JoVE Logo
Faculty Resource Center

Sign In

Summary

Abstract

Introduction

Protocol

Representative Results

Discussion

Acknowledgements

Materials

References

Biology

Organoid-Derived Epithelial Monolayer: A Clinically Relevant In Vitro Model for Intestinal Barrier Function

Published: July 29th, 2021

DOI:

10.3791/62074

1Foundation Hubrecht Organoid Technology (HUB)

Here, we describe the preparation of human organoid-derived intestinal epithelial monolayers for studying intestinal barrier function, permeability, and transport. As organoids represent original epithelial tissue response to external stimuli, these models combine the advantages of expandability of cell lines and the relevance and complexity of primary tissue.

In the past, intestinal epithelial model systems were limited to transformed cell lines and primary tissue. These model systems have inherent limitations as the former do not faithfully represent original tissue physiology, and the availability of the latter is limited. Hence, their application hampers fundamental and drug development research. Adult stem-cell-based organoids (henceforth referred to as organoids) are miniatures of normal or diseased epithelial tissue from which they are derived. They can be established very efficiently from different gastrointestinal (GI) tract regions, have long-term expandability, and simulate tissue- and patient-specific responses to treatments in vitro. Here, the establishment of intestinal organoid-derived epithelial monolayers has been demonstrated along with methods to measure epithelial barrier integrity, permeability and transport, antimicrobial protein secretion, as well as histology. Moreover, intestinal organoid-derived monolayers can be enriched with proliferating stem and transit-amplifying cells as well as with key differentiated epithelial cells. Therefore, they represent a model system that can be tailored to study the effects of compounds on target cells and their mode of action. Although organoid cultures are technically more demanding than cell lines, once established, they can reduce failures in the later stages of drug development as they truly represent in vivo epithelium complexity and interpatient heterogeneity.

The intestinal epithelium acts as a physical barrier between the luminal content of the intestines and the underlying tissue. This barrier comprises a single epithelial layer of mainly absorptive enterocytes that are connected by tight junctions, which establish strong intercellular connections between adjacent cells. These cells form a polarized epithelial lining that separates the apical (lumen) and basolateral sides of the intestine, while simultaneously regulating paracellular transport of digested nutrients and metabolites. In addition to enterocytes, other important epithelial cells such as goblet, Paneth, and enteroendocrine cells also contribute to intestinal ....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

1. Preparing reagents for culture

NOTE: Perform all steps inside a biosafety cabinet and follow standard guidelines for working with cell cultures. Ultraviolet light is used for 10 min before starting up the biosafety cabinet. Before and after use, the surface of the biosafety cabinet is cleaned with a tissue paper drenched in 70% ethanol. To facilitate the formation of three-dimensional drops of extracellular matrix (ECM), keep a prewarmed stock of 96-, 24-, and 6-well plates ready in the incub.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Figure 1A shows a representative brightfield image of intestinal organoids after thawing them from a cryovial. It is important to thaw organoids at a high density to ensure optimal recovery. Organoids are plated in 24- or 6-well plates in ECM domes of approximately 10 µL (Figure 1B). Most normal intestinal organoids have a cystic morphology. After recovering from the thawing process, the organoids grow to a bigger size and are ready to be passaged after 3-7.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

This protocol describes the general manipulation and maintenance of intestinal organoids as well as the preparation and possible applications of epithelial monolayers derived from these organoids. To date, monolayers have been successfully prepared from the duodenum, ileum, and different regions of colon organoids derived from normal as well as previously and actively inflamed intestinal tissue (unpublished data). The application of patient-derived organoid monolayers facilitates the study of barrier function in a diseas.......

Log in or to access full content. Learn more about your institution’s access to JoVE content here

This work is supported by the Topsector Life Sciences & Health - Topconsortium voor Kennis en Innovatie Health~Holland (LSH-TKI) public-private partnerships (PPP) allowance of the Dutch LSH sector with Project number LSHM16021 Organoids as novel tool for toxicology modelling to Hubrecht Organoid Technology (HUB) and HUB internal funding to Disease Modeling and Toxicology department. We thank the laboratories of Sabine Middendorp (Division of Pediatric Gastroenterology, Wilhelmina Children's Hospital, UMC, Utrecht) and Hugo R. de Jonge and Marcel J.C. Bijvelds (Department of Gastroenterology and Hepatology, Erasmus MC, Rotterdam) for providing initial ....

Log in or to access full content. Learn more about your institution’s access to JoVE content here

Name Company Catalog Number Comments
100% ethanol Fisher Emergo 10644795
1250, 300, and 20 µL low-retention filter-tips Greiner bio-one 732-1432 / 732-1434 / 732-2383
15 mL conical tubes Greiner bio-one 188271
24-well cell culture plates Greiner bio-one 662160
24-well HTS Fluoroblok Transwell plate (light-tight) Corning 351156 Plates require REMS AutoSampler for TEER measurements
24-well HTS Transwell plates (Table 1) Corning 3378
24-well plate with Transwell inserts Corning 3470 membrane inserts
40 µm cell strainer PluriSelect 43-50040-01
50 mL conical tubes Greiner bio-one 227261
6-well cell culture plates Greiner bio-one 657160
96-well black plate transparent bottom Greiner bio-one 655090
96-well fast thermal cycling plates Life Technologies Europe BV 4346907
96-well HTS Fluoroblok Transwell plate Corning 351162
96-well HTS Transwell plates (Table 1) Corning 7369
96-well transparent culture plate Greiner bio-one 655180
A83-01 Bio-Techne Ltd 2939
Accutase Cell Dissociation Reagent Life Technologies Europe BV A11105-01
Advanced DMEM/F-12 Life Technologies Europe BV 12634028
B27 supplement Life Technologies Europe BV 17504001
Cell culture microscope (light / optical microscope) Leica
CellTiter-Glo Promega G9683
Centrifuge Eppendorf
CO2 incubator PHCBI
DAPT Sigma-Aldrich D5942
DEPC treated H2O Life Technologies Europe BV 750024
Dulbecco's phosphate-buffered saline (DPBS) with Ca2+ and Mg2+ Life Technologies Europe BV 14040091
DPBS, powder, no calcium, no magnesium Life Technologies Europe BV 21600069
EnzChek Lysozyme Assay Kit Life Technologies Europe BV E22013
EVOM2 meter with STX electrode WTI
Gastrin Bio-Techne Ltd 3006
Glass pipettes Volac
GlutaMAX Life Technologies Europe BV 35050038
hEGF Peprotech AF-100-15
HEPES Life Technologies Europe BV 15630056
Human Noggin Peprotech 120-10C
Human Rspo3 Bio-Techne Ltd 3500-RS/CF
IWP-2 Miltenyi Biotec 130-105-335
Ki67 primary antibody Sanbio BSH-7302-100
Ki67 secondary antibody Agilent K400111-2
Kova International Glasstic Slide with Counting grids Fisher Emergo 10298483
Laminar flow hood Thermo scientific
Lucifer Yellow CH dilithium salt Sigma-Aldrich L0259
Matrigel, Growth Factor Reduced (GFR) Corning 356231 extracellular matrix (ECM)
MicroAmp Fast 8-Tube Strip, 0.1 mL Life Technologies Europe BV 4358293
MicroAmp Optical 8-Cap Strips Life Technologies Europe BV 4323032
Microcentrifuge tubes Eppendorf 0030 120 086
Micropipettes (1000, 200, and 20 µL) Gilson
Microtome Leica
MUC2 primary antibody Santa Cruz Biotechnology sc-15334
MUC2 secondary antibody VWR VWRKS/DPVR-HRP
Multichannel pipette (200 µL) Gilson
N-acetylcysteine Sigma-Aldrich A9165
NGS Wnt U-Protein Express N001-0.5mg
Nicotinamide Sigma-Aldrich N0636
Oligonucleotide ALPI1/Forward Custom-made GGAGTTATCCTGCTCCCCAC
Oligonucleotide ALPI1/Reverse Custom-made CTAGGAGGTGAAGGTCCAACG
Oligonucleotide LGR5/Forward Custom-made ACACGTACCCACAGAAGCTC
Oligonucleotide LGR5/Reverse Custom-made GGAATGCAGGCCACTGAAAC
Oligonucleotide MUC2/Forward Custom-made AGGATCTGAAGAAGTGTGTCACTG
Oligonucleotide MUC2/Reverse Custom-made TAATGGAACAGATGTTGAAGTGCT
Oligonucleotide TBP/Forward Custom-made ACGCCGAATATAATCCCAAGCG
Oligonucleotide TBP/Reverse Custom-made AAATCAGTGCCGTGGTTCGTG
Optical adhesive covers Life Technologies Europe BV 4311971
PD0325901 Stemcell Technologies 72184
Penicillin/streptomycin Life Technologies Europe BV 15140122
Plate shaker Panasonic
PowerUp SYBR Green Master Mix Fisher Emergo A25776
Primocin InvivoGen ANT-PM-2 antimicrobial formulation for primary cells
Qubit RNA HS Assay Kit Life Technologies Europe BV Q32852
Reagent reservoir for multichannel pipet Sigma-Aldrich CLS4870
REMS AutoSampler with 24-probe or 96C-probe WTI
Richard-Allan Scientific Alcian Blue/PAS Special Stain Kit Thermo scientific 87023
RNase-Free DNase Set Qiagen 79254
RNeasy Mini Kit Qiagen 74106
SB202190 Sigma-Aldrich S7076
Serological pipettes Greiner bio-one 606180 / 607180 / 760180
Serological pipettor (Pipet-Aid) Drummond
Single edge razor blade GEM Scientific
Superscript 1st strand system for RT-PCR Life Technologies Europe BV 11904018
Tecan Spark 10M plate reader Tecan
Trypan Blue Solution, 0.4% Life Technologies Europe BV 15250-061
TrypLE Express Enzyme (1x) Life Technologies Europe BV 12605-010 Cell dissociation reagent
Water bath Grant
Y27632 (ROCK inhibitor) AbMole M1817

  1. Haegebarth, A., Clevers, H. Wnt signaling, lgr5, and stem cells in the intestine and skin. The American Journal of Pathology. 174 (3), 715-721 (2009).
  2. Schoultz, I., Keita, &. #. 1. 9. 7. ;. V. The intestinal barrier and current techniques for the assessment of gut permeability. Cells. 9 (8), 1909 (2020).
  3. Martínez-Maqueda, D., Miralles, B., Recio, I., Verhoeckx, K. HT29 Cell Line. The Impact of Food Bio-Actives on Gut Health: In Vitro and Ex Vivo Models. , 113-124 (2015).
  4. Sato, T., et al. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature. 459 (7244), 262-265 (2009).
  5. Sato, T., et al. Long-term expansion of epithelial organoids from human colon, adenoma, adenocarcinoma, and Barrett's epithelium. Gastroenterology. 141 (5), 1762-1772 (2011).
  6. Huch, M., et al. In vitro expansion of single Lgr5(+) liver stem cells induced by Wnt-driven regeneration. Nature. 11 (2), 179-194 (2013).
  7. Sachs, N., et al. Long-term expanding human airway organoids for disease modeling. The EMBO Journal. 38 (4), 1-20 (2019).
  8. Karthaus, W. R., et al. Identification of multipotent luminal progenitor cells in human prostate organoid cultures. Cell. 159 (1), 163-175 (2014).
  9. Boj, S. F., et al. Organoid models of human and mouse ductal pancreatic cancer. Cell. 160 (1-2), 324-338 (2015).
  10. Sachs, N., et al. A living biobank of breast cancer organoids captures disease heterogeneity. Cell. 172 (1-2), 373-386 (2018).
  11. Vlachogiannis, G., et al. Patient-derived organoids model treatment response of metastatic gastrointestinal cancers. Science. 359 (6378), 920-926 (2018).
  12. Van De Wetering, M., et al. Prospective derivation of a living organoid biobank of colorectal cancer patients. Cell. 161 (4), 933-945 (2015).
  13. Driehuis, E., et al. Pancreatic cancer organoids recapitulate disease and allow personalized drug screening. Proceedings of the National Academy of Sciences of the United States of America. 116 (52), 26580-26590 (2019).
  14. Tiriac, H., et al. Organoid profiling identifies common responders to chemotherapy in pancreatic cancer. Cancer Discovery. 8 (9), 1112-1129 (2018).
  15. d'Aldebert, E., et al. Characterization of human colon organoids from inflammatory bowel disease patients. Frontiers in Cell and Developmental Biology. 8, 363 (2020).
  16. Dotti, I., et al. Alterations in the epithelial stem cell compartment could contribute to permanent changes in the mucosa of patients with ulcerative colitis. Gut. 66 (12), 2069-2079 (2017).
  17. VanDussen, K. L., et al. Development of an enhanced human gastrointestinal epithelial culture system to facilitate patient-based assays. Gut. 64 (6), 911-920 (2015).
  18. Noel, G., et al. A primary human macrophage-enteroid co-culture model to investigate mucosal gut physiology and host-pathogen interactions. Scientific Reports. 7, 45270 (2017).
  19. Bartfeld, S., et al. In vitro expansion of human gastric epithelial stem cells and their responses to bacterial infection. Gastroenterology. 148 (1), 126-136 (2015).
  20. van Es, J. H., et al. Wnt signalling induces maturation of Paneth cells in intestinal crypts. Nature Cell Biology. 7 (4), 381-386 (2005).
  21. van Es, J. H., et al. Dll1 marks early secretory progenitors in gut crypts that can revert to stem cells upon tissue damage. Nature Cell Biology. 14 (10), 1099-1104 (2012).
  22. de Lau, W. B. M., Snel, B., Clevers, H. C. The R-spondin protein family. Genome Biology. 13 (3), 1-10 (2012).
  23. Basak, O., Beumer, J., Wiebrands, K., Seno, H., van Oudenaarden, A., Clevers, H. Induced quiescence of Lgr5+ stem cells in intestinal organoids enables differentiation of hormone-producing enteroendocrine cells. Cell Stem Cell. 20 (2), 177-190 (2017).
  24. Beumer, J., et al. Enteroendocrine cells switch hormone expression along the crypt-to-villus BMP signalling gradient. Nature Cell Biology. 20 (8), 909-916 (2018).
  25. Yin, X., Farin, H. F., van Es, J. H., Clevers, H., Langer, R., Karp, J. M. Niche-independent high-purity cultures of Lgr5+ intestinal stem cells and their progeny. Nature Methods. 11 (1), 106-112 (2014).
  26. Boj, S. F., et al. Forskolin-induced swelling in intestinal organoids: An in vitro assay for assessing drug response in cystic fibrosis patients. Journal of Visualized Experiments. (120), (2017).
  27. Miao, Y., et al. Next-generation surrogate Wnts support organoid growth and deconvolute Frizzled pleiotropy in vivo. Cell Stem Cell. 27 (5), 840-851 (2020).
  28. Srinivasan, B., et al. TEER measurement techniques for in vitro barrier model systems. Journal of Laboratory Automation. 20 (2), 107-126 (2015).
  29. Blume, L. -. F., Denker, M., Gieseler, F., Kunze, T. Temperature corrected transepithelial electrical resistance (TEER) measurement to quantify rapid changes in paracellular permeability. Die Pharmazie. 65 (1), 19-24 (2010).
  30. Lea, T., Verhoeckx, K., et al. Caco-2 cell line. The Impact of Food Bio-Actives on Gut Health: In Vitro and Ex Vivo Models. , 103-111 (2015).
  31. Heo, I., et al. Modelling Cryptosporidium infection in human small intestinal and lung organoids. Nature Microbiology. 3 (7), 814-823 (2018).
  32. Watanabe, K., et al. A ROCK inhibitor permits survival of dissociated human embryonic stem cells. Nature Biotechnology. 25 (6), 681-686 (2007).

This article has been published

Video Coming Soon

JoVE Logo

Privacy

Terms of Use

Policies

Research

Education

ABOUT JoVE

Copyright © 2024 MyJoVE Corporation. All rights reserved