Laser Microdissection for Species-Agnostic Single-Tissue Applications

Summary

A protocol is described that uses laser microdissection to isolate individual nematode tissues for RNA-sequencing. The protocol does not require species-specific genetic toolkits, allowing gene expression profiles to be compared between different species at the level of single-tissue samples.

Abstract

Single-cell methodologies have revolutionized the analysis of the transcriptomes of specific cell types. However, they often require species-specific genetic "toolkits," such as promoters driving tissue-specific expression of fluorescent proteins. Further, protocols that disrupt tissues to isolate individual cells remove cells from their native environment (e.g., signaling from neighbors) and may result in stress responses or other differences from native gene expression states. In the present protocol, laser microdissection (LMD) is optimized to isolate individual nematode tail tips for the study of gene expression during male tail tip morphogenesis.

LMD allows the isolation of a portion of the animal without the need for cellular disruption or species-specific toolkits and is thus applicable to any species. Subsequently, single-cell RNA-seq library preparation protocols such as CEL-Seq2 can be applied to LMD-isolated single tissues and analyzed using standard pipelines, given that a well-annotated genome or transcriptome is available for the species. Such data can be used to establish how conserved or different the transcriptomes are that underlie the development of that tissue in different species.

Limitations include the ability to cut out the tissue of interest and the sample size. A power analysis shows that as few as 70 tail tips per condition are required for 80% power. Tight synchronization of development is needed to obtain this number of animals at the same developmental stage. Thus, a method to synchronize animals at 1 h intervals is also described.

Introduction

Nematodes—particularly the rhabditid nematodes related to the model system Caenorhabditis elegans—are a wonderful group of animals for evolutionary developmental biology (EDB) for many reasons^1,2. Advantages include their small number of cells, defined and consistent cell lineages, transparency, and ease of culture and husbandry. There are also many resources available, including high-quality genomes for multiple species, and for C. elegans, extensive molecular genetic tools and knowledge about development, genetics, anatomy, and physiology^3,

Protocol

1. Worm synchronization

NOTE: Two methods are described below to synchronize the development of C. elegans and other rhabditid species.

1. Synchronize by first larval stage (L1) arrest following alkaline hypochlorite (bleach) treatment.
   NOTE: This method was described previously in detail¹⁹. This method relies on two features of C. elegans that are also true for several other rhabditid species: (1) The eggshell is resistant to bleach, whereas the cuticle surrounding adult and larval worms is not. (2) First-stage larvae arrest development when kept without food

Results

Following laser capture microdissection, individual tail tips of males and hermaphrodites at 4 time points (L3 22 h after hatch; L4 24, 26, and 28 h after hatch) were prepared for RNA sequencing using the CEL-Seq2 protocol. CEL-Seq2 primers contain unique barcodes that enable sequencing reads from a particular sample (in this case an individual tail tip) to be identified bioinformatically. Sequencing data were generated with this method for a total of 557 tail tips (266 hermaphrodites and 291 males across 4 developmental.......

Discussion

Critical steps of the method
If performed correctly, the method described here will obtain robust RNA profiles with a relatively small number of laser-dissected samples (70 tail tips in this example). However, for samples from developing animals, tight synchronization is critical to reducing the variability between samples. For this reason, the protocol recommends the hatch-off method for worm-synchronization. Here, the researcher can determine and precisely control the age difference between indiv.......

Materials

Name	Company	Catalog Number	Comments
0.5 µM PEN membrane glass slides RNase free	Leica	11600288	for LMD
500 µL PCR tubes (nuclease-free)	Axygen	732-0675	to cut the tail tips into
Compound microscope with 40x objective and DIC	any		to check age of worms
Desktop humidifier	any
Dissection microscope with transmitted light base	any		for all worm work
glass pasteur pipets	any		handle of worm pick
glass slides and coverslips	any		to check age of worms
LMD6 microdissection system	Leica	multiple	to cut tail tips
LoBind tubes 0.5 mL	Eppendorf	22431005
M9 Buffer			Recipe in WormBook
Methanol 99.8%	Sigma	322415	to fix worms
NGM growth medium	US Biological	N1000	Buffers and salts need to be added: Recipe in WormBook
P10 pipette variablle volume	e.g. Gilson
P1000 pipette variable volume	e.g. Gilson
P2 pipette variable volume	e.g. Gilson
Pipette tips 1,000 µL	any
Pipette tips 1-10 µL filtered	any
platinum iridium wire	Tritech	PT-9010	to make worm pick
sterile and nuclease-free 1 mL centrfuge tubes	any
Tween 20	Sigma	P9416	Add a very small amount to M9 buffer to prevent worms from sticking to the pipet tips
vented 6 mm plastic Petri dishes	any
For CEL-Seq2
4200 TapeStation System with reagents for high-sensitivity RNA and DNA detection	Aligent		automated electrophoresis system
AMPure XP beads	Beckman Coulter	A63880	DNA cleanup beads
Bead binding buffer  20% PEG8000, 2.5 M NaCl
CEL-Seq2 primers (see Table S1)	Sigma Genosys Mastercycler Nexus GX2 Eppendorf	6335000020	Thermal cycler with programmable lid and block for 200 µl tubes.
DNA Polymerase I (E. coli)	Invitrogen	18052-025
dNTP mix 10 mM	any
E. coli DNA ligase	Invitrogen	18052-019
Ethanol
ExoSAP-IT For PCR Product Clean-Up	Affymetrix	78200	exonuclease solution
MEGAscript T7 Transcription Kit	Ambion	AM1334	For step 4.6.1
Nuclease-free water	any
Phusion High-Fidelity PCR Master Mix with HF Buffer	NEB	M0531	PCR mix step 4.9.7
random hexamer RT primer GCCTTGGCACCCGAGAATTCCA NNNNNN	IDT		a primer with 6 nucleotides that are random
RNA Fragmentation buffer	NEB	E6150S
RNA Fragmentation stop buffer	NEB	E6150S
RNA PCR Index Primers (RPI1–RPI48)	Illumina, NEB, or IDT		RPIX in protocol step 4.9.7, sequences available from Illumina
RNAClean XP beads	Beckman Coulter	A63987
RNase AWAY Surface Decontaminant	Thermo Scientific	7000TS1	or any other similar product
RNaseH (E. coli)	Invitrogen	18021-071
RNaseOUT Recombinant Ribonuclease Inhibitor	Invitrogen	10777-019
Second strand buffer	Invitrogen	10812-014
Superscripit II	Invitrogen	18064-014	reverse transcriptase