Este trabalho foi apoiado em parte pela Fundação de Ciências Naturais da China (números de subvenção 31471703, A0201300537 e 31671854 para JV e LL) e o Plano de 100 Estratos Estrangeiros (número de concessão JSB2014012 a JV).

Os procedimentos envolvendo assuntos de animais foram aprovados pelo Comitê de Ética do Centro de Animal Experimental da Universidade Agrícola de Nanjing de acordo com as Diretrizes Nacionais para o Bem-estar Animal Experimental (Ministério da Ciência e Tecnologia, PR da China, 2006) com os animais alojados em um SPF Facilidade (ID de permissão: SYXK-J-2011-0037). 1. Cmah Knock-out Mouse Model <ol><li> Use ratinhos C57Bl / 6 de tipo selvagem do Centro de Medicina Comparada da Universidade de Yangzhou (China). NOTA: Os ratos Cmah knock-out foram gerados com base na informação fornecida pelos estudos anteriores 17 , 19 da Cmah e obtidos comercialmente usando uma estratégia CRISPR / Cas9 20 , removendo 92 pares de bases do exão 6 do gene Cmah , o que também é Eliminado no gene CMAH humano 19 . Positivo F 0 &lt;/ Sub&gt; -mice (2 indivíduos) foram cruzados com camundongos de tipo selvagem para obter ratazana F 1 heterozigótica. Depois de atravessar um heterozigoto F -mice (5 pessoas), homozigica CMAH knock-out F 2 -mice poderia ser obtida com sucesso (3 indivíduos). </li><li> Execute genotipagem de camundongos usando DNA genômico de acordo com o método demonstrado por Zangala 21 usando um kit comercial de purificação de DNA. <ol><li> Amplificar um fragmento de DNA correspondente do gene Cmah usando DNA polimerase comercial e o par de iniciadores 5&#39;gaaagggctcggctctgtatgaa3 &#39;e 5&#39;tttaaaatgtcccgggtgagaagc3&#39;. Execute a amplificação do gene utilizando 34 ciclos de PCR consistindo em desnaturação a 94 ° C durante 40 s, recozimento a 63 ° C durante 40 s e alongamento a 72 ° C durante 1 min. </li><li> Visualize produtos de PCR em um gel de agarose a 1%. Deve observar uma única banda (0,5 kb) para o indivíduo de tipo selvagem, uma banda dupla (0,4 e 0,5 kb) para aIndivíduo knock-out heterocigótico, e uma única banda (0.4 kb) para o indivíduo homozigoto knock-out. </li></ol></li></ol> 2. Coleção de Amostras <ol><li> Coletar leite de rato usando o protocolo descrito por Willingham et al. 22 . </li><li> Coletar o tecido hepático do mouse usando o protocolo descrito por Gonçalves et al. 23 e armazene amostras a -80 ° C. </li></ol> 3. Isolamento de ácidos sialic do leite <ol><li> Prepare 100 mL de uma solução de ácido acético 2 M adicionando 12 mL de ácido acético glacial em 88 mL de H 2 O destilado. </li><li> Transfira 50 μL de leite para um tubo de centrífuga de 1,5 mL e adicione 1,2 ml da solução aquosa preparada de ácido acético. </li><li> Incubar a suspensão durante 4 h a 80 ° C e centrifugar a amostra a 14 000 xg durante 10 min. </li><li> Transfira os 1.000 μL superiores do sobrenadante para um novo tubo de centrifugação de 1,5 mL e remO solvente por evaporação centrífuga à temperatura ambiente para completar a secura (dependendo da bomba de vácuo anexada, isso levará de 4 a 20 h). Re-dissolver a amostra em 500 μL de H 2 O destilado. </li><li> Prepare uma coluna de troca de anião-anião. Este passo irá enriquecer especificamente compostos aniônicos e remover compostos catiônicos e neutros das amostras de leite e fígado e, portanto, aumenta a seletividade do agente de rotulagem OPD fluorogênico para a derivação do ácido siálico. <ol><li> Transferir para cada amostra 200 mg da resina de permuta aniónica (Dowex 1X8) em tubos de coluna de 3 mL vazios com uma torneira de ligação anexada. </li><li> Adicionar 2 mL da solução aquosa de ácido acético preparada no passo 3.1 para substituir os iões cloreto na resina com íons acetato. Feche a torneira assim que o solvente atingir o topo da resina. </li><li> Adicione gentilmente 2 mL de H 2 O destilado, abra a torneira e pare o fluxo assim que a maior parte do solvente atingirO topo da resina. Certifique-se de que a resina esteja sempre coberta com solvente. </li><li> Lave a coluna de resina duas vezes mais com 2 mL de H 2 O destilado para remover o excesso de acetato. </li></ol></li><li> Transfira os 500 μL resultantes de solvente da amostra a partir do passo 3.4. Na coluna de resina e descarte o fluxo. Com cuidado, lavar a resina com 2 ml de H2O destilada Eluir os aniões de amostra a partir da resina utilizando 1 mL de uma solução de acetato de amónio 50 mM (386 mg de acetato de amónio dissolvido em 100 mL de H2O destilada) em um 1,5 mL Tubo de centrífuga. Remova o solvente por evaporação centrífuga à temperatura ambiente até à secura. NOTA: As amostras secas podem ser armazenadas a 4-6 ° C por até 12 meses. </li></ol> 4. Isolamento de ácidos sialic a partir de tecido de fígado <ol><li> Descongelar suavemente 20 - 50 mg de fígado de rato e transferi-lo para um moedor de tecido Dounce (1 mL ou 2 mL de volume). Adicionar 1,2 ml da solução aquosa de ácido acéticoPreparado no passo 3.1 e homogeneizar o tecido por um corte suave durante 10 s. Transfira a suspensão resultante para um tubo de centrifugação de 1,5 mL. </li><li> Siga as etapas 3.3. Para 3.6. NOTA: As amostras secas podem ser armazenadas a 4-6 ° C por até 12 meses. </li></ol> 5. Preparação de um padrão de ácido siálico misto <ol><li> Pesar entre 5 e 8 mg de ácido N-acetilneuramínico em um balanço analítico em um tubo de centrífuga de 1,5 mL. Observe o peso exato e adicione 164 μL de H 2 O destilado por cada mg ( ou seja, se o peso de Neu5Ac for 7.2 mg, então adicione 7.2 x 164 = 1, 181 μL de H 2 O destilado). Isso resulta em uma solução de estoque Neu5Ac 20 mM que pode ser armazenada a -20 ° C por até 12 meses. </li><li> Obter ácido N-glicolneuraminico em quantidades menores a um preço moderado, tal como em alíquotas de 1 mg. Adicionar 154 μL de H 2 O destilado diretamente ao composto para obter uma solução de reserva de Neu5Gc ~ 20 mM. Transfira oSolução em um tubo de centrífuga de 1,5 mL. Esta solução pode ser armazenada a -20 ° C por até 12 meses. </li><li> Combine 5 μL de cada solução de base do passo 5.1 e 5.2 em um tubo de centrífuga fresco de 1,5 mL e remova o solvente por evaporação centrífuga à temperatura ambiente até à secura. NOTA: O padrão de ácido sialico misto pode ser armazenado a 4 - 6 ° C por até 12 meses. </li></ol> 6. Fluorescência Derivação de Ácidos Sialicos <ol><li> Prepare 10 mL de solução de OPD, consistindo em 100 mg de o-fenilenodiamina e 208 mg de hidrogeno sulfito de sódio em 10 mL de H 2 O destilada. </li><li> Adicione 20 μL de solução de OPD às amostras de ácido siálico derivadas de leite de rato (passo 3), fígado de rato (passo 4) ou padrão de ácido sialico misto (passo 5). Vortex vigorosamente por 30 s e incubar as amostras durante 4 h a 80 ° C no escuro ( ou seja, envolva os microtubos na folha de alumínio). </li><li> Deixe as amostras esfriarem por 5 min, adicione 80 μ; L de H 2 O destilada e centrifugar os tubos a 14 000 xg durante 1 min. </li><li> Transferir 80 μL do sobrenadante para um frasco de HPLC de alta recuperação de 300 μL. As amostras de ácido siálico derivadas podem ser armazenadas a 4 - 6 ° C por até uma semana. </li></ol> 7. Análise HPLC de Derivados de Ácido Sialico <ol><li> Analise as amostras usando um sistema HPLC padrão conectado a um detector de fluorescência online. </li><li> Use uma coluna de fase C18 com as dimensões padrão de 250 mm de comprimento e 4,6 mm de diâmetro para a análise. </li><li> Prepare o solvente A diluindo 200 mL de solução de reserva com 800 mL de água com LCMS (LCMS - cromatografia líquida em massa de espectrometria). A própria solução-mãe pode ser preparada da seguinte forma: <ol><li> Adicionar 46 g de ácido fórmico a 800 mL de LCMS-classe de H 2 O. </li><li> Ajustar o pH a 4,5, adicionando gota a gota solução de hidróxido de amônio (pur. Pa). </li><li> Transfira o solvente para umCilindro de medição e preencha até 1.000 mL com H 2 O de grau LCMS. Esta solução pode ser armazenada entre 4 e 6 ° C por até 3 meses. </li></ol></li><li> Para o solvente B, use acetonitrilo de grau LCMS. </li><li> Separar os derivados de ácidos siálicos a uma taxa de fluxo de 1 mL / min com a seguinte eluição gradiente: <ol><li> Comece adicionando 10% do solvente B misturado ao solvente A. </li><li> De 0 min a 15 min, aumenta gradualmente a proporção de solvente B com um gradiente linear para 60%. </li><li> De 15 min a 16 min, aumenta rapidamente a proporção de solvente B com um gradiente linear de 60% a 90%. Isso inicia a lavagem da coluna HPLC. </li><li> Para lavar ainda mais a coluna de HPLC, mantenha o nível de solvente B a 90% entre 16 min e 18 min antes de reduzir gradualmente o nível de solvente B novamente para 10% entre 18 min e 19 min. </li><li> Reequilibre a coluna HPLC nas condições iniciais de 10% B entre 19 e 24 min. </li></ol></li><li> DentroControle 50 μL de amostra para o sistema HPLC. </li><li> Monitorar eluentes usando os comprimentos de onda de excitação / emissão do detector de fluorescência de 373/448 nm, e os ácidos sialic derivatizados podem ser esperados nos tempos de retenção aproximados de 9 min (para Neu5Gc-OPD) e 10 min (para Neu5Ac-OPD). </li><li> Calcule a quantidade relativa de Neu5Gc (F Neu5Gc ) das áreas de pico de fluorescência do Neu5Ac (A Neu5Ac ) e Neu5Gc (A Neu5Gc ) da seguinte maneira: F Neu5Gc [%] = 100 × A Neu5Gc / (A Neu5Ac + A Neu5Gc ). No caso das amostras de leite e fígado do mouse knock-out de Cmah homozigoto, F Neu5Gc deve ser 0%, enquanto que os valores para F Neu5Gc de camundongos heterozigóticos e de tipo selvagem podem variar amplamente dependendo da idade do mouse e do tipo de tecido (entre 2% E&gt; 90%) com margens de erro esperadas de ± 12%. </li></ol>

<ol>
	<li>Lamari, F. N., Karamanos, N. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Separation+methods+for+sialic+acids+and+critical+evaluation+of+their+biologic+relevance.">Separation methods for sialic acids and critical evaluation of their biologic relevance.</a> J Chromatogr B Analyt Technol Biomed Life Sci. 781 (1-2), 3-19 (2002).</li><li>Irie, A., Koyama, S., Kozutsumi, Y., Kawasaki, T., Suzuki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+basis+for+the+absence+of+N-glycolylneuraminic+acid+in+humans.">The molecular basis for the absence of N-glycolylneuraminic acid in humans.</a> J Biol Chem. 273 (25), 15866-15871 (1998).</li><li>Chou, H. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mutation+in+human+CMP-sialic+acid+hydroxylase+occurred+after+the+Homo-Pan+divergence.">A mutation in human CMP-sialic acid hydroxylase occurred after the Homo-Pan divergence.</a> Proc Natl Acad Sci U S A. 95 (20), 11751-11756 (1998).</li><li>Rehan, I. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-Scale+Glycomics+of+Livestock:+Discovery+of+Highly+Sensitive+Serum+Biomarkers+Indicating+an+Environmental+Stress+Affecting+Immune+Responses+and+Productivity+of+Holstein+Dairy+Cows.">Large-Scale Glycomics of Livestock: Discovery of Highly Sensitive Serum Biomarkers Indicating an Environmental Stress Affecting Immune Responses and Productivity of Holstein Dairy Cows.</a> J Agric Food Chem. 63 (48), 10578-10590 (2015).</li><li>Wang, B., McVeagh, P., Petocz, P., Brand-Miller, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brain+ganglioside+and+glycoprotein+sialic+acid+in+breastfed+compared+with+formula-fed+infants.">Brain ganglioside and glycoprotein sialic acid in breastfed compared with formula-fed infants.</a> Am J Clin Nutr. 78 (5), 1024-1029 (2003).</li><li>Yao, H. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantification+of+sialic+acids+in+red+meat+by+UPLC-FLD+using+indoxylsialosides+as+internal+standards.">Quantification of sialic acids in red meat by UPLC-FLD using indoxylsialosides as internal standards.</a> Glycoconj J. 33 (2), 219-226 (2016).</li><li>Nguyen, D. H., Tangvoranuntakul, P., Varki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+natural+human+antibodies+against+a+nonhuman+sialic+acid+that+metabolically+incorporates+into+activated+and+malignant+immune+cells.">Effects of natural human antibodies against a nonhuman sialic acid that metabolically incorporates into activated and malignant immune cells.</a> J Immunol. 175 (1), 228-236 (2005).</li><li>Byres, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Incorporation+of+a+non-human+glycan+mediates+human+susceptibility+to+a+bacterial+toxin.">Incorporation of a non-human glycan mediates human susceptibility to a bacterial toxin.</a> Nature. 456 (7222), 648-652 (2008).</li><li>Hedlund, M., Padler-Karavani, V., Varki, N. M., Varki, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+a+human-specific+mechanism+for+diet+and+antibody-mediated+inflammation+in+carcinoma+progression.">Evidence for a human-specific mechanism for diet and antibody-mediated inflammation in carcinoma progression.</a> Proc Natl Acad Sci U S A. 105 (48), 18936-18941 (2008).</li><li>Tangvoranuntakul, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+uptake+and+incorporation+of+an+immunogenic+nonhuman+dietary+sialic+acid.">Human uptake and incorporation of an immunogenic nonhuman dietary sialic acid.</a> Proc Natl Acad Sci U S A. 100 (21), 12045-12050 (2003).</li><li>Svennerholm, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quantitative+estimation+of+sialic+acids.+II.+A+colorimetric+resorcinol-hydrochloric+acid+method.">Quantitative estimation of sialic acids. II. A colorimetric resorcinol-hydrochloric acid method.</a> Biochim Biophys Acta. 24 (3), 604-611 (1957).</li><li>Warren, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+thiobarbituric+acid+assay+of+sialic+acids.">The thiobarbituric acid assay of sialic acids.</a> J Biol Chem. 234 (8), 1971-1975 (1959).</li><li>Kakehi, K., Maeda, K., Teramae, M., Honda, S., Takai, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+sialic+acids+by+gas+chromatography+of+the+mannosamine+derivatives+released+by+the+action+of+N-acetylneuraminate+lyase.">Analysis of sialic acids by gas chromatography of the mannosamine derivatives released by the action of N-acetylneuraminate lyase.</a> J Chromatogr. 272 (1), 1-8 (1983).</li><li>Wheeler, S. F., Domann, P., Harvey, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Derivatization+of+sialic+acids+for+stabilization+in+matrix-assisted+laser+desorption/ionization+mass+spectrometry+and+concomitant+differentiation+of+alpha(2+-->+3)-+and+alpha(2+-->+6)-isomers.">Derivatization of sialic acids for stabilization in matrix-assisted laser desorption/ionization mass spectrometry and concomitant differentiation of alpha(2 --> 3)- and alpha(2 --> 6)-isomers.</a> Rapid Commun Mass Spectrom. 23 (2), 303-312 (2009).</li><li>Hurum, D. C., Rohrer, J. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Determination+of+sialic+acids+in+infant+formula+by+chromatographic+methods:+a+comparison+of+high-performance+anion-exchange+chromatography+with+pulsed+amperometric+detection+and+ultra-high-performance+liquid+chromatography+methods.">Determination of sialic acids in infant formula by chromatographic methods: a comparison of high-performance anion-exchange chromatography with pulsed amperometric detection and ultra-high-performance liquid chromatography methods.</a> J Dairy Sci. 95 (3), 1152-1161 (2012).</li><li>Ito, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+improved+fluorometric+high-performance+liquid+chromatography+method+for+sialic+acid+determination:+an+internal+standard+method+and+its+application+to+sialic+acid+analysis+of+human+apolipoprotein.">An improved fluorometric high-performance liquid chromatography method for sialic acid determination: an internal standard method and its application to sialic acid analysis of human apolipoprotein.</a> E. Anal Biochem. 300 (2), 260-266 (2002).</li><li>Naito, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Germinal+Center+Marker+GL7+Probes+Activation-Dependent+Repression+of+N-Glycolylneuraminic+Acid,+a+Sialic+Acid+Species+Involved+in+the+Negative+Modulation+of+B-Cell+Activation.">Germinal Center Marker GL7 Probes Activation-Dependent Repression of N-Glycolylneuraminic Acid, a Sialic Acid Species Involved in the Negative Modulation of B-Cell Activation.</a> Mol Cell Biol. 27 (8), 3008-3022 (2007).</li><li>Manzi, A. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-pressure+liquid+chromatography+of+sialic+acids+on+a+pellicular+resin+anion-exchange+column+with+pulsed+amperometric+detection:+a+comparison+with+six+other+systems.">High-pressure liquid chromatography of sialic acids on a pellicular resin anion-exchange column with pulsed amperometric detection: a comparison with six other systems.</a> Anal Biochem. 188 (1), 20-32 (1990).</li><li>Hedlund, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=N-glycolylneuraminic+acid+deficiency+in+mice:+implications+for+human+biology+and+evolution.">N-glycolylneuraminic acid deficiency in mice: implications for human biology and evolution.</a> Mol Cell Biol. 27 (12), 4340-4346 (2007).</li><li>Platt, R. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-Cas9+knockin+mice+for+genome+editing+and+cancer+modeling.">CRISPR-Cas9 knockin mice for genome editing and cancer modeling.</a> Cell. 159 (2), 440-455 (2014).</li><li>Zangala, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+genomic+DNA+from+mouse+tails.">Isolation of genomic DNA from mouse tails.</a> J Vis Exp. (6), e246 (2007).</li><li>Willingham, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Milk+collection+methods+for+mice+and+Reeves'+muntjac+deer.">Milk collection methods for mice and Reeves' muntjac deer.</a> J Vis Exp. (89), (2014).</li><li>Goncalves, L. A., Vigario, A. M., Penha-Goncalves, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Improved+isolation+of+murine+hepatocytes+for+in+vitro+malaria+liver+stage+studies.">Improved isolation of murine hepatocytes for in vitro malaria liver stage studies.</a> Malar J. 6, 169 (2007).</li></ol>

Os autores não têm nada a divulgar.

O protocolo aqui apresentado permite a avaliação fenotípica de camundongos knock-out Cmah homozigotos, analisando e quantificando as quantidades relativas de Neu5Gc de amostras de leite e fígado. A análise foi realizada usando uma configuração padrão de HPLC com detecção de fluorescência. O passo mais crítico deste procedimento é a preparação das colunas de troca de aniões e a realização da cromatografia de troca de aniões; Para resolver adequadamente a resina e para coletar as frações corr...

O ácido N-acetilneuraminico (Neu5Ac) e o ácido N-glicolneuraminico (Neu5Gc) são os ácidos sialicos mais comuns na maioria dos mamíferos 1 . Embora capaz de sintetizar Neu5Ac de forma endógena, os seres humanos não são capazes de produzir Neu5Gc devido a uma deleção primária de exão no gene CMAH que codifica uma hidroxilase 2 , 3 de CMP-Neu5Ac. No entanto, os produtos alimentares baseados em animais podem ser fontes dietéticas de Neu5Gc 4 , 5 , 6 , levando à produção de anticorpos anti-Neu5Gc e, portanto, desencadeiam uma resposta imune em direção a Neu5Gc 7 . Este efeito dietético de Neu5Gc é suspeito de contribuir para a inflamação crônica e várias outras doenças 8 , 9 , 10 . A fim de compreender de forma abrangente os efeitos de Neu5Gc em hUm modelo animal para o estudo sistemático dos efeitos de ácidos sialicos de origem alimentar é altamente desejável. Embora os protocolos baseados na reação em cadeia da polimerase (PCR) para a análise de camundongos nocaute estão bem estabelecidos e uma maneira conveniente para a avaliação genotípica, a análise funcional do fenótipo no nível metabólico requer métodos de análise mais específicos. O fenótipo de um modelo de rato knock-out Cmah pode ser avaliado isolando e analisando a composição de ácidos siálicos em amostras de fígado ou leite. Vários métodos para a detecção de ácidos siiálicos em tecidos animais foram relatados anteriormente: reagir ácidos siálicos com resorcinol 11 ou ácido tiobarbitúrico 12 resultam na formação de um produto cromóforo e podem ser simplesmente analisados ​​usando uma configuração baseada em platereader, mas apenas o sialico total O teor de ácido pode ser determinado. Alternativamente, a análise de ácidos siálicos também foi descrita utilizando cromatografia em fase gasosa13 , espectrometria de massa MALDI-ToF 14 ou métodos amperométricos 15 . No entanto, os métodos de análise de ácido siálico mais comummente aplicados são baseados em liberação hidrolítica, seguidos de derivação de fluorescência e subsequente cromatografia líquida de alto desempenho 16 , 17 , 18 .

<table border="0" cellpadding="0" cellspacing="0" width="684">
	<colgroup>
		<col />
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:147px;">Chemicals:</td>
			<td style="width:144px;"></td>
			<td style="width:143px;"></td>
			<td style="width:251px;"></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">N-acetylneuraminic acid</td>
			<td>Sigma</td>
			<td>A0812</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">N-glycolylneuraminic acid</td>
			<td>Sigma</td>
			<td align="right">50644</td>
			<td>1 mg aliquot should be sufficient</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">o-Phenylenediamine</td>
			<td>Sigma</td>
			<td align="right">694975</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Sodium hydrogen sulfite</td>
			<td>J&#38;K Scientific Ltd</td>
			<td align="right">75234</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Tools/Materials:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">3 mL SPE tubes</td>
			<td>Supelco</td>
			<td>Sigma 57024</td>
			<td>empty solid phase extraction columns</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Luer stopcock</td>
			<td>Sigma</td>
			<td>S7396</td>
			<td>to stop the flow of the SPE tube</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Dowex 1X8</td>
			<td>Dow Chemicals</td>
			<td>Sigma 44340</td>
			<td>200-400 mesh</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Dounce tissue grinder</td>
			<td>Sigma</td>
			<td>D8938</td>
			<td>tight fit</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HPLC Analysis:</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">High-recovery HPLC vial</td>
			<td>Agilent Technologies</td>
			<td>#5188-2788</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HPLC System</td>
			<td>Shimadzu</td>
			<td>Nexera</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Fluorescence Detector for HPLC</td>
			<td>Shimadzu</td>
			<td>RF-20Axs</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">HPLC Column</td>
			<td>Phenomenex</td>
			<td>Hyperclone ODS</td>
			<td>250x4.6 mm</td>
		</tr>
		<tr height="24">
			<td height="24" style="height:24px;">LCMS-grade H2O</td>
			<td>Merck Millipore</td>
			<td>#WX00011</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">LCMS-grade Acetonitrile</td>
			<td>Merck Millipore</td>
			<td>#100029</td>
			<td>Hypergrade</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Ammonium hydroxide solution</td>
			<td>Fluka</td>
			<td>#44273</td>
			<td>puriss. P.a.</td>
		</tr>
	</tbody>
</table>

determination of sialic acids in liver and milk samples of wild-type and cmah knock-out mice.

A CMAH (hidroxilase de ácido citidina monofosfato-N-acetilneuramínico) é responsável pela oxidação de ácidos citidina monofosfato-N-acetilneuraminico em mamíferos. No entanto, os seres humanos não podem oxidar o ácido monofosfato-N-acetilneuramínico da citidina para o ácido monofosfato-N-glicolneuraminico de citidina devido a uma deleção primária de exão do gene CMAH . Para entender os efeitos e as implicações da falta de atividade do CMAH com mais detalhes, um modelo de nocaute Cmah em camundongos é de grande interesse na pesquisa básica e aplicada. O método de análise para determinar o fenótipo deste modelo de rato é aqui descrito em detalhe e é baseado na detecção de ácido N-acetilneuraminico e ácido N-glicolilenuraminico no fígado e leite de camundongos de tipo selvagem e Cmah knock-out. Os ácidos sialicos endógenos são liberados e derivados com o-fenilenodiamina para gerar derivados fluorogénicos, os quais podem ser posteriormente analisados ​​por HPLC. O protocolo apresentado pode serTambém aplicou para a análise de amostras de leite e tecido de várias outras origens e pode ser útil para investigar os efeitos nutricionais e da saúde do ácido N-glicoliluramina.

Uma visão geral esquemática do método de análise descrito é mostrada na Figura 1 e inclui o isolamento de ácidos sialicos a partir de amostras de leite e fígado de camundongos mutantes de tipo selvagem e Cmah knock-out, e a derivação de fluorescência e a análise por HPLC desses componentes. A Figura 2 e a Figura 3 mostram cromatogramas de HPLC representativos de ácidos ...

Watch this Scientific Journal Video about Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice. at JoVE.com

Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

Descrevemos um método baseado em HPLC para a determinação de ácido N-acetilneuraminico e ácido N-glicolilenuraminico em fígado e leite de rato.

Determinação de ácidos sialic em amostras de fígado e leite de tipo selvagem e<em&gt; CMAH</em&gt; Ratinhos de eliminação.

CMAH (cytidine monophosphate-N-acetylneuraminic acid hydroxylase) is responsible for the oxidation of cytidine monophosphate-N-acetylneuraminic acids in ...

determination-sialic-acids-liver-milk-samples-wild-type-cmah-knock

Research

JoVE Journal

Biology

Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

9.7K visualizações.  Nanjing Agricultural University.  Descrevemos um método baseado em HPLC para a determinação de ácido N-acetilneuraminico e ácido N-glicolilenuraminico em fígado e leite de rato. 

Vídeo: Determination of Sialic Acids in Liver and Milk Samples of Wild-type and CMAH Knock-out Mice.

Quantitation of &gamma;H2AX Foci in Tissue Samples

DNA double-strand breaks (DSBs) are particularly lethal and genotoxic lesions, that can arise either by endogenous (physiological or pathological) processes or by exogenous factors, particularly ionizing radiation and radiomimetic compounds. Phosphorylation of the H2A histone variant, H2AX, at the serine-139 residue, in the highly conserved C-terminal SQEY motif, forming &gamma;H2AX, is an early response to DNA double-strand breaks1. This phosphorylation event is mediated by the phosphatidyl-inosito 3-kinase (PI3K) family of proteins, ataxia telangiectasia mutated (ATM), DNA-protein kinase catalytic subunit and ATM and RAD3-related (ATR)2. Overall, DSB induction results in the formation of discrete nuclear &gamma;H2AX foci which can be easily detected and quantitated by immunofluorescence microscopy2. Given the unique specificity and sensitivity of this marker, analysis of &gamma;H2AX foci has led to a wide range of applications in biomedical research, particularly in radiation biology and nuclear medicine. The quantitation of &gamma;H2AX foci has been most widely investigated in cell culture systems in the context of ionizing radiation-induced DSBs. Apart from cellular radiosensitivity, immunofluorescence based assays have also been used to evaluate the efficacy of radiation-modifying compounds. In addition, &gamma;H2AX has been used as a molecular marker to examine the efficacy of various DSB-inducing compounds and is recently being heralded as important marker of ageing and disease, particularly cancer3. Further, immunofluorescence-based methods have been adapted to suit detection and quantitation of &gamma;H2AX foci ex vivo and in vivo4,5. Here, we demonstrate a typical immunofluorescence method for detection and quantitation of &gamma;H2AX foci in mouse tissues.

Quantitation of &#947;H2AX Foci in Tissue Samples

Quantitation of DNA double-strand breaks on the basis of &gamma;H2AX foci has become an invaluable tool, particularly in radiation biology, for the evaluation of tissue radiosensitivity and effects of radiation modifying compounds. Here we demonstrate the use of an immunofluorescence assay for quantitation of &gamma;H2AX foci in tissue samples.

Quantificação de γH2AX Focos em amostras de tecido

DNA double-strand breaks (DSBs) are particularly lethal and genotoxic lesions, that can arise either by endogenous (physiological or pathological) ...

Biologia

Identifying the Effects of BRCA1 Mutations on Homologous Recombination using Cells that Express Endogenous Wild-type BRCA1

The functional analysis of missense mutations can be complicated by the presence in the cell of the endogenous protein. Structure-function analyses of the BRCA1 have been complicated by the lack of a robust assay for the full length BRCA1 protein and the difficulties inherent in working with cell lines that express hypomorphic BRCA1 protein1,2,3,4,5. We developed a system whereby the endogenous BRCA1 protein in a cell was acutely depleted by RNAi targeting the 3'-UTR of the BRCA1 mRNA and replaced by co-transfecting a plasmid expressing a BRCA1 variant. One advantage of this procedure is that the acute silencing of BRCA1 and simultaneous replacement allow the cells to grow without secondary mutations or adaptations that might arise over time to compensate for the loss of BRCA1 function. This depletion and add-back procedure was done in a HeLa-derived cell line that was readily assayed for homologous recombination activity. The homologous recombination assay is based on a previously published method whereby a recombination substrate is integrated into the genome (Figure 1)6,7,8,9. This recombination substrate has the rare-cutting I-SceI restriction enzyme site inside an inactive GFP allele, and downstream is a second inactive GFP allele. Transfection of the plasmid that expresses I-SceI results in a double-stranded break, which may be repaired by homologous recombination, and if homologous recombination does repair the break it creates an active GFP allele that is readily scored by flow cytometry for GFP protein expression. Depletion of endogenous BRCA1 resulted in an 8-10-fold reduction in homologous recombination activity, and add-back of wild-type plasmid fully restored homologous recombination function. When specific point mutants of full length BRCA1 were expressed from co-transfected plasmids, the effect of the specific missense mutant could be scored. As an example, the expression of the BRCA1(M18T) protein, a variant of unknown clinical significance10, was expressed in these cells, it failed to restore BRCA1-dependent homologous recombination. By contrast, expression of another variant, also of unknown significance, BRCA1(I21V) fully restored BRCA1-dependent homologous recombination function. This strategy of testing the function of BRCA1 missense mutations has been applied to another biological system assaying for centrosome function (Kais et al, unpublished observations). Overall, this approach is suitable for the analysis of missense mutants in any gene that must be analyzed recessively.

We provide a method for testing BRCA1 variants in a tissue culture based assay for homologous recombination repair of DNA damage by depleting endogenous BRCA1 protein from a cell using RNAi and replacing it with a BRCA1 point mutant that contains a coding change.

Identificar os efeitos das mutações BRCA1 em Recombinação Homóloga usando células que expressam BRCA1 tipo selvagem endógena

The functional analysis of missense mutations can be complicated by the presence in the cell of the endogenous protein. Structure-function analyses of the ...

Concentration Determination of Nucleic Acids and Proteins Using the Micro-volume Bio-spec Nano Spectrophotometer

Nucleic Acid quantitation procedures have advanced significantly in the last three decades. More and more, molecular biologists require consistent small-volume analysis of nucleic acid samples for their experiments. The BioSpec-nano provides a potential solution to the problems of inaccurate, non-reproducible results, inherent in current DNA quantitation methods, via specialized optics and a sensitive PDA detector. The BioSpec-nano also has automated functionality such that mounting, measurement, and cleaning are done by the instrument, thereby eliminating tedious, repetitive, and inconsistent placement of the fiber optic element and manual cleaning.
In this study, data is presented on the quantification of DNA and protein, as well as on measurement reproducibility and accuracy. Automated sample contact and rapid scanning allows measurement in three seconds, resulting in excellent throughput. Data analysis is carried out using the built-in features of the software. The formula used for calculating DNA concentration is:
Sample Concentration = DF &middot; (OD260-OD320)&middot; NACF (1)
Where DF = sample dilution factor and NACF = nucleic acid concentration factor.
The Nucleic Acid concentration factor is set in accordance with the analyte selected1.
Protein concentration results can be expressed as &mu;g/ mL or as moles/L by entering e280 and molecular weight values respectively. When residue values for Tyr, Trp and Cysteine (S-S bond) are entered in the e280Calc tab, the extinction coefficient values are calculated as e280 = 5500 x (Trp residues) + 1490 x (Tyr residues) + 125 x (cysteine S-S bond). The e280 value is used by the software for concentration calculation.
In addition to concentration determination of nucleic acids and protein, the BioSpec-nano can be used as an ultra micro-volume spectrophotometer for many other analytes or as a standard spectrophotometer using 5 mm pathlength cells.

This communication presents data on the accuracy and reproducibility of the BioSpec-nano UV-VIS spectrophotometer for dsDNA and protein quantitation. Even with ultra-small volumes (1 to 2 L), reproducibility is excellent, while the automated wiping function improves throughput and results in minimal carryover for more precise results.

Determinação de concentração de ácidos nucléicos e proteínas Usando o Micro-volume Bio-spec Espectrofotômetro Nano

Nucleic Acid quantitation procedures have advanced significantly in the last three decades.  More and more, molecular biologists require consistent ...

In vivo Liver Endocytosis Followed by Purification of Liver Cells by Liver Perfusion

The liver is the metabolic center of the mammalian body and serves as a filter for the blood. The basic architecture of the liver is illustrated in figure 1 in which more than 85% of the liver mass is composed of hepatocytes and the remaining 15% of the cellular mass is composed of Kupffer cells (KCs), stellate cells (HSCs), and sinusoidal endothelial cells (SECs). SECs form the blood vessel walls within the liver and contain specialized morphology called fenestrae within in the cytoplasm. Fenestration of the cytoplasm is the appearance of holes (&tilde;100 &mu;m) within the cells so that the SECs act as a sieve in which most chylomicrons, chylomicron remnants and macromolecules, but not cells, pass through to the hepatocytes and HSCs 1 (Fig. 1). Due to the lack of a basement membrane, the gap between the SECs and hepatocytes form the Space of Disse. HSCs occupy this space and play a prominent role in regulation and response to injury, storage of retinoic acid and immunoregulation of the liver 2.
SECs are among the most endocytically active cells of the body displaying an array of scavenger receptors on their cell surface 3. These include SR-A, Stabilin-1 and Stabilin-2. Generally, small colloidal particles less than 230 nm and macromolecules in buffer phase are taken up by SECs, whereas, large particles and cellular debris is endocytosed (phagocytosed) by KCs 4. Thus, the bulk clearance of extracellular material such as the glycosaminoglycans from blood is largely dependent on the health and endocytic functions of SECs 5,6. For example, an increase in blood hyaluronan levels is indicative of liver disease ranging from mild to more severe forms 7.
With the exception of one report 8, there are no immortalized SEC cell lines in existence. Even this immortalized cell line is de-differentiated in that it does not express scavenger receptors that are present on primary SECs (our data, not shown). All cell biological studies must be performed on primary cells obtained freshly from the animal. Unfortunately, SECs dedifferentiate under standard culture conditions and must be used within 1 or 2 days upon isolation from the animal. Differentiation of SECs is marked by the expression of Stabilin-2 or HARE receptor 9 , CD31, and the presence of cytoplasmic fenestration 1. Differentiation of SECs can be extended by the addition of VEGF in culture media or by culturing cells in hepatocyte conditioned medium 10,11.
In this report, we will demonstrate the endocytic activity of SECs in the intact organ using radio-labeled heparin for hyaluronan for the SEC-specific Stabilin-2 receptor. We will then purify hepatocytes and SECs from the perfused liver to measure endocytosis.

In vivo Liver Endocytosis Followed by Purification of Liver Cells by Liver Perfusion

The study of liver sinusoidal endothelial cells (SECs) must be performed with primary cells obtained from the animal as no cell lines exist. This method relies on liver digestion and differential centrifugation for SEC purification for subsequent culturing and experimentation.

Endocitose em Fígado vivo seguidos de purificação de células do fígado por perfusão de fígado

The liver is the metabolic center of the mammalian body and serves as a filter for the blood.  The basic architecture of the liver is illustrated in ...

A PCR-based Genotyping Method to Distinguish Between Wild-type and Ornamental Varieties of Imperata cylindrica

Wild-type I. cylindrica (cogongrass) is one of the top ten worst invasive plants in the world, negatively impacting agricultural and natural resources in 73 different countries throughout Africa, Asia, Europe, New Zealand, Oceania and the Americas1-2. Cogongrass forms rapidly-spreading, monodominant stands that displace a large variety of native plant species and in turn threaten the native animals that depend on the displaced native plant species for forage and shelter. To add to the problem, an ornamental variety [I. cylindrica var. koenigii (Retzius)] is widely marketed under the names of Imperata cylindrica 'Rubra', Red Baron, and Japanese blood grass (JBG). This variety is putatively sterile and noninvasive and is considered a desirable ornamental for its red-colored leaves. However, under the correct conditions, JBG can produce viable seed (Carol Holko, 2009 personal communication) and can revert to a green invasive form that is often indistinguishable from cogongrass as it takes on the distinguishing characteristics of the wild-type invasive variety4 (Figure 1). This makes identification using morphology a difficult task even for well-trained plant taxonomists. Reversion of JBG to an aggressive green phenotype is also not a rare occurrence. Using sequence comparisons of coding and variable regions in both nuclear and chloroplast DNA, we have confirmed that JBG has reverted to the green invasive within the states of Maryland, South Carolina, and Missouri. JBG has been sold and planted in just about every state in the continental U.S. where there is not an active cogongrass infestation. The extent of the revert problem in not well understood because reverted plants are undocumented and often destroyed.
Application of this molecular protocol provides a method to identify JBG reverts and can help keep these varieties from co-occurring and possibly hybridizing. Cogongrass is an obligate outcrosser and, when crossed with a different genotype, can produce viable wind-dispersed seeds that spread cogongrass over wide distances5-7. JBG has a slightly different genotype than cogongrass and may be able to form viable hybrids with cogongrass. To add to the problem, JBG is more cold and shade tolerant than cogongrass8-10, and gene flow between these two varieties is likely to generate hybrids that are more aggressive, shade tolerant, and cold hardy than wild-type cogongrass. While wild-type cogongrass currently infests over 490 million hectares worldwide, in the Southeast U.S. it infests over 500,000 hectares and is capable of occupying most of the U.S. as it rapidly spreads northward due to its broad niche and geographic potential3,7,11. The potential of a genetic crossing is a serious concern for the USDA-APHIS Federal Noxious Week Program. Currently, the USDA-APHIS prohibits JBG in states where there are major cogongrass infestations (e.g., Florida, Alabama, Mississippi). However, preventing the two varieties from combining can prove more difficult as cogongrass and JBG expand their distributions. Furthermore, the distribution of the JBG revert is currently unknown and without the ability to identify these varieties through morphology, some cogongrass infestations may be the result of JBG reverts. Unfortunately, current molecular methods of identification typically rely on AFLP (Amplified Fragment Length Polymorphisms) and DNA sequencing, both of which are time consuming and costly. Here, we present the first cost-effective and reliable PCR-based molecular genotyping method to accurately distinguish between cogongrass and JBG revert.

A PCR-based Genotyping Method to Distinguish Between Wild-type and Ornamental Varieties of Imperata cylindrica

We provide a cost-effective and rapid molecular genotyping protocol that employs variety-specific PCR primers that target DNA sequence differences within the chloroplast trnL-F spacer region to differentiate between varieties of Imperata cylindrica (cogongrass) that cannot be distinguished by morphology alone. These varieties include the federally listed noxious weed, cogongrass and closely-related, wide-spread ornamental variety, I. cylindrica var. koenigii (Japanese blood grass).

Um método de genotipagem baseados em PCR para distinguir entre variedades do tipo selvagem e Ornamental de Imperata cylindrica</em

Wild-type I. cylindrica (cogongrass) is one of the top ten worst invasive plants in the world, negatively impacting agricultural and natural resources in ...

Do-It-Yourself Device for Recovery of Cryopreserved Samples Accidentally Dropped into Cryogenic Storage Tanks

Liquid nitrogen is colorless, odorless, extremely cold (-196 &deg;C) liquid kept under pressure. It is commonly used as a cryogenic fluid for long term storage of biological materials such as blood, cells and tissues 1,2. The cryogenic nature of liquid nitrogen, while ideal for sample preservation, can cause rapid freezing of live tissues on contact - known as 'cryogenic burn'2, which may lead to severe frostbite in persons closely involved in storage and retrieval of samples from Dewars. Additionally, as liquid nitrogen evaporates it reduces the oxygen concentration in the air and might cause asphyxia, especially in confined spaces2.
In laboratories, biological samples are often stored in cryovials or cryoboxes stacked in stainless steel racks within the Dewar tanks1. These storage racks are provided with a long shaft to prevent boxes from slipping out from the racks and into the bottom of Dewars during routine handling. All too often, however, boxes or vials with precious samples slip out and sink to the bottom of liquid nitrogen filled tank. In such cases, samples could be tediously retrieved after transferring the liquid nitrogen into a spare container or discarding it. The boxes and vials can then be relatively safely recovered from emptied Dewar. However, the cryogenic nature of liquid nitrogen and its expansion rate makes sunken sample retrieval hazardous. It is commonly recommended by Safety Offices that sample retrieval be never carried out by a single person. Another alternative is to use commercially available cool grabbers or tongs to pull out the vials3. However, limited visibility within the dark liquid filled Dewars poses a major limitation in their use.
In this article, we describe the construction of a Cryotolerant DIY retrieval device, which makes sample retrieval from Dewar containing cryogenic fluids both safe and easy.

Here we present a low cost, durable cryotolerant device for sample retrieval from Dewar tanks filled with liquid nitrogen. The ease of construction and modular design of the device makes the process of sample retrieval from cryogenic tanks safe and easy.

Do-It-Yourself Dispositivo de Recuperação de amostras criopreservadas cair acidentalmente em Tanques de armazenamento criogênico

Liquid nitrogen is colorless, odorless, extremely cold (-196 &deg;C) liquid kept under pressure. It is commonly used as a cryogenic fluid for long term ...

Milk Collection Methods for Mice and Reeves' Muntjac Deer

Animal models are commonly used throughout research laboratories to accomplish what would normally be considered impractical in a pathogen&#8217;s native host. Milk collection from animals allows scientists the opportunity to study many aspects of reproduction including vertical transmission, passive immunity, mammary gland biology, and lactation. Obtaining adequate volumes of milk for these studies is a challenging task, especially from small animal models. Here we illustrate an inexpensive and facile method for milk collection in mice and Reeves&#8217; muntjac deer that does not require specialized equipment or extensive training. This particular method requires two researchers: one to express the milk and to stabilize the animal, and one to collect the milk in an appropriate container from either a Muntjac or mouse model. The mouse model also requires the use of a P-200 pipetman and corresponding pipette tips. While this method is low cost and relatively easy to perform, researchers should be advised that anesthetizing the animal is required for optimal milk collection.

Milk collection from animal models facilitates various research avenues: understanding passive immunity, identifying pathogens responsible for vertical transmission and, through the use of transgenic mice, even commercial production of proteins found in human breast milk. Here we illustrate a simple method for milk collection in mice and Reeves&#8217; muntjac deer.

Métodos de coleta de leite para Ratos e Reeves Muntjac cervos

Animal models are commonly used throughout research laboratories to accomplish what would normally be considered impractical in a pathogen&#8217;s native ...

Determination of Fatty Acid Oxidation and Lipogenesis in Mouse Primary Hepatocytes

Lipid metabolism in liver is complex. In addition to importing and exporting lipid via lipoproteins, hepatocytes can oxidize lipid via fatty acid oxidation, or alternatively, synthesize new lipid via de novo lipogenesis. The net sum of these pathways is dictated by a number of factors, which in certain disease states leads to fatty liver disease. Excess hepatic lipid accumulation is associated with whole body insulin resistance and coronary heart disease. Tools to study lipid metabolism in hepatocytes are useful to understand the role of hepatic lipid metabolism in certain metabolic disorders.
In the liver, hepatocytes regulate the breakdown and synthesis of fatty acids via &#946;-fatty oxidation and de novo lipogenesis, respectively. Quantifying metabolism in these pathways provides insight into hepatic lipid handling. Unlike in vitro quantification, using primary hepatocytes, making measurements in vivo is technically challenging and resource intensive. Hence, quantifying &#946;-fatty acid oxidation and de novo lipogenesis in cultured mouse hepatocytes provides a straight forward method to assess hepatocyte lipid handling. 
Here we describe a method for the isolation of primary mouse hepatocytes, and we demonstrate quantification of &#946;-fatty acid oxidation and de novo lipogenesis, using radiolabeled substrates.

De novo lipogenesis and &#946;-fatty acid oxidation constitute key metabolic pathways in hepatocyte, pathways that are perturbed in several metabolic disorders, including fatty liver disease. Here we demonstrate isolation of mouse primary hepatocytes and describe quantification of &#946;-fatty acid oxidation and lipogenesis.

Determinação da oxidação de ácidos gordos e Lipogênese em Rato Os hepatócitos primária

Lipid metabolism in liver is complex. In addition to importing and exporting lipid via lipoproteins, hepatocytes can oxidize lipid via fatty acid ...

Milk Collection in the Rat Using Capillary Tubes and Estimation of Milk Fat Content by Creamatocrit

Milk, as the sole source of nutrition for the newborn mammal, provides the necessary nutrients and energy for offspring growth and development. It also contains a vast number of bioactive compounds that greatly affect the development of the neonate. The analysis of milk components will help elucidate key factors that link maternal metabolism and health with offspring growth and development. The laboratory rat represents a popular model organism for maternal studies, and rat milk can be used to examine the effect of various maternal physiological, nutritional, and pharmacological interventions on milk components, which may then impact offspring health. Here a simple method of manually collecting milk from the lactating rat that can be performed by a single investigator, does not require specialized vacuum or suction equipment, and provides sufficient milk for subsequent downstream analysis is described. A method for estimating the fat content of milk by measuring the percentage of cream within the milk sample, known as the creamatocrit, is also presented. These methods can ultimately be used to increase insight into maternal-child health and to elucidate maternal factors that are involved in proper growth and development of offspring.

Milk is a primary source of nutrition for the neonate. Analysis of milk components may provide insight into maternal factors that affect offspring health. This protocol describes a manual method of collecting milk samples from the lactating rat, which can then be used for further downstream analysis.

Coleta de Leite no Rato Usando Capilar Tubos e Estimativa da gordura do leite por conteúdo crematócrito

Milk, as the sole source of nutrition for the newborn mammal, provides the necessary nutrients and energy for offspring growth and development. It also ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 &#181;l whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

We describe here a simple and rapid paper-based DNA extraction method of HIV proviral DNA from whole blood detected by quantitative PCR. This protocol can be extended for use in detecting other genetic markers or using alternative amplification methods.

Isolamento de filtração de Ácidos Nucleicos: Um Método de extracção de DNA simples e rápido

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...

Determinação de ácidos sialic em amostras de fígado e leite de tipo selvagem e

Resumo

Explore mais vídeos

Capítulos neste vídeo