Droplet Digital TRAP (ddTRAP): Adaptation of the Telomere Repeat Amplification Protocol to Droplet Digital Polymerase Chain Reaction

Summary

We successfully converted the standard telomere repeat amplification protocol (TRAP) assay to be employed in droplet digital polymerase chain reactions. This new assay, called ddTRAP, is more sensitive and quantitative, allowing for better detection and statistical analysis of telomerase activity within various human cells.

Abstract

The telomere repeat amplification protocol (TRAP) is the most widely used assay to detect telomerase activity within a given a sample. The polymerase chain reaction (PCR)-based method allows for robust measurements of enzyme activity from most cell lysates. The gel-based TRAP with fluorescently labeled primers limits sample throughput, and the ability to detect differences in samples is restricted to two fold or greater changes in enzyme activity. The droplet digital TRAP, ddTRAP, is a highly sensitive approach that has been modified from the traditional TRAP assay, enabling the user to perform a robust analysis on 96 samples per run and obtain absolute quantification of the DNA (telomerase extension products) input within each PCR. Therefore, the newly developed ddTRAP assay overcomes the limitations of the traditional gel-based TRAP assay and provides a more efficient, accurate, and quantitative approach to measuring telomerase activity within laboratory and clinical settings.

Introduction

Telomeres are dynamic DNA-protein complexes at the ends of linear chromosomes. Human telomeres are composed of an array of 5'-TTAGGG_n hexameric repeats which vary in length between 12–15 kilobases (kb) at birth¹. Human telomerase, the ribonucleoprotein enzyme that maintains the telomeres, was first identified in HeLa cell lysates (cancer cell line)². Together, telomeres and telomerase play a major role in a spectrum of biological processes such as genome protection, gene regulation, and cancer cell immortality^3,4,....

Protocol

1. Buffer preparation and storage

1. Prepare 50 mL of 1x stock RNase-/DNase-free NP-40 lysis buffer (10 mM Tris-HCl [pH 8.0], 1 mM MgCl₂, 1 mM ethylenediaminetetraacetic acid (EDTA), 1% [vol/vol] NP-40, 10% [vol/vol] glycerol, 150 mM NaCl, 5 mM β-mercaptoethanol, and 0.1 mM 4-benzenesulfonyl fluoride hydrochloride (AEBSF)). This buffer can be aliquoted and stored at -20 °C for future use. Avoid freeze/thaw cycles in order to obtain an optimal lysis of cells.
2. Prepare 50 mL of 10x st.......

Discussion

The measurement of telomerase activity is critical to a plethora of research topics including, but not limited to, cancer, telomere biology, aging, regenerative medicine, and structure-based drug design. Telomerase RNPs are low abundant, even in cancer cells, making the detection and study of this enzyme challenging. In this paper, we described the step-by-step procedures for the newly developed ddTRAP assay to robustly quantify telomerase activity in cells. By combining the traditional telomerase extension reaction with.......

Materials

Name	Company	Catalog Number	Comments
1 M Tris-HCl pH 8.0	Ambion	AM9855G	RNAse/DNAse free
1 M MgCl2	Ambion	AM9530G	RnAse/DNAse free
0.5 M EDTA pH 8.0	Ambion	AM9261	RNAse/DNAse free
Surfact- Amps NP-40	Thermo Scientific	28324
100% Ultrapure Glycerol	Invitrogen	15514011	RNAse/DNAse free
phenylmethylsulfonyl fluoride	Thermo Scientific	36978	Powder
2-Mercaptoethanol	SIGMA-ALDRICH	516732
Nuclease Free H20	Ambion	AM9932	RNAse/DNAse free
2.5 mM dNTP mix	Thermo Scientific	R72501	2.5 mM of each dATP, dCTP, dGTP and dTTP
2 M KCl	Ambion	AM9640G	RNAse/DNAse free
100% Tween-20	Fisher	9005-64-5
0.5 M EGTA pH 8.0	Fisher	50-255-956	RNAse/DNAse free
Telomerase Substrate (TS) Primer	Integrated DNA Technology (IDT)	Custom Primer (HPLC Purified)	5'- AATCCGTCGAGCAGAGTT-3'
ACX (Revers) Primer	Integrated DNA Technology (IDT)	Custom Primer (HPLC Purified)	5'- GCGCGGCTTACCCTTACCCTTACCCTAACC -3'
Thin walled (250 ul) PCR grade tubes	USA Scientific	1402-2900	strips, plates, tubes etc.
QX200 ddPCR EvaGreen Supermix	Bio Rad	1864034
Twin-Tec 96 Well Plate	Fisher	Eppendorf 951020362
Piercable foil heat seal	Bio Rad	1814040
Droplet generator cartidges (DG8)	Bio Rad	1863008
Droplet generator oil	Bio Rad	1863005
Droplet generator gasket	Bio Rad	1863009
96-well Thermocycler T100	Bio Rad	1861096
PX1 PCR Plate Sealer	Bio Rad	1814000
QX200 Droplet Reader and Quantasoft Software	Bio Rad	1864001 and 1864003
ddPCR Droplet Reader Oil	Bio Rad	1863004
Nuclease Free Filtered Pipette Tips	Thermo Scientific		10 ul, 20 ul , 200 ul and 1000 ul