A Quantitative Detection Method for MicroRNAs in the Kidney of an Ischemic Kidney Injury Mouse Model

Резюме

This article presents a protocol for detecting microRNA expression in the kidneys of an acute kidney injury mouse model using quantitative real-time reverse-transcription polymerase chain reaction. This protocol emphasizes an ischemic kidney injury mouse model and the careful extraction of microRNA samples.

Аннотация

MicroRNAs (miRNAs) are involved in various disease states and are effective biomarkers for the early diagnosis of diseases and treatment in mice. However, standard protocols for the purification of miRNAs and detection of their expression in the kidneys of acute kidney injury (AKI) mice have not been well established. This study developed an effective and simple protocol to purify and quantify miRNAs in the kidneys of an AKI mouse model induced by renal ischemia-reperfusion using quantitative real-time reverse-transcription polymerase chain reaction (qRT-PCR). This protocol comprises five steps: 1) induction of AKI by renal ischemia-reperfusion, 2) harvesting of kidneys, 3) purification of total RNA, including miRNAs, from kidneys, 4) cDNA synthesis by reverse transcription of miRNA, and 5) qRT-PCR to detect miRNA expression. Using this protocol, the renal ischemia-reperfusion injury model can be generated with mild to severe forms of AKI. Additionally, if the procedure is followed properly, a consistent AKI model with minimal individual differences can be obtained. This qRT-PCR assay shows a very wide dynamic range and enables the discrimination of mature miRNAs, which can be accurately quantified with high specificity. This protocol can be used to study the miRNA expression profile in AKI kidneys.

Введение

Ischemia-reperfusion injury (IRI) of the kidney represents one of the major risk factors for Acute kidney injury (AKI) development¹. AKI plays a significant role in patient prognosis, but specific therapies and early diagnostic biomarkers have not been established.

MicroRNAs (miRNAs) are short, non-coding RNAs with approximately 18–25 bases. miRNAs are stable in body fluids, and their sequences are highly conserved among animals². MiRNAs regulate the expression of multiple proteins through thousands of targets, thereby influencing diverse signaling pathways^{2,3,4,5,6,7,8}. In recent years, it has been reported that miRNAs are involved in various disease states and are effective biomarkers for the early diagnosis of several diseases.

The overall goal of this protocol is to successfully purify and detect miRNAs in the kidneys of an AKI mouse model induced by IRI. This IRI model is a widely used model of AKI and renal fibrosis. The advantages of the IRI model include being able to visually confirm whether ischemia-reperfusion has been achieved and determine the exact time of AKI onset. However, a clamp duration that is long enough to cause broad tubular damage is associated with a high mortality rate, whereas a short clamp duration does not cause tubular damage, which results in a large variation in tubular damage progression in this experimental model. Compared with the bilateral clamping model, the right nephrectomy tissue harvested in the unilateral renal IRI model acts as a control and ensures renal failure.

The kidney sample is mashed using a glass homogenizer, wherein, proteins and nucleic acids are separated, and DNA and RNA are separated⁹. Total RNA, including miRNA, is purified from the kidney sample using a silica-membrane-based spin column⁹. Subsequently, cDNA synthesis (reverse transcription) is performed from total RNA using poly(A) polymerase and oligo-dT primers¹⁰. Finally, the miRNA expression is determined by qRT-PCR using an intercalating dye¹⁰. qRT-PCR can more accurately quantify gene expression compared with PCR of amplification volumes at endpoints. qRT-PCR measures high concentrations and is characterized by a wide dynamic range, which allows accurate quantification that depends on the number of cycles. Previous studies reported that simple processes could be used to effectively purify and detect miRNAs in tissues^8,9,10. The methods described in this protocol for cDNA synthesis (reverse transcription) and the detection of miRNA expression by qRT-PCR using an intercalating dye have been reported to show high accuracy and sensitivity¹⁰.

Additionally, this protocol is simple and achieves consistent results between laboratories. Therefore, this protocol is useful in studies that require highly accurate and sensitive miRNA detection in mouse AKI kidneys.

протокол

All animal experimental protocols were approved by the animal ethics committee of Jichi Medical University and performed in accordance with the Use and Care of Experimental Animals guidelines from the Jichi Medical University Guide for Laboratory Animals.

1. IRI model

NOTE: Carefully monitor for hypothermia, intestinal moisturization, and depth of anesthesia throughout the procedure.

1. Prepare the following items: a 50 mL centrifuge tube containing cotton drenched in isoflurane, a heated surgical pad, a Petri dish with phosphate-buffered saline (PBS), surgical scissors, and forceps. Maintain the PBS at 37 °C.
   NOTE: This IRI model was generated using male C57BL/6 mice (9 weeks; 20–25 g) housed in a room with controlled temperature, humidity, and a 12 h light-dark cycle.
2. Anesthetize the animal using isoflurane: induction concentration 3%–5%, maintenance concentration 2%–3%, and concentration during clamping 1%–1.5%. Confirm the depth of anesthesia by the loss of reflexes. Inhalation anesthesia has the advantage that the time can be adjusted. The procedure might take a significant amount of time because of the exfoliation of the tissue surrounding the kidney. However, the disadvantage of inhalation anesthesia is that the body temperature tends to fall. Throughout the procedure, avoid unnecessary anesthesia.
3. Mount the anesthetized mouse on a heated surgical pad on its back, remove the hair surrounding the incision area, and spray the abdominal skin of the mouse with 70% ethanol.
4. Make a midline incision in the abdominal skin, muscle, and peritoneal membrane using scissors and forceps.
5. Using a cotton swab moistened with PBS, gently push the bowel toward the left side of the extra-abdominal cavity, exposing the right kidney and ureter. The long procedure time is likely to cause postoperative intestinal injury. Thus, it is better to operate without removing the intestines from the abdominal cavity when a visual field can be obtained. Avoid drying out the intestines. Dry swabs or gauze can cause intestinal damage.
6. Lift the right ureter with angled forceps. Ligate the right ureter twice using 4/0 silk-braided sutures. Cut between the sutures, leaving the suture that is closer to the kidney longer.
7. Carefully hold the remaining suture without pulling too much, and bluntly dissect the connective tissue and fat along the kidney. Performing surgery from behind reduces the risk of liver damage.
   1. Identify a blood vessel, other than the renal arteries and veins, that supplies blood to the right kidney, and then ligate or clip it. When the right kidney is sufficiently detached, ligate the right renal artery and vein using a 4/0 silk-braided suture. Instead of suturing, use a hemostatic clip.
   2. Using a cotton swab moistened with PBS, gently push the intestine towards the right side of the extra-abdominal cavity to expose the left kidney, and then cover the intestine with a moistened drape to prevent it from drying out. Dissect the connective tissue and fat around the left kidney.
8. Identify a blood vessel, other than the renal arteries and veins, that supplies blood to the left kidney, and then ligate or clip it. Clamp the renal artery and renal vein to induce left kidney ischemia. Position the hemostatic clip approximately 1 cm from the kidney to avoid damage to the renal parenchyma. Successful ischemia can be visually confirmed by a gradual uniform darkening of the kidney.
9. Return the intestines to the abdominal cavity, taking care to avoid intestinal twisting; temporarily close the abdominal skin and drape to maintain a moist environment. Reduce the concentration of inhalation anesthesia as much as possible and try to keep the animal warm. The clamping time is 25–45 min. A longer clamping time induces more severe renal damage but also increases long-term mortality. Adjust by analyzing the pathology results.
10. Remove the clamp after the period of ischemia has concluded. Ensure that blood flow reperfusion and kidney color improve. Confirm that the bowel is not twisted before closing the abdominal skin. Instill PBS intraperitoneally as a volume supplement before the abdomen is closed in two layers. Close the abdominal skin using 4-0 nylon sutures. For longer renal removal periods, the possibility of intestinal adhesions may be reduced by separately closing the abdominal wall and peritoneum.
11. To minimize the risk of post-operative infection, apply an antiseptic (e.g., iodine/alcohol solution) to the surgical area.

2. Kidney sample collection

NOTE: This video has a 45 min clamping time, collecting the kidneys 24 h later.

1. Anesthetize the animal with 5% isoflurane and confirm the depth of anesthesia by the loss of reflexes.
2. Make a midline incision in the abdominal skin, muscle, and peritoneal membrane using scissors and forceps. Collect the blood from the inferior vena cava punctured by a 27 G needle.
3. Make a midline incision in the chest wall and insert a 23 G needle into the left ventricle. Confirm backflow. Make an incision in the liver and inject 20 mL of PBS. As the blood drains, the liver changes color from red to pink, confirming that sufficient blood has been drained.
4. Remove the left kidney using forceps and scissors and wash it with PBS in a Petri dish. Remove the renal fascia using forceps, being careful not to dry out the kidney.
5. Cut the kidney in half and use one half for histopathology and the other half for the next step. Avoid the renal pelvis, and harvest 30 mg of the kidney. Store this at −80 °C before use.

3. Purifying miRNAs from kidney samples

NOTE: Here, kidney samples weighing 30 mg are homogenized using a glass homogenizer and a biopolymer-shredding system in a microcentrifuge spin column. Subsequently, miRNA from the kidney sample is isolated using a silica-membrane-based spin column.

1. Prepare the following items: 1.5 or 2.0 mL microcentrifuge tubes, 100% ethanol, chloroform, a glass homogenizer, ice, a biopolymer-shredding system in a microcentrifuge spin column⁹, silica-membrane-based spin columns⁹, phenol/guanidine-based lysis reagent, wash buffer containing guanidine and ethanol (wash buffer 1), and wash buffer containing ethanol (wash buffer 2).
2. Place a 30 mg kidney sample into a glass homogenizer and add 700 µL of phenol/guanidine-based lysis reagent. Perform this step on ice because the tissue is denatured by heat.
3. Homogenize the kidney sample by slowly pressing the pestle onto the sample by twisting it. Repeat this process several dozen times on ice until the kidney sample has completely dissolved into the phenol/guanidine-based lysis reagent. When miRNA is not obtained in subsequent measurements, this is likely because of insufficient dissolving.
4. For further homogenization, transfer the homogenized lysate to the biopolymer-shredding system in a microcentrifuge spin column placed in a 2.0 mL collection tube. Centrifuge this at 14,000 × g for 3 min at room temperature.
5. Transfer the homogenized lysate to a new microcentrifuge tube.
6. Add 140 µL of chloroform to the homogenized lysate and cap the tube securely. Mix the tube by inversion for 15 s.
7. Incubate the samples for 2–3 min at room temperature. Then, centrifuge them at 12,000 × g for 15 min at 4 °C.
8. Transfer the supernatant (normally 300 µL) to a new microcentrifuge tube without disturbing the precipitate and add 1.5 volumes (normally 450 µL) of 100% ethanol. Mix the sample by vortexing for 5 s.
9. Pipette up to 700 µL of the sample into a silica-membrane-based spin column placed in a 2.0 mL collection tube. Close the column cap, and centrifuge at 15,000 × g for 15 s. Following centrifugation, discard the flow-through in the collection tube.
10. Add 700 µL of wash buffer 1 to the silica-membrane-based spin column to thoroughly wash the sample. Close the cap of the column, and centrifuge it at 15,000 × g for 15 s. Following centrifugation, discard the flow-through in the collection tube.
11. Add 500 µL of wash buffer 2 to the silica-membrane-based spin column to remove any traces of salt. Close the cap of the column, and centrifuge at 15,000 × g for 15 s. Following centrifugation, discard the flow-through in the collection tube.
    1. Repeat step 3.11.
12. Centrifuge the silica-membrane-based spin column again at 15,000 × g for 1 min. Following centrifugation, discard the flow-through in the collection tube.
13. Place the silica-membrane-based spin column in a new 1.5 mL collection tube. Transfer 25 µL of RNase-free water into the column, and close the column cap. Leave the sample at room temperature for 5 min, and then centrifuge it at 15,000 × g for 1 min.
14. Transfer the 25 µL eluate containing miRNAs to a new microcentrifuge tube. Because miRNA is degraded by repeated dissolution, it is recommended to dispense the sample into 2 or 3 tubes. Store these at −80 °C before use.

4. Reverse transcription of miRNA

NOTE: Here, 1.0 µg of isolated RNA is reverse-transcribed using reverse transcriptase, poly(A) polymerase, and oligo-dT primers.

1. Prepare the following items: 1.5 mL microcentrifuge tubes; 8-well strip tubes; RNase-free water; ice; a 10x Nucleic Acid Mix containing deoxynucleotides, ribonucleotide triphosphates, and oligo-dT primers; a poly(A) polymerase and reverse transcriptase mix; and activating buffer, including Mg²⁺, deoxyribonucleotides, oligo-dT primers, and random primers¹⁰.
2. Prepare a master mix solution containing 2.0 µL of 10x Nucleic Acid Mix, 2.0 µL of poly(A) polymerase and reverse transcriptase mix, and 4.0 µL of 5x activating buffer, including Mg²⁺, deoxyribonucleotides, oligo-dT primers, and random primers, for a total of 8.0 µL per tube.
3. Dispense 8.0 µL of the master mix solution into each tube.
4. Add 1.0 µg of isolated miRNAs purified from the kidney sample to each tube.
5. Add RNase-free water to each tube to a total of 20 µL. Mix thoroughly by pipetting, and centrifuge at 1,500 x g for 15 s.
6. Incubate the samples for 60 min at 37 °C, followed immediately by incubation for 5 min at 95 °C. This step can be performed in a thermal cycler.
7. Transfer the cDNA to a new microcentrifuge tube and dilute 10 times (1:10) with RNase-free water.
8. Store the diluted cDNA short term on ice and long term at −80 °C before use.

5. qRT-PCR of miRNA

NOTE: qRT-PCR of miRNA is performed using an intercalating dye. Here, primers for U6 small nuclear 2 (RNA-2), miRNA-17-5p, miRNA-18a-5p, miRNA-21a-5p, miRNA-132-3p, miRNA-212-3p, miRNA-223-3p, and miRNA-574-5p were used.

1. Prepare the following items: 1.5 mL microcentrifuge tubes, 96-well reaction plates for qRT-PCR, adhesive film for the 96-well reaction plate, miRNA-specific primers, PCR Master Mix comprising Taq DNA polymerase, PCR buffer, deoxynucleotides, and universal primers¹⁰, and a real-time PCR Instrument.
2. Prepare a master mix containing 12.5 µL of 2x PCR Master Mix, 2.5 µL of each miRNA primer (5 µM) dissolved in nuclease-free water, and 1.25 µL of 10x universal primers for each well.
3. Dispense 22.5 µL of the master mix into each well of the 96-well plate.
4. Add 2.5 µL of template cDNA to each well.
5. Seal the plate with the adhesive film for the 96-well reaction plate. Then, centrifuge the plate at 1,000 × g for 30 s.
6. Using the real-time PCR instrument and software, run the PCR cycling program as follows.
   1. Place the plate in the real-time PCR instrument. Assign a name to the sample and target miRNA in each well using the Real-Time PCR software.
   2. Input the following PCR cycling conditions in the real-time PCR software according to the instructions: preincubation at 95 °C for 15 min, followed by 40 cycles of denaturation at 94 °C for 15 s, annealing at 55 °C for 30 s, and extension at 70 °C for 30 s.
7. Analyze the qRT-PCR data using the software of the real-time PCR instrument. Check for non-specific reactions. Analyze the Dissociation curve or the Melt curve to confirm that amplification other than the intended one has not occurred.
   1. Normalize the expression level of target miRNAs to RNU-6 as an endogenous control. Calculate the relative expression level of target miRNAs using the 2^−ΔΔCT method¹¹.

Результаты

Here, the miRNA expression profile in AKI mice was investigated. The miRNA expression profile has been investigated in various organs and tissues in mice. MiRNAs are important post-transcriptional regulators and are now being extensively studied in the characterization of a variety of diseases, including AKI. MiRNAs have the potential to help elucidate pathological conditions and be applied to the treatment of AKI¹². The major causes of AKI are IRI, nephrotoxic insult, and sepsis. IRI of the kidne...

Обсуждение

Using the protocol presented in this manuscript, miRNAs from the kidney of IRI mice were successfully purified and detected using qRT-PCR. Critical points of the IRI-inducing procedure in the protocol include careful monitoring of body temperature and anesthesia concentrations, which are known to affect AKI²⁰. The strength of this protocol is that it allows visual confirmation of whether ischemia-reperfusion has been achieved. However, there are some limitations to this IRI model. Prolonging the c...

Материалы

Name	Company	Catalog Number	Comments
Bent Tip Tapered Tweezers without Hook	Natsume Seisakusho	MA-47
Buffer RLT	Qiagen	79216	wash buffer 1
Buffer RWT	Qiagen	1067933	wash buffer 2
C57B6 mice	SLC	not assign
forcep with Teeth	Natsume Seisakusho	MA-49
forcep without Teeth	Natsume Seisakusho	MA-48-1
Hemostatic clips	Natsume Seisakusho	KN−353
MicroAmp Optical 96 well reaction plate for qRT-PCR	Thermo Fisher Scientific	4316813	96-well reaction plate
MicroAmp Optical Adhesive Film	Thermo Fisher Scientific	4311971	adhesive film for 96-well reaction plate
miRNA-132-3p primer	Qiagen	MS00003458	5'UAACAGUCUACAGCCAUGGUCG
miRNA-17-5p primer	Qiagen	MS00029274	5'CAAAGUGCUUACAGUGCAGGUAG
miRNA-18a-5p primer	Qiagen	MS00031514	5'UAAGGUGCAUCUAGUGCAGAUAG
miRNA-212-3p primer	Qiagen	MS00003815	5'UAACAGUCUCCAGUCACGGCC
miRNA-21a-5p primer	Qiagen	MS00009079	5'UAGCUUAUCAGACUGAUGUUGA
miRNA-223-3p primer	Qiagen	MS00003871	5'UGUCAGUUUGUCAAAUACCCCA
miRNA-574-5p primer	Qiagen	MS00043617	5'UGAGUGUGUGUGUGUGAGUGUGU
miRNeasy Mini kit	Qiagen	217004	silica-membrane based spin column
miScript II RT kit	Qiagen	218161
miScript SYBR Green PCR kit	Qiagen	218073
QIA shredder	Qiagen	79654	biopolymer-shredding system in a micro centrifuge spin-column
QIAzol Lysis Reagent	Qiagen	79306	phenol/guanidine-based lysis reagent
QuantStudio 12K Flex Flex Real-Time PCR system	Thermo Fisher Scientific	4472380	real-time PCR instrument
QuantStudio 12K Flex Software version 1.2.1.	Thermo Fisher Scientific	4472380	real-time PCR instrument software
RNU6-2 primer	Qiagen	MS00033740	not disclosed
surgical scissors	Natsume Seisakusho	B-2
Vascular clip applier	VITALITEC	1621420