td><td>11255-20</td><td></td></tr><tr><td>10 ml Syringe</td><td>BD</td><td>309604</td><td></td></tr><tr><td>Mineral Oil, White, light</td><td>Macron Fine Chemicals</td><td>6358-10</td><td></td></tr><tr><td>Minutein pins</td><td>Fine Science Tools</td><td>26002-10</td><td></td></tr><tr><td>1.5 ml&amp;nbsp; Microcentrifuge tubes; Seal Rite</td><td>USA Scientific Inc.</td><td>1615-5500</td><td></td></tr><tr><td>Motorized Pestle; Talboys Laboratory Stirrer</td><td>Troemner</td><td>103</td><td></td></tr><tr><td>Talboys High Throughput Homogenizer</td><td>OPS Diagnostics</td><td>930145</td><td></td></tr><tr><td>5/32&#039;&#039; Grinding Balls</td><td>OPS Diagnostics</td><td>GBSS 156-5000-01</td><td></td></tr><tr><td>Vortex Genie</td><td>Scientific indurstries inc.</td><td>G560</td><td></td></tr><tr><td>Multichannel Pipettor (10 &amp;mu;l - 300 &amp;mu;l)</td><td>Sartorius</td><td>730360</td><td></td></tr><tr><td>WASP2 Whitley Automated Spiral Plater</td><td>Microbiology International</td><td></td><td></td></tr><tr><td>ProtoCOL automated colony counter / plate counter/ plate reader&amp;nbsp;</td><td>Microbiology International</td><td></td><td></td></tr><tr><td>TRIzol</td><td>Life Technologies</td><td>15596-026</td><td></td></tr><tr><td>qPCR tubes; Low-Profile 0.2 ml 8-Tube Strips</td><td>Bio-Rad</td><td>TLS0801</td><td></td></tr><tr><td>qPCR caps; Optical Flat 8-Cap Strips</td><td>Bio-Rad</td><td>TCS0803</td><td></td></tr><tr><td>RQ1 RNase-Free DNase</td><td>Promega</td><td>m610a</td><td></td></tr><tr><td>M-MLV Reverse Transcriptase</td><td>Promega</td><td>m170b</td><td></td></tr><tr><td>dNTPs</td><td>Promega</td><td>U1240</td><td></td></tr><tr><td>Oligo-dT</td><td>IDT</td><td></td><td></td></tr><tr><td>&amp;nbsp;SsoAdvanced SYBR Green Supermix</td><td>Bio-Rad</td><td>172-5260</td><td></td></tr><tr><td>CFX Connect Real-Time PCR Detection System</td><td>Bio-Rad</td><td>185-5200</td><td></td></tr><tr><td>RNasin Ribonuclease Inhibitor</td><td>Promega</td><td>N2115</td><td></td></tr></tbody></table>

systemic bacterial infection and immune defense phenotypes in drosophila melanogaster

A mosca da fruta Drosophila melanogaster é um dos organismos modelo premier para estudar a função e evolução de defesa imunológica. Muitos aspectos da imunidade inata são conservadas entre insectos e mamíferos, e uma vez que a Drosophila pode ser facilmente manipulado geneticamente e experimentalmente, que são poderosos para estudar a função do sistema imunitário e as consequências fisiológicas da doença. O processo demonstrado aqui permite a infecção de moscas através da introdução de bactérias directamente na cavidade do corpo, contornando barreiras epiteliais e formas mais passivas de defesa e permitindo que o foco sobre a infecção sistémica. O procedimento inclui protocolos para medir as taxas de mortalidade de acolhimento, carga patógeno sistémica, e grau de indução do sistema imunitário do hospedeiro. Este procedimento de infecção é barato, robusto e quantitativamente reprodutível, e pode ser utilizado em estudos de genética funcional, história de vida evolucionária, e fisiologia.

Esta secção ilustra os resultados que podem ser obtidos após a infecção bacteriana de Drosophila melanogaster. A Figura 1 mostra que a dose de infecção varia com a densidade óptica da suspensão bacteriana utilizada para a injecção, e que a dose administrada pode ser estimado de forma fiável por homogeneização e revestimento voa imediatamente após a injecção . Tal como ilustrado na Figura 2, diferentes agentes patogénicos podem causar diferentes níveis de mortalidade de acolhimento (Figura 2A) e de mortalidade hospedeira pode ser (Figura 2B), dependente da dose. Importante, este protocolo permite que diferentes tipos de infecções a atingir: Providencia rettgeri pode causar uma infecção crónica, sub-letal que persiste durante 20 dias ou mais (Figura 3A). No entanto, outras bactérias como Escerichia coli vai ser maioritariamente apuradas pela mosca acolhimento no prazo de seis horas após a infecção (Figura 3B). A indução dos sys imunesTEM pode ser estimado através do isolamento de ARN e subsequente qRT-PCR de transcritos de péptidos antibacterianos (Figura 4A e B). De forma análoga, mas menos quantitativamente, moscas expressando GFP sob o controlo de promotores de gene de um péptido antimicrobiano pode ser utilizado para visualizar a indução do sistema imunitário (Figura 4C). <img alt="Figura 1" src="/files/ftp_upload/52613/52613fig1.jpg" /> . Figura 1: Determinação Dose Infecciosa Moscas foram injectados com 50 nl de suspensões bacterianas que cobrem uma gama de densidades ópticas (,0001-,05). As moscas foram imediatamente homogeneizados e plaqueados para determinar o número de bactérias introduzidas por injecção. A carga bacteriana inicial se correlaciona fortemente com o OD inicial injectado (r 2 = 0,96) <img alt="Figura 2" src="/files/ftp_upload/52613/52613fig2.jpg" /> <strong&gt; Figura 2:. A sobrevida após injeção com bacterianas Pathogens Cinco a sete dias homens de idade foram injectados com 50 nl de qualquer suspensão bacteriana ou meios estéreis e monitorados para a sobrevivência. (A), as moscas de tipo selvagem foram injetados com aproximadamente 5.000 bactérias a partir de uma das três espécies diferentes. A taxa de mortalidade do hospedeiro depende fortemente das espécies bacterianas utilizadas para a infecção. (B) Tipo Selvagem moscas foram injectados com três doses diferentes de Enterococcous faecalis - 50, 500, e 5.000 bactérias por mosca. Moscas morrem mais rapidamente quando infectados com doses superiores infecciosas (C) Um mutante sistema imunológico e sua linha de controle isogênica de tipo selvagem foram injetados com aproximadamente 500 Burkholderia cepacia. Uma comparação aos pares de Log-Rank mostra que o de tipo selvagem mosca sobrevive à infecção significativamente melhor do que o mutante (χ 2 = 59,02, df = 1, p &lt;0,0001). Figura 3:. A carga bacteriana após injeção moscas foram injectados com aproximadamente (a) 5000 P. rettgeri (B) 3400 E. coli. A carga bacteriana foi determinada imediatamente após a injecção e em vários pontos de tempo subsequentes. Cada ponto de dados representa a carga bacteriana de uma única mosca. E. coli é rapidamente eliminado do anfitriões desafiados enquanto P. rettgeri persistir para o resto da vida do hospedeiro ,. <img alt="Figura 4" src="/files/ftp_upload/52613/52613fig4.jpg" /> Figura 4: Indução de Expressão Gênica imune após a injeção. (A) As moscas foram injectados com 50 nl de P. PBS rettgeri ou estéril tanto no abdómen ou tórax, ou foram deixados de lado unmanipulated de CO <sub&gt; 2 anestesia. Seis horas após a infecção, as moscas foram recolhidas para isolamento de ARN e a expressão do Diptericin Um gene foi determinada por meio de qRT-PCR. (A) Os níveis de expressão são representados graficamente como a razão entre Diptericin A transcrição de rp49 transcrição e dimensionado de tal modo que o controlo de CO 2 é definida como possuindo um nível de expressão 1. As barras representam a média e o erro padrão de rácios de cada condição (n = 4). Níveis (B) de expressão são representadas graficamente como um ΔΔCT 2 com o valor de C T média de CO 2 aesthesia moscas de controle usados ​​como a condição não induzida padrão. As barras representam o erro médio e padrão da ΔΔC T a partir de cada condição (n = 4). Embora não exista uma diferença na indução da transcrição devido ao local de injecção, a comparação dos painéis A e B mostra como o método ΔΔC T pode potencialmente sobrestimar os níveis de indução. (C) Moscas que expressa GFP sob o controle do promotor Diptericin A foram injectados com 50 nl de P. rettgeri (OD = 0,1) e em seguida trabalhada 7 dias mais tarde. O painel GFP mostra a expressão de GFP no corpo de gordura abdominal de moscas infectadas, indicando ativação do Diptericin Um promotor em moscas infectadas por bactérias, mas não controles injecção de mídia. <table border="0" cellpadding="0" cellspacing="0"><tbody><tr><td> Gene </td><td> Para a frente </td><td> Reversa </td></tr><tr><td> rp49 (também chamado rpL32) </td><td> 5 &#39;AGGCCCAAGATCGTGAAGAA 3&#39; </td><td> 5 &#39;GACGCACTCTGTTGTCGATACC 3&#39; </td></tr><tr><td> A Diptericin </td><td> 5 &#39;GCGGCGATGGTTTTGG 3&#39; </td><td> 5 &#39;CGCTGGTCCACACCTTCTG 3&#39; </td></tr><tr><td> Drosomycin </td><td> 5 &#39;CTGCCTGTCCGGAAGATACAA 3 &#39; </td><td> 5 &#39;TCCCTCCTCCTTGCACACA 3&#39; </td></tr><tr><td> Defensina </td><td> 5 &#39;GAGGATCATGTCCTGGTGCAT 3&#39; </td><td> 5 &#39;TCGCTTCTGGCGGCTATG 3&#39; </td></tr><tr><td> A atacina </td><td> 5 &#39;CGTTTGGATCTGACCAAGG 3&#39; </td><td> 5 &#39;AAAGTTCCGCCAGGTGTGAC 3&#39; </td></tr><tr><td> Metchnikowan </td><td> 5 &#39;AACTTAATCTTGGAGCGATTTTTCTG 3&#39; </td><td> 5 &#39;ACGGCCTCGTATCGAAAATG 3&#39; </td></tr></tbody></table> Tabela 1: Iniciadores de qRT-PCR.

Watch this Scientific Journal Video about Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster at JoVE.com

Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster

Drosophila melanogaster is an outstanding model organism for studying innate immune systems and the physiological consequences of infection and disease. This protocol describes how to deliver robust and quantitatively repeatable bacterial infections to D. melanogaster, and how to subsequently measure infection severity and quantify the host immune response.

Infecção bacteriana sistêmica e Imune Defesa Phenotypes em<em&gt; Drosophila melanogaster</em

The fruit fly Drosophila melanogaster is one of the premier model organisms for studying the function and evolution of immune defense. Many aspects of ...

systemic-bacterial-infection-immune-defense-phenotypes-drosophila

Research

JoVE Journal

Immunology and Infection

Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster

24.5K visualizações.  Cornell University. Drosophila melanogaster is an outstanding model organism for studying innate immune systems and the physiological consequences of infection and disease. This protocol describes how to deliver robust and quantitatively repeatable bacterial infections to D. melanogaster, and how to subsequently measure infection severity and quantify the host immune response.

Vídeo: Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. 1A-C), females of the genus Leptopilina (Fig. 1D, 1F, 1G) and Ganaspis (Fig. 1E) attack the larval stages. We use these parasites to study the molecular basis of a biological arms race. Parasitic wasps have tremendous value as biocontrol agents. Most of them carry virulence and other factors that modify host physiology and immunity. Analysis of Drosophila wasps is providing insights into how species-specific interactions shape the genetic structures of natural communities. These studies also serve as a model for understanding the hosts' immune physiology and how coordinated immune reactions are thwarted by this class of parasites.
The larval/pupal cuticle serves as the first line of defense. The wasp ovipositor is a sharp needle-like structure that efficiently delivers eggs into the host hemocoel. Oviposition is followed by a wound healing reaction at the cuticle (Fig. 1C, arrowheads). Some wasps can insert two or more eggs into the same host, although the development of only one egg succeeds. Supernumerary eggs or developing larvae are eliminated by a process that is not yet understood. These wasps are therefore referred to as solitary parasitoids.
Depending on the fly strain and the wasp species, the wasp egg has one of two fates. It is either encapsulated, so that its development is blocked (host emerges; Fig. 2 left); or the wasp egg hatches, develops, molts, and grows into an adult (wasp emerges; Fig. 2 right). L. heterotoma is one of the best-studied species of Drosophila parasitic wasps. It is a "generalist," which means that it can utilize most Drosophila species as hosts1. L. heterotoma and L. victoriae are sister species and they produce virus-like particles that actively interfere with the encapsulation response2. Unlike L. heterotoma, L. boulardi is a specialist parasite and the range of Drosophila species it utilizes is relatively limited1. Strains of L. boulardi also produce virus-like particles3 although they differ significantly in their ability to succeed on D. melanogaster1. Some of these L. boulardi strains are difficult to grow on D. melanogaster1 as the fly host frequently succeeds in encapsulating their eggs. Thus, it is important to have the knowledge of both partners in specific experimental protocols.
In addition to barrier tissues (cuticle, gut and trachea), Drosophila larvae have systemic cellular and humoral immune responses that arise from functions of blood cells and the fat body, respectively. Oviposition by L. boulardi activates both immune arms1,4. Blood cells are found in circulation, in sessile populations under the segmented cuticle, and in the lymph gland. The lymph gland is a small hematopoietic organ on the dorsal side of the larva. Clusters of hematopoietic cells, called lobes, are arranged segmentally in pairs along the dorsal vessel that runs along the anterior-posterior axis of the animal (Fig. 3A). The fat body is a large multifunctional organ (Fig. 3B). It secretes antimicrobial peptides in response to microbial and metazoan infections.
Wasp infection activates immune signaling (Fig. 4)4. At the cellular level, it triggers division and differentiation of blood cells. In self defense, aggregates and capsules develop in the hemocoel of infected animals (Fig. 5)5,6. Activated blood cells migrate toward the wasp egg (or wasp larva) and begin to form a capsule around it (Fig. 5A-F). Some blood cells aggregate to form nodules (Fig. 5G-H). Careful analysis reveals that wasp infection induces the anterior-most lymph gland lobes to disperse at their peripheries (Fig. 6C, D).
We present representative data with Toll signal transduction pathway components Dorsal and Sp&auml;tzle (Figs. 4,5,7), and its target Drosomycin (Fig. 6), to illustrate how specific changes in the lymph gland and hemocoel can be studied after wasp infection. The dissection protocols described here also yield the wasp eggs (or developing stages of wasps) from the host hemolymph (Fig. 8).

An Introduction to Parasitic Wasps of Drosophila and the Antiparasite Immune Response

Parasitoid (parasitic) wasps constitute a major class of natural enemies of many insects including Drosophila melanogaster. We will introduce the techniques to propagate these parasites in Drosophila spp. and demonstrate how to analyze their effects on immune tissues of Drosophila larvae.

Uma Introdução à Vespas parasitas de<em&gt; Drosophila</em&gt; E Resposta Imune a antiparasitários

Most known parasitoid wasp species attack the larval or pupal stages of Drosophila. While Trichopria drosophilae infect the pupal stages of the host (Fig. ...

Imunologia e Infecção

Rearing the Fruit Fly Drosophila melanogaster Under Axenic and Gnotobiotic Conditions

The influence of microbes on myriad animal traits and behaviors has been increasingly recognized in recent years. The fruit fly Drosophila melanogaster is a model for understanding microbial interactions with animal hosts, facilitated by approaches to rear large sample sizes of Drosophila under microorganism-free (axenic) conditions, or with defined microbial communities (gnotobiotic). This work outlines a method for collection of Drosophila embryos, hypochlorite dechorionation and sterilization, and transfer to sterile diet. Sterilized embryos are transferred to sterile diet in 50 ml centrifuge tubes, and developing larvae and adults remain free of any exogenous microbes until the vials are opened. Alternatively, flies with a defined microbiota can be reared by inoculating sterile diet and embryos with microbial species of interest. We describe the introduction of 4 bacterial species to establish a representative gnotobiotic microbiota in Drosophila. Finally, we describe approaches for confirming bacterial community composition, including testing if axenic Drosophila remain bacteria-free into adulthood.

Rearing the Fruit Fly Drosophila melanogaster Under Axenic and Gnotobiotic Conditions

A method for rearing Drosophila melanogaster under axenic and gnotobiotic conditions is presented. Fly embryos are dechorionated in sodium hypochlorite, transferred aseptically to sterile diet, and reared in closed containers. Inoculating diet and embryos with bacteria leads to gnotobiotic associations, and bacterial presence is confirmed by plating whole-body Drosophila homogenates.

Elevando a mosca da fruta<em&gt; Drosophila melanogaster</em&gt; Sob axênicas e gnotobióticos Condições

The influence of microbes on myriad animal traits and behaviors has been increasingly recognized in recent years. The fruit fly Drosophila melanogaster is ...

Biologia do Desenvolvimento

Quantitative Measurement of the Immune Response and Sleep in Drosophila

A complex interaction between the immune response and host behavior has been described in a wide range of species. Excess sleep, in particular, is known to occur as a response to infection in mammals 1 and has also recently been described in Drosophila melanogaster2. It is generally accepted that sleep is beneficial to the host during an infection and that it is important for the maintenance of a robust immune system3,4. However, experimental evidence that supports this hypothesis is limited4, and the function of excess sleep during an immune response remains unclear. We have used a multidisciplinary approach to address this complex problem, and have conducted studies in the simple genetic model system, the fruitfly Drosophila melanogaster. We use a standard assay for measuring locomotor behavior and sleep in flies, and demonstrate how this assay is used to measure behavior in flies infected with a pathogenic strain of bacteria. This assay is also useful for monitoring the duration of survival in individual flies during an infection. Additional measures of immune function include the ability of flies to clear an infection and the activation of NF&kappa;B, a key transcription factor that is central to the innate immune response in Drosophila. Both survival outcome and bacterial clearance during infection together are indicators of resistance and tolerance to infection. Resistance refers to the ability of flies to clear an infection, while tolerance is defined as the ability of the host to limit damage from an infection and thereby survive despite high levels of pathogen within the system5. Real-time monitoring of NF&kappa;B activity during infection provides insight into a molecular mechanism of survival during infection. The use of Drosophila in these straightforward assays facilitates the genetic and molecular analyses of sleep and the immune response and how these two complex systems are reciprocally influenced.

Quantitative Measurement of the Immune Response and Sleep in Drosophila

To understand a link between the immune response and behavior, we describe a method to measure locomotor behavior in Drosophila during bacterial infection as well as the ability of flies to mount an immune response by monitoring survival, bacterial load, and real-time activity of a key regulator of innate immunity, NF&kappa;B.

Medição quantitativa da resposta imune e do sono em<em&gt; Drosophila</em

A complex interaction between the immune response and  host behavior has been described in a wide range of species. Excess sleep, in  particular, is known ...

Extraction of Hemocytes from Drosophila melanogaster Larvae for Microbial Infection and Analysis

During the pathogenic infection of Drosophila melanogaster, hemocytes play an important role in the immune response throughout the infection. Thus, the goal of this protocol is to develop a method to visualize the pathogen invasion in a specific immune compartment of flies, namely hemocytes. Using the method presented here, up to 3 &#215; 106 live hemocytes can be obtained from 200 Drosophila 3rd instar larvae in 30 min for ex vivo infection. Alternatively, hemocytes can be infected in vivo through injection of 3rd instar larvae followed by hemocyte extraction up to 24 h post-infection. These infected primary cells were fixed, stained, and imaged using confocal microscopy. Then, 3D representations were generated from the images to definitively show pathogen invasion. Additionally, high-quality RNA for qRT-PCR can be obtained for the detection of pathogen mRNA following infection, and sufficient protein can be extracted from these cells for Western blot analysis. Taken together, we present a method for definite reconciliation of pathogen invasion and confirmation of infection using bacterial and viral pathogen types and an efficient method for hemocyte extraction to obtain enough live hemocytes from Drosophila larvae for ex vivo and in vivo infection experiments.

Extraction of Hemocytes from Drosophila melanogaster Larvae for Microbial Infection and Analysis

This method demonstrates how to visualize pathogen invasion into insect cells with three-dimensional (3D) models. Hemocytes from Drosophila larvae were infected with viral or bacterial pathogens, either ex vivo or in vivo. Infected hemocytes were then fixed and stained for imaging with a confocal microscope and subsequent 3D cellular reconstruction.

Extração de hemócitos de larvas de Drosophila melanogaster para infecção microbiana e análise

During the pathogenic infection of Drosophila melanogaster, hemocytes play an important role in the immune response throughout the infection. Thus, the ...

Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster

Virus spreading is a major cause of epidemic diseases. Thus, understanding the interaction between the virus and the host is very important to extend our knowledge of prevention and treatment of viral infection. The fruit fly Drosophila melanogaster has proven to be one of the most efficient and productive model organisms to screen for antiviral factors and investigate virus-host interaction, due to powerful genetic tools and highly conserved innate immune signaling pathways. The procedure described here demonstrates a nano-injection method to establish viral infection and induce systemic antiviral responses in adult flies. The precise control of the viral injection dose in this method enables high experimental reproducibility. Protocols described in this study include the preparation of flies and the virus, the injection method, survival rate analysis, the virus load measurement, and an antiviral pathway assessment. The influence effects of viral infection by the flies' background were mentioned here. This infection method is easy to perform and quantitatively repeatable; it can be applied to screen for host/viral factors involved in virus-host interaction and to dissect the crosstalk between innate immune signaling and other biological pathways in response to viral infection.

Establishment of Viral Infection and Analysis of Host-Virus Interaction in Drosophila Melanogaster

This protocol describes how to establish viral infection in vivo in Drosophila melanogaster using the nano-injection method and basic techniques to analyze virus-host interaction.

Estabelecimento de infecção Viral e análise da interação vírus-hospedeiro em Drosophila Melanogaster.

Virus spreading is a major cause of epidemic diseases. Thus, understanding the interaction between the virus and the host is very important to extend our ...

Assessing the Cellular Immune Response of the Fruit Fly, Drosophila melanogaster, Using an In Vivo Phagocytosis Assay

In all animals, innate immunity provides an immediate and robust defense against a broad spectrum of pathogens. Humoral and cellular immune responses are the main branches of innate immunity, and many of the factors regulating these responses are evolutionarily conserved between invertebrates and mammals. Phagocytosis, the central component of cellular innate immunity, is carried out by specialized blood cells of the immune system. The fruit fly, Drosophila melanogaster, has emerged as a powerful genetic model to investigate the molecular mechanisms and physiological impacts of phagocytosis in whole animals. Here we demonstrate an injection-based in vivo phagocytosis assay to quantify the particle uptake and destruction by Drosophila blood cells, hemocytes. The procedure allows researchers to precisely control the particle concentration and dose, making it possible to obtain highly reproducible results in a short amount of time. The experiment is quantitative, easy to perform, and can be applied to screen for host factors that influence pathogen recognition, uptake, and clearance.

Assessing the Cellular Immune Response of the Fruit Fly, Drosophila melanogaster, Using an In Vivo Phagocytosis Assay

This protocol describes an in vivo phagocytosis assay in adult Drosophila melanogaster to quantify phagocyte recognition and clearance of microbial infections.

Avaliar a resposta imune celular de mosca da fruta, Drosophila melanogaster, usando um ensaio de fagocitose em Vivo

In all animals, innate immunity provides an immediate and robust defense against a broad spectrum of pathogens. Humoral and cellular immune responses are ...

Drosophila melanogaster Larva Injection Protocol

The use of unconventional models to study innate immunity and pathogen virulence provides a valuable alternative to mammalian models, which can be costly and raise ethical issues. Unconventional models are notoriously cheap, easy to handle and culture, and do not take much space. They are genetically amenable and possess complete genome sequences, and their use presents no ethical considerations. The fruit fly Drosophila melanogaster, for instance, has provided great insights into a variety of behavior, development, metabolism, and immunity research. More specifically, D. melanogaster adult flies and larvae possess several innate defense reactions that are shared with vertebrate animals. The mechanisms regulating immune responses have been mostly revealed through genetic and molecular studies in the D. melanogaster model. Here a novel larval injection technique is provided, which will further promote investigations of innate immune processes in D. melanogaster larvae and explore the pathogenesis of a wide range of microbial infections.

Drosophila melanogaster Larva Injection Protocol

Drosophila melanogaster adult flies have been extensively utilized as model organisms to investigate the molecular mechanisms underlying host antimicrobial innate immune responses and microbial infection strategies. To promote the D. melanogaster larva stage as an additional or alternative model system, a larval injection technique is described.

Melanogaster drosophila Protocolo de injeção de larvas

The use of unconventional models to study innate immunity and pathogen virulence provides a valuable alternative to mammalian models, which can be costly ...

Oral Bacterial Infection and Shedding in Drosophila melanogaster

The fruit fly Drosophila melanogaster is one of the best developed model systems of infection and innate immunity. While most work has focused on systemic infections, there has been a recent increase of interest in the mechanisms of gut immunocompetence to pathogens, which require methods to orally infect flies. Here we present a protocol to orally expose individual flies to an opportunistic bacterial pathogen (Pseudomonas aeruginosa) and a natural bacterial pathogen of D. melanogaster (Pseudomonas entomophila). The goal of this protocol is to provide a robust method to expose male and female flies to these pathogens. We provide representative results showing survival phenotypes, microbe loads, and bacterial shedding, which is relevant for the study of heterogeneity in pathogen transmission. Finally, we confirm that Dcy mutants (lacking the protective peritrophic matrix in the gut epithelium) and Relish mutants (lacking a functional immune deficiency (IMD) pathway), show increased susceptibility to bacterial oral infection. This protocol, therefore, describes a robust method to infect flies using the oral route of infection, which can be extended to the study of a variety genetic and environmental sources of variation in gut infection outcomes and bacterial transmission.

Oral Bacterial Infection and Shedding in Drosophila melanogaster

This protocol describes methods to orally expose and infect the fruit fly Drosophila melanogaster with bacterial pathogens, and to measure the number of infectious bacteria shed following gut infection. We further describe the effect of immune mutants on fly survival following oral bacterial infection.

Infecção bacteriana e oral Shedding em Drosophila melanogaster.

The fruit fly Drosophila melanogaster is one of the best developed model systems of infection and innate immunity. While most work has focused on systemic ...

Biologia

Assessing the Age-Specific Phagocytic Ability of Adult Drosophila melanogaster Hemocytes using an In Vivo Phagocytosis Assay

Phagocytosis is an essential function of the innate immune response. This process is carried out by phagocytic hemocytes whose primary function is to recognize a wide range of particles and destroy microbial pathogens. As organisms age, this process begins to decline, yet little is known about the underlying mechanisms or the genetic basis of immunosenescence. Here, an injection based in vivo phagocytosis assay is used to assess age related changes in different aspects of phagocytosis, such as binding, engulfment, and degradation of internalized particles, by quantifying phagocytic events in hemocytes in adult Drosophila. Drosophila melanogaster has become an ideal model to investigate age related changes in innate immune function for many reasons. For one, many genetic components and functions of the innate immune response, including phagocytosis, are evolutionarily conserved between Drosophila and mammals. Because of that, results obtained from using this protocol are likely to be widely relevant to understanding the age related changes in immune function in a variety of organisms. Additionally, we note that this method provides quantitative estimates of hemocyte phagocytic ability, which could be useful for a variety of research topics, and need not be limited to studies of aging.

Assessing the Age-Specific Phagocytic Ability of Adult Drosophila melanogaster Hemocytes using an In Vivo Phagocytosis Assay

This protocol describes an in vivo assay of phagocytosis used to assess and quantify the ability of young and aged Drosophila melanogaster hemocytes to phagocytose bacteria.

Avaliando a Habilidade Fagocítica Específica da Idade dos Hemócitos de Melanogaster Drosophila Adulto usando um Ensaio de Faagocitose In Vivo

Phagocytosis is an essential function of the innate immune response. This process is carried out by phagocytic hemocytes whose primary function is to ...

Infecting Flies with Bacterial Suspension Using a Nanoinjector

Source: Khalil, S. et al., <a href="https://app.jove.com/v/52613">Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster.</a>&#160;J. Vis. Exp.&#160; (2015)
This video demonstrates the nano-injection of bacterial suspension into the fly body cavity, resulting in bacterial multiplication and infection. The fly&#39;s immune response clears some bacteria, while others escape immune clearance and survive within the host causing an infection.

Infectando moscas com suspensão bacteriana usando um nanoinjetor

Source: Khalil, S. et al., Systemic Bacterial Infection and Immune Defense Phenotypes in Drosophila Melanogaster.&#160;J. Vis. Exp.&#160; (2015)
This ...

Infecção bacteriana sistêmica e Imune Defesa Phenotypes em

Resumo

Explore mais vídeos

Capítulos neste vídeo

Uma Introdução à Vespas parasitas de

Elevando a mosca da fruta

Medição quantitativa da resposta imune e do sono em