A subscription to JoVE is required to view this content. Sign in or start your free trial.
We successfully converted the standard telomere repeat amplification protocol (TRAP) assay to be employed in droplet digital polymerase chain reactions. This new assay, called ddTRAP, is more sensitive and quantitative, allowing for better detection and statistical analysis of telomerase activity within various human cells.
The telomere repeat amplification protocol (TRAP) is the most widely used assay to detect telomerase activity within a given a sample. The polymerase chain reaction (PCR)-based method allows for robust measurements of enzyme activity from most cell lysates. The gel-based TRAP with fluorescently labeled primers limits sample throughput, and the ability to detect differences in samples is restricted to two fold or greater changes in enzyme activity. The droplet digital TRAP, ddTRAP, is a highly sensitive approach that has been modified from the traditional TRAP assay, enabling the user to perform a robust analysis on 96 samples per run and obtain absolute quantification of the DNA (telomerase extension products) input within each PCR. Therefore, the newly developed ddTRAP assay overcomes the limitations of the traditional gel-based TRAP assay and provides a more efficient, accurate, and quantitative approach to measuring telomerase activity within laboratory and clinical settings.
Telomeres are dynamic DNA-protein complexes at the ends of linear chromosomes. Human telomeres are composed of an array of 5'-TTAGGGn hexameric repeats which vary in length between 12–15 kilobases (kb) at birth1. Human telomerase, the ribonucleoprotein enzyme that maintains the telomeres, was first identified in HeLa cell lysates (cancer cell line)2. Together, telomeres and telomerase play a major role in a spectrum of biological processes such as genome protection, gene regulation, and cancer cell immortality3,4,....
1. Buffer preparation and storage
Using the ddTRAP, telomerase activity was measured in a cell panel consisting of the following cell lines (Figure 1): nonsmall cell lung cancer (H2882, H1299, Calu6, H920, A549, and H2887), small cell lung cancer (H82 and SHP77), and telomerase-negative fibroblasts (BJ). One million cell pellets were lysed in NP-40 buffer, and telomerase extension reactions were performed in biological triplicates. A common and highly recommended negative control is the ̶.......
The measurement of telomerase activity is critical to a plethora of research topics including, but not limited to, cancer, telomere biology, aging, regenerative medicine, and structure-based drug design. Telomerase RNPs are low abundant, even in cancer cells, making the detection and study of this enzyme challenging. In this paper, we described the step-by-step procedures for the newly developed ddTRAP assay to robustly quantify telomerase activity in cells. By combining the traditional telomerase extension reaction with.......
The authors would like to acknowledge funding sources from the National Institutes of Health (NIH) (NCI-R00-CA197672-01A1). Small cell lung cancer lines (SHP77 and H82) were a generous gift from Drs. John Minna and Adi Gazdar from the UT Southwestern Medical Center.
....Name | Company | Catalog Number | Comments |
1 M Tris-HCl pH 8.0 | Ambion | AM9855G | RNAse/DNAse free |
1 M MgCl2 | Ambion | AM9530G | RnAse/DNAse free |
0.5 M EDTA pH 8.0 | Ambion | AM9261 | RNAse/DNAse free |
Surfact- Amps NP-40 | Thermo Scientific | 28324 | |
100% Ultrapure Glycerol | Invitrogen | 15514011 | RNAse/DNAse free |
phenylmethylsulfonyl fluoride | Thermo Scientific | 36978 | Powder |
2-Mercaptoethanol | SIGMA-ALDRICH | 516732 | |
Nuclease Free H20 | Ambion | AM9932 | RNAse/DNAse free |
2.5 mM dNTP mix | Thermo Scientific | R72501 | 2.5 mM of each dATP, dCTP, dGTP and dTTP |
2 M KCl | Ambion | AM9640G | RNAse/DNAse free |
100% Tween-20 | Fisher | 9005-64-5 | |
0.5 M EGTA pH 8.0 | Fisher | 50-255-956 | RNAse/DNAse free |
Telomerase Substrate (TS) Primer | Integrated DNA Technology (IDT) | Custom Primer (HPLC Purified) | 5'- AATCCGTCGAGCAGAGTT-3' |
ACX (Revers) Primer | Integrated DNA Technology (IDT) | Custom Primer (HPLC Purified) | 5'- GCGCGGCTTACCCTTACCCTTACCCTAACC -3' |
Thin walled (250 ul) PCR grade tubes | USA Scientific | 1402-2900 | strips, plates, tubes etc. |
QX200 ddPCR EvaGreen Supermix | Bio Rad | 1864034 | |
Twin-Tec 96 Well Plate | Fisher | Eppendorf 951020362 | |
Piercable foil heat seal | Bio Rad | 1814040 | |
Droplet generator cartidges (DG8) | Bio Rad | 1863008 | |
Droplet generator oil | Bio Rad | 1863005 | |
Droplet generator gasket | Bio Rad | 1863009 | |
96-well Thermocycler T100 | Bio Rad | 1861096 | |
PX1 PCR Plate Sealer | Bio Rad | 1814000 | |
QX200 Droplet Reader and Quantasoft Software | Bio Rad | 1864001 and 1864003 | |
ddPCR Droplet Reader Oil | Bio Rad | 1863004 | |
Nuclease Free Filtered Pipette Tips | Thermo Scientific | 10 ul, 20 ul , 200 ul and 1000 ul |
This article has been published
Video Coming Soon
ABOUT JoVE
Copyright © 2024 MyJoVE Corporation. All rights reserved