Name: determination of sialic acids in liver and milk samples of wild-type and cmah knock-out mice.
Uploaded: 2017-07-14T15:00:00.000+00:00
Duration: 8 min 4 s
Description: Watch this Scientific Journal Video about Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice. at JoVE.com

Este trabalho foi apoiado em parte pela Fundação de Ciências Naturais da China (números de subvenção 31471703, A0201300537 e 31671854 para JV e LL) e o Plano de 100 Estratos Estrangeiros (número de concessão JSB2014012 a JV).

Os procedimentos envolvendo assuntos de animais foram aprovados pelo Comitê de Ética do Centro de Animal Experimental da Universidade Agrícola de Nanjing de acordo com as Diretrizes Nacionais para o Bem-estar Animal Experimental (Ministério da Ciência e Tecnologia, PR da China, 2006) com os animais alojados em um SPF Facilidade (ID de permissão: SYXK-J-2011-0037). 1. Cmah Knock-out Mouse Model <ol><li> Use ratinhos C57Bl / 6 de tipo selvagem do Centro de Medicina Comparada da Universidade de Yangzhou (China). NOTA: Os ratos Cmah knock-out foram gerados com base na informação fornecida pelos estudos anteriores 17 , 19 da Cmah e obtidos comercialmente usando uma estratégia CRISPR / Cas9 20 , removendo 92 pares de bases do exão 6 do gene Cmah , o que também é Eliminado no gene CMAH humano 19 . Positivo F 0 &lt;/ Sub&gt; -mice (2 indivíduos) foram cruzados com camundongos de tipo selvagem para obter ratazana F 1 heterozigótica. Depois de atravessar um heterozigoto F -mice (5 pessoas), homozigica CMAH knock-out F 2 -mice poderia ser obtida com sucesso (3 indivíduos). </li><li> Execute genotipagem de camundongos usando DNA genômico de acordo com o método demonstrado por Zangala 21 usando um kit comercial de purificação de DNA. <ol><li> Amplificar um fragmento de DNA correspondente do gene Cmah usando DNA polimerase comercial e o par de iniciadores 5&#39;gaaagggctcggctctgtatgaa3 &#39;e 5&#39;tttaaaatgtcccgggtgagaagc3&#39;. Execute a amplificação do gene utilizando 34 ciclos de PCR consistindo em desnaturação a 94 ° C durante 40 s, recozimento a 63 ° C durante 40 s e alongamento a 72 ° C durante 1 min. </li><li> Visualize produtos de PCR em um gel de agarose a 1%. Deve observar uma única banda (0,5 kb) para o indivíduo de tipo selvagem, uma banda dupla (0,4 e 0,5 kb) para aIndivíduo knock-out heterocigótico, e uma única banda (0.4 kb) para o indivíduo homozigoto knock-out. </li></ol></li></ol> 2. Coleção de Amostras <ol><li> Coletar leite de rato usando o protocolo descrito por Willingham et al. 22 . </li><li> Coletar o tecido hepático do mouse usando o protocolo descrito por Gonçalves et al. 23 e armazene amostras a -80 ° C. </li></ol> 3. Isolamento de ácidos sialic do leite <ol><li> Prepare 100 mL de uma solução de ácido acético 2 M adicionando 12 mL de ácido acético glacial em 88 mL de H 2 O destilado. </li><li> Transfira 50 μL de leite para um tubo de centrífuga de 1,5 mL e adicione 1,2 ml da solução aquosa preparada de ácido acético. </li><li> Incubar a suspensão durante 4 h a 80 ° C e centrifugar a amostra a 14 000 xg durante 10 min. </li><li> Transfira os 1.000 μL superiores do sobrenadante para um novo tubo de centrifugação de 1,5 mL e remO solvente por evaporação centrífuga à temperatura ambiente para completar a secura (dependendo da bomba de vácuo anexada, isso levará de 4 a 20 h). Re-dissolver a amostra em 500 μL de H 2 O destilado. </li><li> Prepare uma coluna de troca de anião-anião. Este passo irá enriquecer especificamente compostos aniônicos e remover compostos catiônicos e neutros das amostras de leite e fígado e, portanto, aumenta a seletividade do agente de rotulagem OPD fluorogênico para a derivação do ácido siálico. <ol><li> Transferir para cada amostra 200 mg da resina de permuta aniónica (Dowex 1X8) em tubos de coluna de 3 mL vazios com uma torneira de ligação anexada. </li><li> Adicionar 2 mL da solução aquosa de ácido acético preparada no passo 3.1 para substituir os iões cloreto na resina com íons acetato. Feche a torneira assim que o solvente atingir o topo da resina. </li><li> Adicione gentilmente 2 mL de H 2 O destilado, abra a torneira e pare o fluxo assim que a maior parte do solvente atingirO topo da resina. Certifique-se de que a resina esteja sempre coberta com solvente. </li><li> Lave a coluna de resina duas vezes mais com 2 mL de H 2 O destilado para remover o excesso de acetato. </li></ol></li><li> Transfira os 500 μL resultantes de solvente da amostra a partir do passo 3.4. Na coluna de resina e descarte o fluxo. Com cuidado, lavar a resina com 2 ml de H2O destilada Eluir os aniões de amostra a partir da resina utilizando 1 mL de uma solução de acetato de amónio 50 mM (386 mg de acetato de amónio dissolvido em 100 mL de H2O destilada) em um 1,5 mL Tubo de centrífuga. Remova o solvente por evaporação centrífuga à temperatura ambiente até à secura. NOTA: As amostras secas podem ser armazenadas a 4-6 ° C por até 12 meses. </li></ol> 4. Isolamento de ácidos sialic a partir de tecido de fígado <ol><li> Descongelar suavemente 20 - 50 mg de fígado de rato e transferi-lo para um moedor de tecido Dounce (1 mL ou 2 mL de volume). Adicionar 1,2 ml da solução aquosa de ácido acéticoPreparado no passo 3.1 e homogeneizar o tecido por um corte suave durante 10 s. Transfira a suspensão resultante para um tubo de centrifugação de 1,5 mL. </li><li> Siga as etapas 3.3. Para 3.6. NOTA: As amostras secas podem ser armazenadas a 4-6 ° C por até 12 meses. </li></ol> 5. Preparação de um padrão de ácido siálico misto <ol><li> Pesar entre 5 e 8 mg de ácido N-acetilneuramínico em um balanço analítico em um tubo de centrífuga de 1,5 mL. Observe o peso exato e adicione 164 μL de H 2 O destilado por cada mg ( ou seja, se o peso de Neu5Ac for 7.2 mg, então adicione 7.2 x 164 = 1, 181 μL de H 2 O destilado). Isso resulta em uma solução de estoque Neu5Ac 20 mM que pode ser armazenada a -20 ° C por até 12 meses. </li><li> Obter ácido N-glicolneuraminico em quantidades menores a um preço moderado, tal como em alíquotas de 1 mg. Adicionar 154 μL de H 2 O destilado diretamente ao composto para obter uma solução de reserva de Neu5Gc ~ 20 mM. Transfira oSolução em um tubo de centrífuga de 1,5 mL. Esta solução pode ser armazenada a -20 ° C por até 12 meses. </li><li> Combine 5 μL de cada solução de base do passo 5.1 e 5.2 em um tubo de centrífuga fresco de 1,5 mL e remova o solvente por evaporação centrífuga à temperatura ambiente até à secura. NOTA: O padrão de ácido sialico misto pode ser armazenado a 4 - 6 ° C por até 12 meses. </li></ol> 6. Fluorescência Derivação de Ácidos Sialicos <ol><li> Prepare 10 mL de solução de OPD, consistindo em 100 mg de o-fenilenodiamina e 208 mg de hidrogeno sulfito de sódio em 10 mL de H 2 O destilada. </li><li> Adicione 20 μL de solução de OPD às amostras de ácido siálico derivadas de leite de rato (passo 3), fígado de rato (passo 4) ou padrão de ácido sialico misto (passo 5). Vortex vigorosamente por 30 s e incubar as amostras durante 4 h a 80 ° C no escuro ( ou seja, envolva os microtubos na folha de alumínio). </li><li> Deixe as amostras esfriarem por 5 min, adicione 80 μ; L de H 2 O destilada e centrifugar os tubos a 14 000 xg durante 1 min. </li><li> Transferir 80 μL do sobrenadante para um frasco de HPLC de alta recuperação de 300 μL. As amostras de ácido siálico derivadas podem ser armazenadas a 4 - 6 ° C por até uma semana. </li></ol> 7. Análise HPLC de Derivados de Ácido Sialico <ol><li> Analise as amostras usando um sistema HPLC padrão conectado a um detector de fluorescência online. </li><li> Use uma coluna de fase C18 com as dimensões padrão de 250 mm de comprimento e 4,6 mm de diâmetro para a análise. </li><li> Prepare o solvente A diluindo 200 mL de solução de reserva com 800 mL de água com LCMS (LCMS - cromatografia líquida em massa de espectrometria). A própria solução-mãe pode ser preparada da seguinte forma: <ol><li> Adicionar 46 g de ácido fórmico a 800 mL de LCMS-classe de H 2 O. </li><li> Ajustar o pH a 4,5, adicionando gota a gota solução de hidróxido de amônio (pur. Pa). </li><li> Transfira o solvente para umCilindro de medição e preencha até 1.000 mL com H 2 O de grau LCMS. Esta solução pode ser armazenada entre 4 e 6 ° C por até 3 meses. </li></ol></li><li> Para o solvente B, use acetonitrilo de grau LCMS. </li><li> Separar os derivados de ácidos siálicos a uma taxa de fluxo de 1 mL / min com a seguinte eluição gradiente: <ol><li> Comece adicionando 10% do solvente B misturado ao solvente A. </li><li> De 0 min a 15 min, aumenta gradualmente a proporção de solvente B com um gradiente linear para 60%. </li><li> De 15 min a 16 min, aumenta rapidamente a proporção de solvente B com um gradiente linear de 60% a 90%. Isso inicia a lavagem da coluna HPLC. </li><li> Para lavar ainda mais a coluna de HPLC, mantenha o nível de solvente B a 90% entre 16 min e 18 min antes de reduzir gradualmente o nível de solvente B novamente para 10% entre 18 min e 19 min. </li><li> Reequilibre a coluna HPLC nas condições iniciais de 10% B entre 19 e 24 min. </li></ol></li><li> DentroControle 50 μL de amostra para o sistema HPLC. </li><li> Monitorar eluentes usando os comprimentos de onda de excitação / emissão do detector de fluorescência de 373/448 nm, e os ácidos sialic derivatizados podem ser esperados nos tempos de retenção aproximados de 9 min (para Neu5Gc-OPD) e 10 min (para Neu5Ac-OPD). </li><li> Calcule a quantidade relativa de Neu5Gc (F Neu5Gc ) das áreas de pico de fluorescência do Neu5Ac (A Neu5Ac ) e Neu5Gc (A Neu5Gc ) da seguinte maneira: F Neu5Gc [%] = 100 × A Neu5Gc / (A Neu5Ac + A Neu5Gc ). No caso das amostras de leite e fígado do mouse knock-out de Cmah homozigoto, F Neu5Gc deve ser 0%, enquanto que os valores para F Neu5Gc de camundongos heterozigóticos e de tipo selvagem podem variar amplamente dependendo da idade do mouse e do tipo de tecido (entre 2% E&gt; 90%) com margens de erro esperadas de ± 12%. </li></ol>

<ol>
	<li>Lamari, F. N., Karamanos, N. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separation+methods+for+sialic+acids+and+critical+evaluation+of+their+biologic+relevance.">Separation methods for sialic acids and critical evaluation of their biologic relevance.</a> J Chromatogr B Analyt Technol Biomed Life Sci. 781 (1-2), 3-19 (2002).</li><li>Irie, A., Koyama, S., Kozutsumi, Y., Kawasaki, T., Suzuki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+basis+for+the+absence+of+N-glycolylneuraminic+acid+in+humans.">The molecular basis for the absence of N-glycolylneuraminic acid in humans.</a> J Biol Chem. 273 (25), 15866-15871 (1998).</li><li>Chou, H. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mutation+in+human+CMP-sialic+acid+hydroxylase+occurred+after+the+Homo-Pan+divergence.">A mutation in human CMP-sialic acid hydroxylase occurred after the Homo-Pan divergence.</a> Proc Natl Acad Sci U S A. 95 (20), 11751-11756 (1998).</li><li>Rehan, I. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-Scale+Glycomics+of+Livestock:+Discovery+of+Highly+Sensitive+Serum+Biomarkers+Indicating+an+Environmental+Stress+Affecting+Immune+Responses+and+Productivity+of+Holstein+Dairy+Cows.">Large-Scale Glycomics of Livestock: Discovery of Highly Sensitive Serum Biomarkers Indicating an Environmental Stress Affecting Immune Responses and Productivity of Holstein Dairy Cows.</a> J Agric Food Chem. 63 (48), 10578-10590 (2015).</li><li>Wang, B., McVeagh, P., Petocz, P., Brand-Miller, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brain+ganglioside+and+glycoprotein+sialic+acid+in+breastfed+compared+with+formula-fed+infants.">Brain ganglioside and glycoprotein sialic acid in breastfed compared with formula-fed infants.</a> Am J Clin Nutr. 78 (5), 1024-1029 (2003).</li><li>Yao, H. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+sialic+acids+in+red+meat+by+UPLC-FLD+using+indoxylsialosides+as+internal+standards.">Quantification of sialic acids in red meat by UPLC-FLD using indoxylsialosides as internal standards.</a> Glycoconj J. 33 (2), 219-226 (2016).</li><li>Nguyen, D. H., Tangvoranuntakul, P., Varki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+natural+human+antibodies+against+a+nonhuman+sialic+acid+that+metabolically+incorporates+into+activated+and+malignant+immune+cells.">Effects of natural human antibodies against a nonhuman sialic acid that metabolically incorporates into activated and malignant immune cells.</a> J Immunol. 175 (1), 228-236 (2005).</li><li>Byres, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Incorporation+of+a+non-human+glycan+mediates+human+susceptibility+to+a+bacterial+toxin.">Incorporation of a non-human glycan mediates human susceptibility to a bacterial toxin.</a> Nature. 456 (7222), 648-652 (2008).</li><li>Hedlund, M., Padler-Karavani, V., Varki, N. M., Varki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+a+human-specific+mechanism+for+diet+and+antibody-mediated+inflammation+in+carcinoma+progression.">Evidence for a human-specific mechanism for diet and antibody-mediated inflammation in carcinoma progression.</a> Proc Natl Acad Sci U S A. 105 (48), 18936-18941 (2008).</li><li>Tangvoranuntakul, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+uptake+and+incorporation+of+an+immunogenic+nonhuman+dietary+sialic+acid.">Human uptake and incorporation of an immunogenic nonhuman dietary sialic acid.</a> Proc Natl Acad Sci U S A. 100 (21), 12045-12050 (2003).</li><li>Svennerholm, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+estimation+of+sialic+acids.+II.+A+colorimetric+resorcinol-hydrochloric+acid+method.">Quantitative estimation of sialic acids. II. A colorimetric resorcinol-hydrochloric acid method.</a> Biochim Biophys Acta. 24 (3), 604-611 (1957).</li><li>Warren, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+thiobarbituric+acid+assay+of+sialic+acids.">The thiobarbituric acid assay of sialic acids.</a> J Biol Chem. 234 (8), 1971-1975 (1959).</li><li>Kakehi, K., Maeda, K., Teramae, M., Honda, S., Takai, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+sialic+acids+by+gas+chromatography+of+the+mannosamine+derivatives+released+by+the+action+of+N-acetylneuraminate+lyase.">Analysis of sialic acids by gas chromatography of the mannosamine derivatives released by the action of N-acetylneuraminate lyase.</a> J Chromatogr. 272 (1), 1-8 (1983).</li><li>Wheeler, S. F., Domann, P., Harvey, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivatization+of+sialic+acids+for+stabilization+in+matrix-assisted+laser+desorption/ionization+mass+spectrometry+and+concomitant+differentiation+of+alpha(2+-->+3)-+and+alpha(2+-->+6)-isomers.">Derivatization of sialic acids for stabilization in matrix-assisted laser desorption/ionization mass spectrometry and concomitant differentiation of alpha(2 --> 3)- and alpha(2 --> 6)-isomers.</a> Rapid Commun Mass Spectrom. 23 (2), 303-312 (2009).</li><li>Hurum, D. C., Rohrer, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+of+sialic+acids+in+infant+formula+by+chromatographic+methods:+a+comparison+of+high-performance+anion-exchange+chromatography+with+pulsed+amperometric+detection+and+ultra-high-performance+liquid+chromatography+methods.">Determination of sialic acids in infant formula by chromatographic methods: a comparison of high-performance anion-exchange chromatography with pulsed amperometric detection and ultra-high-performance liquid chromatography methods.</a> J Dairy Sci. 95 (3), 1152-1161 (2012).</li><li>Ito, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+fluorometric+high-performance+liquid+chromatography+method+for+sialic+acid+determination:+an+internal+standard+method+and+its+application+to+sialic+acid+analysis+of+human+apolipoprotein.">An improved fluorometric high-performance liquid chromatography method for sialic acid determination: an internal standard method and its application to sialic acid analysis of human apolipoprotein.</a> E. Anal Biochem. 300 (2), 260-266 (2002).</li><li>Naito, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germinal+Center+Marker+GL7+Probes+Activation-Dependent+Repression+of+N-Glycolylneuraminic+Acid,+a+Sialic+Acid+Species+Involved+in+the+Negative+Modulation+of+B-Cell+Activation.">Germinal Center Marker GL7 Probes Activation-Dependent Repression of N-Glycolylneuraminic Acid, a Sialic Acid Species Involved in the Negative Modulation of B-Cell Activation.</a> Mol Cell Biol. 27 (8), 3008-3022 (2007).</li><li>Manzi, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-pressure+liquid+chromatography+of+sialic+acids+on+a+pellicular+resin+anion-exchange+column+with+pulsed+amperometric+detection:+a+comparison+with+six+other+systems.">High-pressure liquid chromatography of sialic acids on a pellicular resin anion-exchange column with pulsed amperometric detection: a comparison with six other systems.</a> Anal Biochem. 188 (1), 20-32 (1990).</li><li>Hedlund, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N-glycolylneuraminic+acid+deficiency+in+mice:+implications+for+human+biology+and+evolution.">N-glycolylneuraminic acid deficiency in mice: implications for human biology and evolution.</a> Mol Cell Biol. 27 (12), 4340-4346 (2007).</li><li>Platt, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9+knockin+mice+for+genome+editing+and+cancer+modeling.">CRISPR-Cas9 knockin mice for genome editing and cancer modeling.</a> Cell. 159 (2), 440-455 (2014).</li><li>Zangala, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+genomic+DNA+from+mouse+tails.">Isolation of genomic DNA from mouse tails.</a> J Vis Exp. (6), e246 (2007).</li><li>Willingham, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Milk+collection+methods+for+mice+and+Reeves'+muntjac+deer.">Milk collection methods for mice and Reeves' muntjac deer.</a> J Vis Exp. (89), (2014).</li><li>Goncalves, L. A., Vigario, A. M., Penha-Goncalves, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+isolation+of+murine+hepatocytes+for+in+vitro+malaria+liver+stage+studies.">Improved isolation of murine hepatocytes for in vitro malaria liver stage studies.</a> Malar J. 6, 169 (2007).</li></ol>

Os autores não têm nada a divulgar.

O protocolo aqui apresentado permite a avaliação fenotípica de camundongos knock-out Cmah homozigotos, analisando e quantificando as quantidades relativas de Neu5Gc de amostras de leite e fígado. A análise foi realizada usando uma configuração padrão de HPLC com detecção de fluorescência. O passo mais crítico deste procedimento é a preparação das colunas de troca de aniões e a realização da cromatografia de troca de aniões; Para resolver adequadamente a resina e para coletar as frações corr...

O ácido N-acetilneuraminico (Neu5Ac) e o ácido N-glicolneuraminico (Neu5Gc) são os ácidos sialicos mais comuns na maioria dos mamíferos 1 . Embora capaz de sintetizar Neu5Ac de forma endógena, os seres humanos não são capazes de produzir Neu5Gc devido a uma deleção primária de exão no gene CMAH que codifica uma hidroxilase 2 , 3 de CMP-Neu5Ac. No entanto, os produtos alimentares baseados em animais podem ser fontes dietéticas de Neu5Gc 4 , 5 , 6 , levando à produção de anticorpos anti-Neu5Gc e, portanto, desencadeiam uma resposta imune em direção a Neu5Gc 7 . Este efeito dietético de Neu5Gc é suspeito de contribuir para a inflamação crônica e várias outras doenças 8 , 9 , 10 . A fim de compreender de forma abrangente os efeitos de Neu5Gc em hUm modelo animal para o estudo sistemático dos efeitos de ácidos sialicos de origem alimentar é altamente desejável. Embora os protocolos baseados na reação em cadeia da polimerase (PCR) para a análise de camundongos nocaute estão bem estabelecidos e uma maneira conveniente para a avaliação genotípica, a análise funcional do fenótipo no nível metabólico requer métodos de análise mais específicos. O fenótipo de um modelo de rato knock-out Cmah pode ser avaliado isolando e analisando a composição de ácidos siálicos em amostras de fígado ou leite. Vários métodos para a detecção de ácidos siiálicos em tecidos animais foram relatados anteriormente: reagir ácidos siálicos com resorcinol 11 ou ácido tiobarbitúrico 12 resultam na formação de um produto cromóforo e podem ser simplesmente analisados ​​usando uma configuração baseada em platereader, mas apenas o sialico total O teor de ácido pode ser determinado. Alternativamente, a análise de ácidos siálicos também foi descrita utilizando cromatografia em fase gasosa13 , espectrometria de massa MALDI-ToF 14 ou métodos amperométricos 15 . No entanto, os métodos de análise de ácido siálico mais comummente aplicados são baseados em liberação hidrolítica, seguidos de derivação de fluorescência e subsequente cromatografia líquida de alto desempenho 16 , 17 , 18 .

<table><tbody><tr><td>&lt;strong&gt;Chemicals:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>N-acetylneuraminic acid</td><td>Sigma</td><td>A0812</td><td></td></tr><tr><td>N-glycolylneuraminic acid</td><td>Sigma</td><td>50644</td><td>1 mg aliquot should be sufficient</td></tr><tr><td>o-Phenylenediamine</td><td>Sigma</td><td>694975</td><td></td></tr><tr><td>Sodium hydrogen sulfite</td><td>J&amp;amp;K Scientific Ltd</td><td>75234</td><td></td></tr><tr><td>&lt;strong&gt;Tools/Materials:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>3 mL SPE tubes</td><td>Supelco</td><td>Sigma 57024</td><td>empty solid phase extraction columns</td></tr><tr><td>Luer stopcock</td><td>Sigma</td><td>S7396</td><td>to stop the flow of the SPE tube</td></tr><tr><td>Dowex 1X8</td><td>Dow Chemicals</td><td>Sigma 44340</td><td>200 - 400 mesh</td></tr><tr><td>Dounce tissue grinder</td><td>Sigma</td><td>D8938</td><td>tight fit</td></tr><tr><td>&lt;strong&gt;HPLC Analysis:&lt;/strong&gt;</td><td></td><td></td><td></td></tr><tr><td>High-recovery HPLC vial</td><td>Agilent Technologies</td><td>#5188-2788</td><td></td></tr><tr><td>HPLC System</td><td>Shimadzu</td><td>Nexera</td><td></td></tr><tr><td>Fluorescence Detector for HPLC</td><td>Shimadzu</td><td>RF-20Axs</td><td></td></tr><tr><td>HPLC Column</td><td>Phenomenex</td><td>Hyperclone ODS</td><td>250 x 4.6 mm</td></tr><tr><td>LCMS-grade H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Merck Millipore</td><td>#WX00011</td><td></td></tr><tr><td>LCMS-grade Acetonitrile</td><td>Merck Millipore</td><td>#100029</td><td>Hypergrade</td></tr><tr><td>Ammonium hydroxide solution</td><td>Fluka</td><td>#44273</td><td>puriss. P.a.</td></tr></tbody></table>

determination of sialic acids in liver and milk samples of wild-type and cmah knock-out mice.

A CMAH (hidroxilase de ácido citidina monofosfato-N-acetilneuramínico) é responsável pela oxidação de ácidos citidina monofosfato-N-acetilneuraminico em mamíferos. No entanto, os seres humanos não podem oxidar o ácido monofosfato-N-acetilneuramínico da citidina para o ácido monofosfato-N-glicolneuraminico de citidina devido a uma deleção primária de exão do gene CMAH . Para entender os efeitos e as implicações da falta de atividade do CMAH com mais detalhes, um modelo de nocaute Cmah em camundongos é de grande interesse na pesquisa básica e aplicada. O método de análise para determinar o fenótipo deste modelo de rato é aqui descrito em detalhe e é baseado na detecção de ácido N-acetilneuraminico e ácido N-glicolilenuraminico no fígado e leite de camundongos de tipo selvagem e Cmah knock-out. Os ácidos sialicos endógenos são liberados e derivados com o-fenilenodiamina para gerar derivados fluorogénicos, os quais podem ser posteriormente analisados ​​por HPLC. O protocolo apresentado pode serTambém aplicou para a análise de amostras de leite e tecido de várias outras origens e pode ser útil para investigar os efeitos nutricionais e da saúde do ácido N-glicoliluramina.

Uma visão geral esquemática do método de análise descrito é mostrada na Figura 1 e inclui o isolamento de ácidos sialicos a partir de amostras de leite e fígado de camundongos mutantes de tipo selvagem e Cmah knock-out, e a derivação de fluorescência e a análise por HPLC desses componentes. A Figura 2 e a Figura 3 mostram cromatogramas de HPLC representativos de ácidos ...

Watch this Scientific Journal Video about Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice. at JoVE.com

Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

Descrevemos um método baseado em HPLC para a determinação de ácido N-acetilneuraminico e ácido N-glicolilenuraminico em fígado e leite de rato.

Determinação de ácidos sialic em amostras de fígado e leite de tipo selvagem e<em&gt; CMAH</em&gt; Ratinhos de eliminação.

CMAH (cytidine monophosphate-N-acetylneuraminic acid hydroxylase) is responsible for the oxidation of cytidine monophosphate-N-acetylneuraminic acids in ...

determination-sialic-acids-liver-milk-samples-wild-type-cmah-knock

Research

JoVE Journal

Biology

Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

9.7K visualizações.  Nanjing Agricultural University.  Descrevemos um método baseado em HPLC para a determinação de ácido N-acetilneuraminico e ácido N-glicolilenuraminico em fígado e leite de rato. 

Vídeo: Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

Determining Bile Duct Density in the Mouse Liver

Mouse is broadly used as a model organism to study biliary diseases. To evaluate the development and function of the biliary system, various techniques are used, including serum chemistry, histological analysis, and immunostaining for specific markers. Although these techniques can provide important information about the biliary system, they often do not present a full picture of bile duct (BD) developmental defects across the whole liver. This is in part due to the robust ability of the mouse liver to drain the bile even in animals with significant impairment in biliary development. Here we present a simple method to calculate the average number of BDs associated with each portal vein (PV) in sections covering all lobes of mutant/transgenic mice. In this method, livers are mounted and sectioned in a stereotypic manner to facilitate comparison among various genotypes and experimental conditions. BDs are identified via light microscopy of cytokeratin-stained cholangiocytes, and then counted and divided by the total number of PVs present in liver section. As an example, we show how this method can clearly distinguish between wild-type mice and a mouse model of Alagille syndrome. The method presented here cannot substitute for techniques that visualize the three-dimensional structure of the biliary tree. However, it offers an easy and direct way to quantitatively assess BD development and the degree of ductular reaction formation in mice.

We present a rather simple and sensitive method for accurate quantification of bile duct density in the mouse liver. This method can aid in determining the effects of genetic and environmental modifiers and the effectiveness of potential therapies in mouse models of biliary diseases.

Determinando a densidade do ducto biliar no fígado do rato

Mouse is broadly used as a model organism to study biliary diseases. To evaluate the development and function of the biliary system, various techniques ...

Biologia do Desenvolvimento

Metabolic Glycoengineering of Sialic Acid Using N-acyl-modified Mannosamines

Sialic acid (Sia) is a highly important constituent of glycoconjugates, such as N- and O-glycans or glycolipids. Due to its position at the non-reducing termini of oligo- and polysaccharides, as well as its unique chemical characteristics, sialic acid is involved in a multitude of different receptor-ligand interactions. By modifying the expression of sialic acid on the cell surface, sialic acid-dependent interactions will consequently be influenced. This can be helpful to investigate sialic acid-dependent interactions and has the potential to influence certain diseases in a beneficial way. Via metabolic glycoengineering (MGE), the expression of sialic acid on the cell surface can be modulated. Herein, cells, tissues, or even entire animals are treated with C2-modified derivatives of N-acetylmannosamine (ManNAc). These amino sugars act as sialic acid precursor molecules and therefore are metabolized to the corresponding sialic acid species and expressed on glycoconjugates. Applying this method produces intriguing effects on various biological processes. For example, it can drastically reduce&#160;the expression of polysialic acid (polySia) in treated neuronal cells and thus affects neuronal growth and differentiation. Here, we show the chemical synthesis of two of the most common C2-modified N-acylmannosamine derivatives, N-propionylmannosamine (ManNProp) as well as N-butanoylmannosamine (ManNBut), and further show how these non-natural amino sugars can be applied in cell culture experiments. The expression of modified sialic acid species is quantified by high performance liquid chromatography (HPLC) and further analyzed via mass spectrometry. The effects on polysialic acid expression are elucidated via Western blot using a commercially available polysialic acid antibody.

Metabolic Glycoengineering of Sialic Acid Using N-acyl-modified Mannosamines

Sialic acid is a typical monosaccharide-unit found in glycoconjugates. It is involved in a plethora of molecular and cellular interactions. Here we present a method to modify cell surface sialic acid expression using metabolic glycoengineering with N-acetylmannosamine derivatives.

Glycoengineering metabólica do ácido siálico usando N-acil-modificado Mannosamines

Sialic acid (Sia) is a highly important constituent of glycoconjugates, such as N- and O-glycans or glycolipids. Due to its position at the non-reducing ...

Bioengenharia

The bm12 Inducible Model of Systemic Lupus Erythematosus (SLE) in C57BL/6 Mice

Systemic lupus erythematosus (SLE) is an autoimmune disease with diverse clinical and immunological manifestations. Several spontaneous and inducible animal models mirror common components of human disease, including the bm12 transfer model. Upon transfer of bm12 splenocytes or purified CD4 T cells, C57BL/6 mice rapidly develop large frequencies of T follicular helper cells (Tfh), germinal center (GC) B cells, and plasma cells followed by high levels of circulating anti-nuclear antibodies. Since this model utilizes mice on a pure C57BL/6 background, researchers can quickly and easily study disease progression in transgenic or knockout mouse strains in a relatively short period of time. Here we describe protocols for the induction of the model and the quantitation Tfh, GC B cells, and plasma cells by multi-color flow cytometry. Importantly, these protocols can also be used to characterize disease in most mouse models of SLE and identify Tfh, GC B cells, and plasma cells in other disease models.

The bm12 Inducible Model of Systemic Lupus Erythematosus SLE in C57BL/6 Mice

The transfer of bm12 lymphocytes into a C57BL/6 recipient is an established model of systemic lupus erythematosus. Here we describe how to initiate disease using this model and how to characterize T follicular helper cells, germinal center B cells and plasma cells by flow cytometry.

O Inducible Modelo BM12 de Lúpus Eritematoso Sistêmico (LES) em camundongos C57BL / 6

Systemic lupus erythematosus (SLE) is an autoimmune disease with diverse clinical and immunological manifestations. Several spontaneous and inducible ...

Medicina

A Method for the Measurement of Salivary Gland Function in Mice

Patients with Sj&#246;gren&#39;s syndrome, an autoimmune disease affecting the exocrine glands, develop salivary gland inflammation and have reduced saliva production. Similarly, saliva production is severely compromised in patients receiving radiation treatment for head and neck cancers. Rodent models, developed to mimic these clinical conditions, facilitate an understanding of the disease pathogenesis and allow for the development of new therapeutic strategies. Therefore, the ability to accurately, reproducibly, and repeatedly measure salivary gland function in animal models is critical. Building on procedures previously described in the literature, a method was developed that meets these criteria and was used to evaluate salivary gland function in mice. An additional advantage of this new method is that it is easily mastered, and has little inter-operator variation. Salivary gland function is evaluated as the amount (weight or volume) or rate (mL/min) of saliva produced in response to pilocarpine stimulation. The collected saliva is a good source for the analyses of protein content, immunoglobulin concentrations, and other biomolecules.

Salivary gland hypofunction is a frequent consequence of autoimmune disease and radiation therapy. Reproducible evaluation of salivary gland function in mouse models of these diseases is a technical challenge. Here, a simple method for accurate and reproducible measurement of saliva production in mice is described.

Um método para a medição da função da glândula salivar em ratos

Patients with Sj&#246;gren&#39;s syndrome, an autoimmune disease affecting the exocrine glands, develop salivary gland inflammation and have reduced ...

Imunologia e Infecção

Using a Bacterial Pathogen to Probe for Cellular and Organismic-level Host Responses

There are a variety of strategies bacterial pathogens employ to survive and proliferate once inside the eukaryotic cell. The so-called 'cytosolic' pathogens (Listeria monocytogenes, Shigella flexneri, Burkholderia pseudomallei, Francisella tularensis, and Rickettsia spp.) gain access to the infected cell cytosol by physically and enzymatically degrading the primary vacuolar membrane. Once in the cytosol, these pathogens both proliferate as well as generate sufficient mechanical forces to penetrate the plasma membrane of the host cell in order to infect new cells. Here, we show how this terminal step of the cellular infection cycle of L. monocytogenes (Lm) can be quantified by both colony-forming unit assays and flow cytometry and give examples of how both pathogen- and host-encoded factors impact this process. We also show a close correspondence of Lm infection dynamics of cultured cells infected in vitro and those of hepatic cells derived from mice infected in vivo. These function-based assays are relatively simple and can be readily scaled up for discovery-based high-throughput screens for modulators of eukaryotic cell function.

We describe both in vitro and in vivo infection assays that can be used to analyze the activities of host-encoding factors.

Usando um patógeno bacteriano para sonda para celular e organísmica-nível Host respostas

There are a variety of strategies bacterial pathogens employ to survive and proliferate once inside the eukaryotic cell. The so-called 'cytosolic' ...

Using Unfixed, Frozen Tissues to Study Natural Mucin Distribution

Mucins are complex and heavily glycosylated O-linked glycoproteins, which contain more than 70% carbohydrate by weight1-3. Secreted mucins, produced by goblet cells and the gastric mucosa, provide the scaffold for a micrometers-thick mucus layer that lines the epithelia of the gut and respiratory tract3,4. In addition to mucins, mucus layers also contain antimicrobial peptides, cytokines, and immunoglobulins5-9. The mucus layer is an important part of host innate immunity, and forms the first line of defense against invading microorganisms8,10-12. As such, the mucus is subject to numerous interactions with microbes, both pathogens and symbionts, and secreted mucins form an important interface for these interactions. The study of such biological interactions usually involves histological methods for tissue collection and staining. The two most commonly used histological methods for tissue collection and preservation in the clinic and in research laboratories are: formalin fixation followed by paraffin embedding, and tissue freezing, followed by embedding in cryo-protectant media.
Paraffin-embedded tissue samples produce sections with optimal qualities for histological visualization including clarity and well-defined morphology. However, during the paraffin embedding process a number of epitopes become altered and in order to study these epitopes, tissue sections have to be further processed with one of many epitope retrieval methods13. Secreted mucins and lipids are extracted from the tissue during the paraffin-embedding clearing step, which requires prolong incubation with organic solvents (xylene or Citrisolv). Therefore this approach is sub-optimal for studies focusing on the nature and distribution of mucins and mucus in vivo.
In contrast, freezing tissues in Optimal Cutting Temperature (OCT) embedding medium avoids dehydration and clearing of the sample, and maintains the sample hydration. This allows for better preservation of the hydrated mucus layer, and thus permits the study of the numerous roles of mucins in epithelial biology. As this method requires minimal processing of the tissue, the tissue is preserved in a more natural state. Therefore frozen tissues sections do not require any additional processing prior to staining and can be readily analyzed using immunohistochemistry methods.
We demonstrate the preservation of micrometers-thick secreted mucus layer in frozen colon samples. This layer is drastically reduced when the same tissues are embedded in paraffin. We also demonstrate immunofluorescence staining of glycan epitopes presented on mucins using plant lectins. The advantage of this approach is that it does not require the use of special fixatives and allows utilizing frozen tissues that may already be preserved in the laboratory.

Unfixed frozen tissue samples embedded in Optimal Cutting Temperature medium (OCT) can be used to study natural distribution and glycosylation of secreted mucus. In this approach tissue processing is minimal and the natural presentation of glycolipids, mucins and glycan-epitopes is preserved. Tissue sections can be analyzed by immunohistochemistry using fluorescence or chromogenic detection.

Usando unfixed, tecidos congelados para estudar a distribuição de mucina Natural

Mucins are complex and heavily glycosylated O-linked glycoproteins, which contain more than 70% carbohydrate by weight1-3. Secreted mucins, produced by ...

Biologia

Induction of Drug-Induced, Autoimmune Hepatitis in BALB/c Mice for the Study of Its Pathogenic Mechanisms

Drug-induced autoimmune hepatitis (DIH) is the most common hepatic drug-induced hypersensitization process observed in approximately 9 to 12% of patients with autoimmune hepatitis. The overwhelming majority of patients with DIH are women. The underlying mechanisms of these sex differences in prevalence are unclear because of the paucity of animal models that mimic human disease. Even so, underlying mechanisms are widely believed to be associated with human leukocyte antigen haplotypes and sex hormones. In contrast, using a DIH mouse model, we have uncovered that IL-4 initiated&#160;CD4+ T cells directed against an epitope of cytochrome P450 2E1 induces influx of neutrophils, macrophages and mast cells into the livers of female BALB/c mice. Using this model, we have also shown that IL-33-induced FoxP3+regulatory T cells confer protection against DIH in female and male mice. This DIH model is induced by immunizing mice with an epitope of CYP2E1 that has been covalently altered with a drug metabolite that has been associated with DIH. This epitope is recognized by patients with DIH. Our method induces robust and reproducible hepatitis and autoantibodies that can be utilized to study the pathogenesis of DIH. While in vivo studies can cause undue pain and distress in mice when done improperly, the advantage of an in vivo model is the ability to evaluate the pathogenesis of disease in a large number of mice. Additionally, biological effects of the altered liver proteins can be studied using invasive procedures. The addition of in vitro studies to the experimental design allows rapid repetition and mechanistic analysis at a cellular level. Thus, we will demonstrate our model protocol and how it can be utilized to study in vivo and in vitro mechanisms of DIH.

We describe an in vivo immunization, translational hepatitis model in BALB/c mice that can be utilized to study the pathogenesis of drug-induced autoimmune hepatitis including sex differences seen in this disease. We will describe how this model demonstrates reproducible analyses using in vivo and in vitro experimental techniques.

Indução de Hepatite Autoimune Induzida por Drogas em CAMUNDONGOS BALB/c para o Estudo de Seus Mecanismos Patogênicos

Drug-induced autoimmune hepatitis (DIH) is the most common hepatic drug-induced hypersensitization process observed in approximately 9 to 12% of patients ...

Inducing Meningococcal Meningitis Serogroup C in Mice via Intracisternal Delivery

Neisseria meningitidis (meningococcus) is a narrow-host-range microorganism, globally recognized as the leading cause of bacterial meningitis. Meningococcus is a transient colonizer of human nasopharynx of approximately 10% of healthy subject. In particular circumstances, it acquires an invasive ability to penetrate the mucosal barrier and invades the bloodstream causing septicaemia. In the latest case, fulminating sepsis could arise even without the consequent development of meningitis. Conversely, bacteria could poorly multiply in the bloodstream, cross the blood brain barrier, reach the central nervous system, leading to fulminant meningitis. The murine models of bacterial meningitis represent a useful tool to investigate the host-pathogen interactions and to analyze the pathogenetic mechanisms responsible for this lethal disease. Although, several experimental model systems have been evaluated over the last decades, none of these were able to reproduce the characteristic pathological events of meningococcal disease. In this experimental protocol, we describe a detailed procedure for the induction of meningococcal meningitis in a mouse model based on the intracisternal inoculation of bacteria. The peculiar signs of human meningitis were recorded in the murine host through the assessment of clinical parameters (e.g., temperature, body weight), evaluation of survival rate, microbiological analysis and histological examination of brain injury. When using intracisternal (i.cist.) inoculum, meningococci complete delivery directly into cisterna magna, leading to a very efficient meningococcal replication in the brain tissue. A 1,000-fold increase of viable count of bacteria is observed in about 18 h. Moreover, meningococci are also found in the spleen, and liver of infected mice, suggesting that the liver may represent a target organ for meningococcal replication.

Here, we describe a method to induce meningococcal meningitis through an intracisternal route of infection in adult mice. We present a step by step protocol of meningococcal infection from the preparation of inoculum to the intracisternal infection; then record the animal survival and evaluate the bacterial loads in murine tissues.

Indução meningocócica meningite sorogrupo C em camundongos via parto intracisternal

Neisseria meningitidis (meningococcus) is a narrow-host-range microorganism, globally recognized as the leading cause of bacterial meningitis. ...

Indirect Immunofluorescence on Frozen Sections of Mouse Mammary Gland

Indirect immunofluorescence is used to detect and locate proteins of interest in a tissue. The protocol presented here describes a complete and simple method for the immune detection of proteins, the mouse lactating mammary gland being taken as an example. A protocol for the preparation of the tissue samples, especially concerning the dissection of mouse mammary gland, tissue fixation and frozen tissue sectioning, are detailed. A standard protocol to perform indirect immunofluorescence, including an optional antigen retrieval step, is also presented. The observation of the labeled tissue sections as well as image acquisition and post-treatments are also stated. This procedure gives a full overview, from the collection of animal tissue to the cellular localization of a protein. Although this general method can be applied to other tissue samples, it should be adapted to each tissue/primary antibody couple studied.

The indirect immunofluorescence protocol described in this article allows the detection and the localization of proteins in the mouse mammary gland. A complete method is given to prepare mammary gland samples, to perform immunohistochemistry, to image the tissue sections by fluorescence microscopy, and to reconstruct images.

Imunofluorescência Indireta em cortes congelados de Rato glândula mamária

Indirect immunofluorescence is used to detect and locate proteins of interest in a tissue. The protocol presented here describes a complete and simple ...

<meta charset="utf8"></head><body>Método otimizado de uma única pessoa para coleta de leite em estudos de lactação de camundongos

An Efficient Single-Person Technique for Milk Sampling from Laboratory Mice

Rodent models have been widely used in biology since the early 20th century to study basic physiology and biochemical mechanisms. In lactation and neonatal development research, there is a need to sample milk to determine the composition and how milk may be affected by experimental manipulations, thereby impacting newborn development. Collecting biofluids in sufficient amounts from small rodents can be difficult. Several studies have demonstrated different techniques to obtain milk from mice. However, these techniques often require at least two trained personnel, which may be challenging in some cases.&#160;
Here, we demonstrate a modified milk sampling technique based on a method published in 2009. With this affordable and easy-to-assemble method, one trained person can routinely obtain 0.1&#8211;0.5 mL of milk from a dam under anesthesia in less than 10 min. Using this method, we collected sufficient milk on post-delivery day 2 (PD2) and post-delivery day 10 (PD10). We measured milk macronutrient components and compared them with the existing literature to validate our collection method.&#160;
We recorded that on PD2, milk protein averaged at 70.1 &#177; 5.2 g/L, milk fat was 174.4 &#177; 7.1 g/L, and milk lactose was 12.3 &#177; 0.6 g/L. On PD10, while milk lactose and protein remained at similar concentrations as on PD2, milk fat was significantly higher (224.4 &#177; 17.1 g/L). We also observed that the relative abundance of individual milk proteins varied between PD2 and PD10. More specifically, &#945;S1-casein and whey acidic protein were higher, while &#946;-casein was lower at PD10 compared with PD2. Overall, we demonstrate an efficient single-person technique for milk sampling from mice using a device that can easily be assembled with commonly used laboratory equipment.

<meta charset="utf8"></head><body>Uma técnica eficiente de uma única pessoa para amostragem de leite de camundongos de laboratório

This article describes how to assemble a device that can be used to collect milk from laboratory mice. This device is affordable, portable, and allows a collection of 0.1&#8211;0.5 mL of milk by one trained person. A detailed milking protocol is also included.&#160;

Determinação de ácidos sialic em amostras de fígado e leite de tipo selvagem e

Resumo

Explore mais vídeos

Capítulos neste vídeo