Overexpressing Long Noncoding RNAs Using Gene-activating CRISPR

Summary

Traditional cDNA-based overexpression techniques have a limited applicability for the overexpression of long noncoding RNAs due to their multiple splice forms with potential functionality. This review reports a protocol using CRISPR technology to overexpress multiple splice variants of a long noncoding RNA.

Abstract

Long noncoding RNA (lncRNA) biology is a new and exciting field of research, with the number of publications from this field growing exponentially since 2007. These studies have confirmed that lncRNAs are altered in almost all diseases. However, studying the functional roles for lncRNAs in the context of disease remains difficult due to the lack of protein products, tissue-specific expression, low expression levels, complexities in splice forms, and lack of conservation among species. Given the species-specific expression, lncRNA studies are often restricted to human research contexts when studying disease processes. Since lncRNAs function at the molecular level, one way to dissect lncRNA biology is to either remove the lncRNA or overexpress the lncRNA and measure cellular effects. In this article, a written and visualized protocol to overexpress lncRNAs in vitro is presented. As a representative experiment, an lncRNA associated with inflammatory bowel disease, Interferon Gamma Antisense 1 (IFNG-AS1), is shown to be overexpressed in a Jurkat T-cell model. To accomplish this, the activating clustered regularly interspaced short palindromic repeats (CRISPR) technique is used to enable overexpression at the endogenous genomic loci. The activating CRISPR technique targets a set of transcription factors to the transcriptional start site of a gene, enabling a robust overexpression of multiple lncRNA splice forms. This procedure will be broken down into three steps, namely (i) guide RNA (gRNA) design and vector construction, (ii) virus generation and transduction, and (iii) colony screening for overexpression. For this representative experiment, a greater than 20-fold enhancement in IFNG-AS1 in Jurkat T cells was observed.

Introduction

While most biomedical research has focused on protein-coding transcripts, the majority of transcribed genes actually consists of noncoding RNAs (Ensembl release 93).Current research is beginning to explore this field, with the number of publications on lncRNAs in disease processes rising exponentially between 2007 and 2017¹. These publications demonstrate that many lncRNAs are associated with disease. However, the molecular mechanisms of these lncRNAs are difficult to study due to their diverse functions as compared to mRNAs. Compounding the problem of understanding the role of lncRNAs in disease, lncRNAs are often expressed at lower levels tha....

Protocol

NOTE: It is important to note that this protocol uses replication-deficient lentiviruses. Perform viral handling only after appropriate lab safety training. Bleach all items and surfaces that come in contact with live viruses for a minimum of 10 min after handling. Use a disposable lab coat and face/eye protection, as well as double gloves, at all times. Perform virus work in biosafety level 2+ labs with viral certification. Dedicate tissue culture hoods and incubators to viral work.

Discussion

This manuscript presents a protocol for using activating CRISPR to overexpress lncRNAs in vitro. This is an especially important technique when studying long noncoding RNAs as the transcriptomic product is the functional unit. After overexpression, the researcher can, then, use these cells to increase the signal-to-noise ratio when studying binding partners and even measure the cellular consequences of increased levels of lncRNAs. Additionally, as lncRNAs frequently act on cis-genes, this endogenous overexpression techni.......

Materials

Name	Company	Catalog Number	Comments
Ampicillin	Fisher Scientific	BP1760-5
CaCl2	Sigma Aldrich	C1016
cDNA synthesis kit (iScript)	BioRad	1708891
dCas9 forward primer	Integrated DNA Technologies	n/a	5'-TCGCCACAGCATAAAGAAGA
dCas9 reverse primer	Integrated DNA Technologies	n/a	5'-CTTTTCATGGTACGCCACCT
dCas9 vector	Addgene	50918
DMEM	Corning	10013CM
Ethanol	Acros Organics	61509-0010
FBS	Sigma Aldrich	F2442
gRNA plasmid	VectorBuilder	VB180119-1195qxv
HEK293T cells	ATCC	CRL-1573
HEPES	Sigma Aldrich	H3375
HPRT1 forward primer	Integrated DNA Technologies	n/a	GACCAGTCAACAGGGGACAT
HPRT1 reverse primer	Integrated DNA Technologies	n/a	GCTTGCGACCTTGACCATCT
Hygromycin B	Corning	MT3024CR
Isopropanol	Fisher Scientific	BP2618-500
Jurkat cells	ATCC	TIB-152	clone E6-1
L-glutamine	Corning	25005Cl
LB agar	Fisher Scientific	BP1425-500
LB broth	Fisher Scientific	BP1426-2
Maxi-prep kit (Plasmid Purification Kit)	Qiagen	12362
Na2HPO4	Sigma Aldrich	NIST2186II
Optimem I reduced serum media	Gibco	31985070
p24 elisa	Perkin Elmer	NEK050B
PBS	Corning	21-040-CMR
Penicillin and Streptomycin	Corning	30-002-Cl
pMDG2.G	Addgene	#12259
pMDLg/pRRE	Addgene	#60488
Poly-L-Lysine	Sigma Aldrich	P-4832
Polybrene	EMD Millipore	TR-1003
pRSV-REV	Addgene	#12253
Puromycin dihydrochloride	Sigma Aldrich	P8833
RNA purification kit (Aurum RNA mini)	BioRad	7326820
Sodium Butyrate	Sigma Aldrich	B5887
SYBR green (iTaq universal)	BioRad	1725122
Triton X-100	Sigma Aldrich	X100