JoVE Logo
Faculty Resource Center

Sign In

Summary

Abstract

Introduction

Protocol

Representative Results

Discussion

Acknowledgements

Materials

References

Immunology and Infection

Quantitative PCR of T7 Bacteriophage from Biopanning

Published: September 27th, 2018

DOI:

10.3791/58165

1Division of Molecular Pharmaceutics and Drug Delivery, College of Pharmacy, University of Texas at Austin

A reproducible, accurate, and time efficient quantitative PCR (qPCR) method to enumerate T7 bacteriophage is described here. The protocol clearly describes phage genomic DNA preparation, PCR reaction preparation, qPCR cycling conditions, and qPCR data analysis.

This protocol describes the use of quantitative PCR (qPCR) to enumerate T7 phages from phage selection experiments (i.e., "biopanning"). qPCR is a fluorescence-based approach to quantify DNA, and here, it is adapted to quantify phage genomes as a proxy for phage particles. In this protocol, a facile phage DNA preparation method is described using high-temperature heating without additional DNA purification. The method only needs small volumes of heat-treated phages and small volumes of the qPCR reaction. qPCR is high-throughput and fast, able to process and obtain data from a 96-well plate of reactions in 2–4 h. Compared to other phage enumeration approaches, qPCR is more time-efficient. Here, qPCR is used to enumerate T7 phages identified from biopanning against in vitro cystic fibrosis-like mucus model. The qPCR method can be extended to quantify T7 phages from other experiments, including other types of biopanning (e.g., immobilized protein binding, in vivo phage screening) and other sources (e.g., water systems or body fluids). In summary, this protocol can be modified to quantify any DNA-encapsulated viruses.

Bacteriophage (phage) display technology, developed by George Smith in 1985, is a powerful, high-throughput approach to identify peptide or protein ligands against targets or receptors from the cell membrane, disease antigens, cellular organelles or specific organs and tissues in the past two decades1,2. Here, random libraries of polypeptides or single chain antibodies are displayed on the coat proteins of phages (typically M13 or T7), and specific ligands can be identified from panning against immobilized proteins in vitro or in vivo biological systems through an iterative selection process.....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

1. Primer Design and Analysis for T7 Phage Genomic DNA

  1. Design primers for amplification of T7 phage genomic DNA.
    NOTE: F (forward) and R (reverse) primers (see Table of Materials) amplify the T7 DNA sequence located upstream of the library variable region (Figure 1).
  2. Choose an appropriate primer analyzer to evaluate parameters of the primers, including melting temperature (Tm), percent GC content (GC%), primer dimers, hairpin formation and PCR su.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Different primer design tools can be used to design qPCR primers. Typically, primer design programs have their own built-in algorithms to calculate and validate the key parameters of the primers, e.g., GC%, Tm, primer dimer or hairpin formation, etc. Generally, the key criteria are similar in different primer design tools, and primers can be designed following their instructions. Primer BLAST can be used to confirm the specificity of the primers. One primer pair that tar.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

We developed qPCR methods to quantify phage genomic DNA5, and here we described and adapted a qPCR method to enumerate T7 phages selected against a CF-like mucus barrier. Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines were adapted to develop and validate the qPCR method for enumeration of T7 phages15. The protocol we developed to quantify phages from biopanning experiments is a time-efficient, reliable, and economical approac.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

This work was supported by PhRMA Foundation Research Starter Grant and the National Heart, Lung, and Blood Institute of the National Institutes of Health grant under award number R01HL138251.

....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Name Company Catalog Number Comments
Materials and reagents
Primers for T7 genomic DNA IDT F: CCTCTTGGGAGGAAGAGATTTG
R: TACGGGTCTCGTAGGACTTAAT
T7Select packaging control DNA EMD Millipore 69679-1UG
MicroAmp optical 96-well reaction plate ThermoFisher Scientific N8010560
qPCR master mix--Power up SYBR Green master mix Applied biosystems A25742
MicroAmp optical adhesive film kit ThermoFisher Scientific 4313663
T7Select 415-1 Cloning Kit EMD Millipore 70015 User protocols : http://www.emdmillipore.com/US/en/product/T7Select-415-1-Cloning-Kit,EMD_BIO-70015#anchor_USP
DNase I solution ThermoFisher Scientific 90083
24-well transwell plate Corning 3472
UltraPure DNase/RNase-Free Distilled H2O Invitrogen 10977015
Phosphate Buffered Saline (1X) Corning 21040CV
Name Company Catalog Number Comments
Equipments
ViiA7 Real-Time PCR System with Fast 96-Well Block ThermoFisher Scientific 4453535
Heraeus Pico 21 Microcentrifuge ThermoFisher Scientific 75002415
Fisherbrand Digital Vortex Mixer Fisher Scientific 02-215-370
HERMO SCIENTIFIC Multi-Blok Heater ThermoFisher Scientific Model:2001
Sorvall Legend X1 Centrifuge ThermoFisher Scientific 75004220
M-20 Microplate Swinging Bucket Rotor ThermoFisher Scientific 75003624
Name Company Catalog Number Comments
Software
QuantStudio Real-time PCR software ThermoFisher Scientific v1.2
Real-time qPCR primer design IDT
OligoAnalyzer 3.1 IDT

  1. Smith, G. Filamentous fusion phage: novel expression vectors that display cloned antigens on the virion surface. Science. 228 (4705), 1315-1317 (1985).
  2. Smith, G. P., Petrenko, V. A. Phage Display. Chemical Reviews. 97 (96), 391-410 (1997).
  3. Sergeeva, A., Kolonin, M. G., Molldrem, J. J., Pasqualini, R., Arap, W. Display technologies: Application for the discovery of drug and gene delivery agents. Advanced Drug Delivery Reviews. 58 (15), 1622-1654 (2006).
  4. Dias-Neto, E., et al. Next-generation phage display: Integrating and comparing available molecular tools to enable costeffective high-throughput analysis. PLoS ONE. 4 (12), 1-11 (2009).
  5. Peng, X., Nguyen, A., Ghosh, D. Quantification of M13 and T7 bacteriophages by TaqMan and SYBR green qPCR. Journal of Virological Methods. 252 (June 2017), 100-107 (2017).
  6. Khan, M. S., Pande, T., Mvan de Ven, T. G. Qualitative and quantitative detection of T7 bacteriophages using paper based sandwich ELISA. Colloids and Surfaces B: Biointerfaces. 132, 264-270 (2015).
  7. Brasino, M., Lee, J. H., Cha, J. N. Creating highly amplified enzyme-linked immunosorbent assay signals from genetically engineered bacteriophage. Analytical Biochemistry. 470, 7-13 (2014).
  8. Yu, X., Burgoon, M., Shearer, A., Gilden, D. Characterization of phage peptide interaction with antibody using phage mediated immuno-PCR. J immunol Methods. 326 (1-2), 33-40 (2007).
  9. Lehmusvuori, A., Manninen, J., Huovinen, T., Soukka, T., Lamminmäki, U. Homogenous M13 bacteriophage quantification assay using switchable lanthanide fluorescence probes. BioTechniques. 53 (5), 301-303 (2012).
  10. Schlaman, H. R. M., et al. Analysis of interactions of signaling proteins with phage-displayed ligands by fluorescence correlation spectroscopy. Journal of Biomolecular Screening. 13 (8), 766-776 (2008).
  11. Tjhung, K. F., Burnham, S., Anany, H., Griffiths, M. W., Derda, R. Rapid enumeration of phage in monodisperse emulsions. Analytical Chemistry. 86 (12), 5642-5648 (2014).
  12. Reitinger, S., Petriv, O. I., Mehr, K., Hansen, C. L., Withers, S. G. Purification and quantitation of bacteriophage M13 using desalting spin columns and digital PCR. Journal of Virological Methods. 185 (1), 171-174 (2012).
  13. . T7Select® Biopanning Kit Available from: https://www.emdmillipore.com/US/en/product/T7Select-Biopanning-Kit (2018)
  14. Schneider, A., Hommel, G., Blettner, M. Linear Regression Analysis. Deutsches Ärzteblatt international. 107 (44), 776-782 (2010).
  15. Bustin, S. A., Benes, V., Garson, J. A., Hellemans, J., Huggert, J. The MIQE Guidelines: Minimun information for publication of quantitative real-time PCR experiments. Clinical Chemitry. 55 (4), 611-622 (2009).
  16. Lock, M., Alvira, M. R., Chen, S. -. J., Wilson, J. M. Absolute Determination of Single-Stranded and Self-Complementary Adeno-Associated Viral Vector Genome Titers by Droplet Digital PCR. Human Gene Therapy Methods. 25 (2), 115-125 (2014).
  17. Fittipaldi, M., et al. Discrimination of infectious bacteriophage T4 virus by propidium monoazide real-time PCR. Journal of Virological Methods. 168 (1-2), 228-232 (2010).
  18. Lodder, W. J., et al. Reduction of bacteriophage MS2 by filtration and irradiation determined by culture and quantitative real-time RT-PCR. Journal of Water and Health. 11 (2), 256-266 (2013).
  19. Brown-Jaque, M., et al. Antibiotic resistance genes in phage particles isolated from human feces and induced from clinical bacterial isolates. International Journal of Antimicrobial Agents. , (2017).
  20. Naveca, F. G., et al. Multiplexed reverse transcription real-time polymerase chain reaction for simultaneous detection of Mayaro, Oropouche, and oropouche-like viruses. Memorias do Instituto Oswaldo Cruz. 112 (7), 510-513 (2017).
  21. Jia, J., et al. Simultaneous detection and differentiation of human parvovirus B19 and human parvovirus 4 by an internally controlled multiplex quantitative real-time PCR. Molecular and Cellular Probes. 36, 50-57 (2017).
  22. Bliem, R., et al. A novel triplex quantitative pcr strategy for quantification of toxigenic and nontoxigenic Vibrio cholerae in aquatic environments. Applied and Environmental Microbiology. 81 (9), 3077-3085 (2015).
  23. Wan, Z., Goddard, N. L. Competition Between Conjugation and M13 Phage Infection in Escherichia coli in the Absence of Selection Pressure: A Kinetic Study. G3 Genes|Genomes|Genetics. 2 (10), 1137-1144 (2012).

This article has been published

Video Coming Soon

JoVE Logo

Privacy

Terms of Use

Policies

Research

Education

ABOUT JoVE

Copyright © 2024 MyJoVE Corporation. All rights reserved