This research was supported by grant from INSERM, University of Lille 1, University of Lille 2, Regional Hospital Center of Lille (CHR de Lille). MCCH acknowledges supports from the Fondation de France and wishes to thank IRCL, Pr. Sonenberg for the gift of the V5-plasmids, Dr. Dissous (Pasteur Institute, Lille) for the gift of anti-GFP antibodies, UMS 3387 (University of Rennes) where Xenopus oocytes are purchased and Dr Taymans (JPArc, Lille) for critical reading of the manuscript text.

Tüm Xenopus deneyleri laboratuvar hayvanları deney için Avrupa Topluluğu Konseyi yönergelerine (86/609 / EEC) kurallarına göre Lille 1 Üniversitesi&#39;nin hayvan tesisinde gerçekleştirildi. Hayvan protokolü (Comité d&#39;Ethique en Deneme Animale Nord-Pas-de-Calais CEEA 07/2010) yerel kurumsal inceleme kurulu tarafından onaylanmıştır. 1. Oosit İşleme <ol><li> Anestezik hazırlayın: steril su, bir 1 L tricaine metan sülfonat tozu 1 g çözülür. </li><li> Kadın Xenopus bu çözüm içine laevis Dalma, kaçış önlemek ve hayvan tamamen (bir bacak tutam herhangi bir tepki olmadan) sedasyon olmak için yaklaşık 45 dakika beklemek zorunda beher kapsamaktadır. </li><li> Daha sonra temiz bir alüminyum folyo üzerine sırtında hayvan koyun sabunla yıkayın kurbağayı ve musluk suyu ile durulayın. </li><li> Karın yan kısmında ve forseps ile yumurtalıklar düzeyinde cildi Kelepçe.Etanol% 70 ile kullanılmadan önce temizlenmelidir makasla yaklaşık 1 cm&#39;lik bir kesi olun. Bölüm yeterince derin olduğundan emin olun ve çeşitli gelişim aşamalarında çeşitli oosit bulundu edildiği yumurtalık dokusunun çıkarılmasını sağlamak için altta yatan karın duvarı ulaşmak için. </li><li> ND96 ortamı (96 mM NaCI, 2 mM KCI ile bir Petri kabı (50 mm) olanağına 4 kez yıkayın, yumurtalık loblar teşrih, 1 mM MgCl2, 1,8 mM CaCl2, 5 mM HEPES, NaOH ile pH 7.4&#39;e ayarlanmış takviye 50 ug / ml streptomisin / penisilin, 225 ug / ml sodyum piruvat, / ml soya fasulyesi tripsin inhibitörü, 30 ug, 1 ul / ml tetrasiklin) kan ve döküntü tüm izlerini silmek için. Not: Tetrasiklin optimal koruma ve mikroenjeksiyon tedavisi sonrası iyi bir iyileşme sağlar. </li><li> Bir hafta boyunca kendi koruma sağlayan, 14 ° C &#39;de ortam içine kapalı bir Petri tabağına saklayın. </li><li> Karın duvarı ve veteriner emilebilir t ile cildi Dikişhread ve dikiş iğnesi (3 ya da 4 dikiş gerekli olacaktır). </li><li> Su olmadan beher hayvan koyun ve kurbağa tekrar hareket kadar musluk suyu ile cildi nemli. Kaçmasını önlemek için beher örtün. </li><li> 10-kat büyütmeli bir stereomikroskop altında forseps 2 çiftleri kullanılarak dikkatli bir şekilde 5 ila 10 oosit gruplarda orta yumurtalık loblar ayırın. Sahne VI Seçin oositler. Bu, kahverengi bir pigmentli hayvan kutup çapında 10 1.2 mm ii) boyutları her türlü açık bir kayış ile ayrılan sarı bir bitki kutuplu i) kendi şekil ve renk tanınabilir. </li><li> (Kolajenaz oosit / folikül hücresi bağlantısına digests) oosit defolliculation kolaylaştırmak için 45 dakika boyunca hafif hafif çalkalamak suretiyle bir Petri kabındaki (tetrasiklin olmayan ND96 içinde çözülmüş Clostridium histolyticum&#39;dan, 1 mg / ml kollajenaz A) kolajenaz çözeltisi seçilen oositlerin inkübe edin. ND96 ortam ile 3 ya da 4 kez 14 tutulan oosit durulayın° C. Not: oosit az ya da oosit yüzey proteinleri tahrip ve yoksul canlılığı neden riski nedeniyle fazla 45 dakika inkübe etmeyin. Kollajenaz tedavisi kendiliğinden GVBD indükleyebilir. </li><li> 3-4 saat boyunca ortam içinde oosit inkübe edin. Binoküler büyüteç altında ince cımbız ile foliküler hücreleri çıkarın ve ND96 ortamında 19 ° C&#39;de saklayın. </li></ol> MRNA Synthesis 2. Hazırlık <ol><li> I enzim PME ile enzimatik sindirme ile aşağıdaki plazmidlerle 5 ug Linearize. NOT: pcDNA6.2 / a 1599 amino asitler eIF4G1 cDNA vahşi tip (eIF4G1-WT; NM_198241) içeren V5-DEST mutasyonları c.2105T ile, bir eIF4G1 dominant negatif cDNA (eIF4G1-DN) içeren pcDNA6.2 / V5-DEST &gt; G c.2106A&gt; C, c.2120-&gt; G, c.2122T&gt; A, 2125T&gt; - ve c.2126T&gt; G karşılık gelen protein içindeki 618 pozisyonuna 612 eIF4G1 ve eIF4E arasındaki etkileşim bölgesinde rahatsız etkileşim between eIF4G1 ve eIF4E 8 chloramphenicol acetyl transferase ihtiva eden pcDNA6.2 / C-EmGFP (GFP). 3 plazmidlerin her biri için 2 karışımları hazırlayın: I enzim de dahil olmak üzere, ilk ve ikinci PME kontrol olarak enzimsiz. </li><li> Klasik bir etanol prosedürü kullanılarak plazmid DNA çökelti ve nukleazsız H2O 20 ul içinde tekrar süspansiyon haline getirin </li><li> Bir spektrofotometre kullanılarak konsantrasyonunu belirleyin. Konsantrasyon cRNA yazıya ul 150 ng / üstün olmalıdır. </li><li> Plazmid doğrusallaştırma doğrulamak için 1 ul numune ve% 0.8 agaroz jeli üzerinde yükleme tamponu, 5 ul ile kontrol çalıştırın. </li><li> In vitro transkripsiyonu, üreticinin talimatlarına göre cRNA saflaştırılması için bir kit kullanın. Transkribe cRNA, nukleazsız H2O 20 ul içinde tekrar süspanse edilir Gerekirse Numuneler -80 ° C&#39;de saklanabilir. </li><li> 0.2 M MOPS (pH 7.0), 20 m ihtiva MOPS 10X geçiş tamponu hazırlayınM sodyum asetat ve 10 mM EDTA (pH 8.0). 0.45 um filtre ile çözelti sterilize edin. Çözelti oksidasyonu önlemek için oda sıcaklığında ışıktan korunur çözelti stok. </li><li> NaOH, HCl ile art arda elektroforez tankı temizleyin ve iyice bir O çift-filtrelenmiş su ile durulanır / N RNAaz ari önlemek ve RNA bozulmasını önlemek için. </li><li> MOPS ve formaldehit içeren% 1.5 agaroz jel Cast. Tam agaroz çözülünceye kadar sıcak ve 55 ° C&#39;ye kadar soğumasını bekleyin. Davlumbaz altında, MOPS 10X 0.1 hacim, formaldehit% 6.6 ve etidyum 4 mikrogram (10 mg / ml) ekleyin. Davlumbaz altında jel dökün ve jel sertleşmesine yaklaşık 1 saat bekleyin. Not: Formaldehit ve etidyum bromür toksiktir. </li><li> CRNA 1 ul, formaldehit% 8.8, formamit 60 ve% MOPS 10X 0,1 hacmi ile 0.2 ml tüp içinde göç örnekleri hazırlayın. 70 ° C &#39;de 3 dakika süre ile inkübe edilir ve 10 dakika süreyle buz üzerinde tüpler koydu. Santrifüj örnekleri Birkaç saniye at5000 x g. , Jel yükleme tampon maddesi, 2 ul ekle. Not: Formamid toksiktir. </li><li> 90V, 20 dakika boyunca numune çalıştırın. CRNA kalitesini kontrol etmek için analiz etmeden önce jel destain için nukleazsız H 2 OO / N jel bekletin. </li><li> Bir spektrofotometre kullanılarak cRNA konsantrasyonunu belirleyin ve -80 ° C&#39;de saklayın. </li></ol> Sentezlenen RNA ve Oosit Olgunlaşma Uyarım 3. Mikroenjeksiyon <ol><li> Oosit mikroenjeksiyon için gerekli ekipman hazırlayın. Küçük cam kapiller çekmek için bir mikropipet çektirmesi kullanın. Stereomicroscope altında, kör bir uç oluşturmak için cımbız ile kılcal ekstremite kesiyorum. Karşı ucunda, bir Millipore 0,45 mikron filtre ile 1 ml şırınga kullanarak, mineral yağ ile kılcal mikropipet doldurun. Mikroenjeksiyon pipet üzerine mikropipet monte edin. Uygun cam kapiller ile kullanıldığında iyi doğruluk vermek için üretici tarafından kalibre doğru mikropipet seçin. </li><li> Mikroenjeksiyon defolliculation sonra 1-2 saat gerçekleştirin, oosit üzerinde oosit kurtarma için gerekli gecikme 14 ° C&#39;de muhafaza. Alt Kullan Petri kapları oositler için bir yapıştırıcı yüzey oluşturmak ve ND96 ortamı onları doldurmak için forseps ile kazınır. </li><li> 45 ° C &#39;lik bir açıda kılcal mikropipet ile oosit ardışık enjekte etmeyi sağlamak bir Petri kabındaki kazınmış şerit boyunca oosit düzenlemek. </li><li> Sitoplazmada örneklerin optimal difüzyonu için pigmentli, hayvan alanının altında, oosit ekvatoryal mıntıkasında enjekte edilir. Derinliği yaklaşık 150-200 mikron üzerinde kılcal ucu sadece ince bir kısmını yerleştirin. </li><li> Bir birinci oosit içinde 60 nl bir hacimde farklı plazmid sırasıyla elde edilen cRNA 30 ng enjekte edilir. Enjeksiyon sonrası, numune kaçış (Şekil 2A) önlemek için kılcal ucu çıkarmadan önce 5-10 saniye bekleyin. Not: 120 nl aşmayın. Yavaş olabildiğince enjekte edilir. Damıtılmış su olan bir kontrol yapılması tavsiye edilir. </li><li> Bir sonraki oositi enjekte elle Petri kabı taşıyın. Not: İpucu 2 ila 3 microinjections sonra banyo solüsyonu dışarı küçük bir darbe oluşturarak tıkanmış olmadığından emin olun. </li><li> 24 kuyu kültür plakaları içinde Aktarım enjekte edilmiş oositler (10 oosit / oyuk), taze ND96 ortamının 3 ml ile doldurulur ve 19 ° C&#39;de bırakın. </li><li> , 19 ° C de mayoz olgunlaşmasını (GVBD) tetiklemek için progesteron (PG) (2 ug / ml) ile ND96 içinde oosit inkübe 15 saat veya pcDNA6.2 / V5-DESTeIF4G1 ve pcDNA6 sırasıyla elde edilen poliadenile edilmiş cRNAs mikroenjeksiyon 4 saat sonra 0,2 / C-EmGFP bir kontrol (Şekil 2A) olarak kullanılır. Not: cRNA ile floresan markör ortak enjeksiyonu cRNA enjekte edilmiş ve oosit kalmıştır sağlamak için iyi bir araçtır. GFP etiketi ile ilgi bir cRNA kullanarak bu tür ön deneyler yapın. </li><li> Microinject olarak içerisinde 3,5 farklı oranları (1: 3; 2: 2: 3: 1) te üzere eIF4G1-WT ve eIF4G1-DN cRNAs poliadenile arasındast mutant fenotipinin (Şekil 2B) üzerindeki eIF4G1-WT cRNAs translasyon etkisi. </li></ol> 4. Germinal Vesikül Arıza Tespiti <ol><li> Bir stereomikroskopta siyah hayvan kutup beyaz bir nokta varlığını gözlemleyerek PG uyarıldıktan sonra olgun oosit sayısını. 20-4 saat (Şekil 2B, 2C) kadar saymaya her saat tekrarlayın. </li></ol> 5. Western Blot (WB) analizi <ol><li> 50 mM Hepes, pH 7.4, 500 mM NaCl,% 0.05 SDS, 5 mM MgCI2, 1 mg aşağıdaki tampon maddesi içinde 200 ul 4 ° C &#39;de, 10 arka oositler ve bir mikro pipet ile ortaya hareketlerin grubu homojenize / ml büyükbaş hayvan serum albümini, 10 mg / ml löpeptin, 10 mg / ml aprotinin, 10 mg / ml soya fasulyesi tripsin inhibitörü, 10 mg / ml benzamidin, 1 mM PMSF, 1 mM sodyum vanadat. </li><li> 10,000 x g&#39;de 15 dakika boyunca santrifüj örnekleri lipid (üst faz) ve zar (alt faz) f çıkarmak içinkasılma konsantrasyona. Protein konsantrasyonu belirlemek ve Laemmli veya Bis-Tris numune tamponu ile geri kalan tamamlamak için bir alikot depolamak, sitoplazmik bölümünü kazan (1: 1). Not: Bis-Tris jelleri ve yükleme tamponu hidrolizinden proteinleri koruyan daha nötr pH değerine sahip </li><li> 10 dakika boyunca 95 ° C&#39;de örneğin 20 ug ısıtın. Akrilamid jel kuyu içine her bir örnek yükleyin. Uygun tampon maddesi ile bir tankta jel yerleştirin. </li><li> 200 V&#39;de 1 saat boyunca bir elektroforez gerçekleştirme </li><li> TBS pH bir WB 8,0 Gerçekleştirmek (Tris-HCl 15 mM, NaCl 150 mM Tween% 0.1;% 10 bovin serum albümini), bir keçi anti-Aurora A / eg2 (1: 3000, 2 saat) ile birlikte ya da bir tavşan anti-ile -Aurora A / eg2-P (1: 4 ° C &#39;de 1000, O / N), fare anti-ERK2 (1: 3000, 2 saat), keçi anti-ERK2-P (Tyr204) (1: 3000, 2 saat 10.000, 2 saat) ve tavşan anti-Rsk (1:), tavşan anti-ay (1: 5000, 4 saat), tavşan anti-GFP (1: 3000, 2 saat) antibodies.Use fare anti-V5 antikorları (1 : yükleme kontrolleri gibi 1000, 2 saat) (). </li><li> YıkamaMembran 3 kez 10 dakika için TBS-Tween ile 1 saat inkübe edilir, 1 seyreltilerde bir anti-fare ya da anti-tavşan veya anti-keçi (IgM) bayır turpu peroksidazı etiketli ikincil antikor ya: 5000, 1: 7500 ve 1 : sırasıyla 5.000. </li><li> TBS-Tween 10 dakika süren 3 yıkama yapın ve Advanced ECL Detection sistemi ile antijen antikorlarının kompleksleri tespit. </li></ol> 6. Poliadenilasyon Deneyi <ol><li> Örnek 1.5 ml koşulu başına 5 oosit. Nukleazsız PBS 1X (pH 7.4), 1 ml ile yıkanır. Aşağıdaki adımlar davlumbaz altında yapılacaktır. </li><li> (Üretici talimatlarına bakın) klasik organik prosedür kullanılarak RNA ayıklayın. </li><li> 4 ° C&#39;de 5 dakika boyunca santrifüje (10000 x g) RNA kurtarmak. 10 dakika boyunca supernatant ve hava kuru RNA çıkarın. </li><li> Nukleazsız H2O 30 ul içinde süspanse RNA topağı </li><li> Yeni bir tüp içinde numunelerin 15 ul alın ve nukleazsız H 2 O 85 ul ekleyin Temizlemekse örnekleri, üreticinin talimatlarına uygun olarak silisyum dioksidin kolonu üzerinde kalitesini artırmak için. Nukleazsız H2O 30 ul kullanarak, RNA yı Zehir </li><li> RNA bütünlüğü kontrol etmek için bir% 0.8 agaroz jeli üzerinde yükleme tamponu 5 ul numune 1 ul çalıştırın. </li><li> Bir spektrofotometre kullanılarak RNA konsantrasyonu belirleyin. </li><li> Koşul başına 2 ligasyon karışımları hazırlanması (örneğin, eIF4G1-WT, eIF4G1-DN ve H2O kontrol), aşağıdaki reaktifleri ile: RNA ligaz 10 U, 10X tampon maddesi 0.1 hacim, 1 mM ATP, 50 PEG8000,%% 10 , primer P1 (5&#39;-P-GGTCACCTTGATCTGAAGC-NH2-3 &#39;) 11 ve nukleazsız H2O ile 10 ul son hacim getirmek 0.1 ug PG uyarılma olmaksızın oosit elde edilen ilk karışım RNA ekleyin ve PG elde edilen ikinci karışım RNA oosit uyarılmış. </li><li> Enzimler inaktive edildi, 65 ° C de 20 dakika ve sonra 37 ° C&#39;de 1 saat süreyle inkübe edin. </li><li> Bizeea cDNA Ters Transkripsiyon (RT) kiti. Tüp başına, RT karışım hazırlayın: 10X RT tamponu 0,1 hacim nukleazsız H primer P2 (5&#39;-GCTTCAGATCAAGGTGACCTTTTT) 10, 4 mM dNTP karışımı, ters transkriptazın 50 U ve 0.1 ug tam bir nihai hacme 2 O 10 ul. Yukarıda elde edilen ligasyon reaksiyonunun 10 ul ekle. Üretici tarafından tarif edilen koşullar altında RT gerçekleştirin. </li><li> (PCR) karışımı, tüp başına Polimeraz Zincir Reaksiyonu hazırlayın: tampon 10X 0.1 hacim, 1.5 mM MgCI2, 133 uM dNTP karışımı, 0.2 uM spesifik primer, 0.2 uM primer P2, 0.025 U Taq polimerazı, cDNA 1 ul ile komple nukleazsız 50 ul nihai hacme kadar H2O. Aşağıdaki koşullar altında PCR yapın: 50 ° C, 2 dakika, 10 dakika boyunca 95 ° C, [30 saniye için 1 dk için 95 ° C, 56 ° C, 30 sn için 72 ° C] için 40 döngü, 72 ° C 10 dakika 9. Şöyle spesifik primerler şunlardır: mos GTTGCATTGCTGTTTAAGTGGTAA Histon benzeri B4 AGTGACAAACTAGGCTGATATACT; Siklin A1, CATTGAACTGCTTCATTTTCCCAG; Siklin B1: GTGGCATTCCAATTGTGTATTGTT 9. </li><li> % 3 agaroz jel hazırlayın. Her bir PCR ürünlerinin yükleme tamponu 10 ul ekle. Optimal göç 110 V numunelerin 10 ul jel çalıştırın. Tercümelerine için bir ön koşuldur kuyruk poli (A) ve böylece RNA olgunlaşma süresini yansıtan boyutta bir değişikliği gözlemek için 10 ve 20 dakika sonra jel analiz eder. </li></ol>

<ol>
	<li>Jackson, R. J., Hellen, C. U., Pestova, T. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanism+of+eukaryotic+translation+initiation+and+principles+of+its+regulation.">The mechanism of eukaryotic translation initiation and principles of its regulation.</a> Nat Rev Mol Cell Biol. 11 (2), 113-127 (2010).</li><li>Holcik, M., Sonenberg, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translational+control+in+stress+and+apoptosis.">Translational control in stress and apoptosis.</a> Nat Rev Mol Cell Bio. 6 (4), 318-327 (2005).</li><li>Lopez-Lastra, M., Rivas, A., Barria, M. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+synthesis+in+eukaryotes:+the+growing+biological+relevance+of+cap-independent+translation+initiation.">Protein synthesis in eukaryotes: the growing biological relevance of cap-independent translation initiation.</a> Biol Res. 38 (2-3), 121-146 (2005).</li><li>Terenin, I. M., Andreev, D. E., Dmitriev, S. E., Shatsky, I. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+mechanism+of+eukaryotic+translation+initiation+that+is+neither+m7G-cap-,+nor+IRES-dependent.">A novel mechanism of eukaryotic translation initiation that is neither m7G-cap-, nor IRES-dependent.</a> Nucleic Acids Res. 41 (3), 1807-1816 (2013).</li><li>Sonenberg, N., Hinnebusch, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+translation+initiation+in+eukaryotes:+mechanisms+and+biological+targets.">Regulation of translation initiation in eukaryotes: mechanisms and biological targets.</a> Cell. 136 (4), 731-745 (2009).</li><li>Van der Knaap, M. S., Leegwater, P. A., K&#246;nst, A. A., Visser, A., Naidu, S., Oudejans, C. B., Schutgens, R. B., Pronk, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+each+of+the+five+subunits+of+translation+initiation+factor+eIF2B+can+cause+leukoencephalopathy+with+vanishing+white+matter.">Mutations in each of the five subunits of translation initiation factor eIF2B can cause leukoencephalopathy with vanishing white matter.</a> Ann Neurol. 51 (2), 264-270 (2002).</li><li>Sen&#233;e, V., Vattem, K. M., Del&#233;pine, M., Rainbow, L. A., Haton, C., Lecoq, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolcott-Rallison+Syndrome:+clinical,+genetic,+and+functional+study+of+EIF2AK3+mutations+and+suggestion+of+genetic+heterogeneity.">Wolcott-Rallison Syndrome: clinical, genetic, and functional study of EIF2AK3 mutations and suggestion of genetic heterogeneity.</a> Diabetes. 53 (7), 1876-1883 (2004).</li><li>Chartier-Harlin, M. C., Dachsel, J. C., Vilari&#241;o-G&#252;ell, C., Lincoln, S. J., Lepr&#234;tre, F., Hulihan, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translation+initiator+EIF4G1+mutations+in+familial+Parkinson+disease.">Translation initiator EIF4G1 mutations in familial Parkinson disease.</a> Am J Hum Genet. 89 (3), 398-406 (2011).</li><li>Charlesworth, A., Cox, L. L., MacNicol, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytoplasmic+polyadenylation+Element+(CPE)-+and+CPE-binding+Protein+(CPEB)-independent+mechanisms+regulate+early+class+maternal+mRNA+translational+activation+in+Xenopus+oocytes.">Cytoplasmic polyadenylation Element (CPE)- and CPE-binding Protein (CPEB)-independent mechanisms regulate early class maternal mRNA translational activation in Xenopus oocytes.</a> J Biol Chem. 279 (17), 17650-17659 (2004).</li><li>Dumont, J. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oogenesis+in+Xenopus+laevis.">Oogenesis in Xenopus laevis.</a> J Morphol. 136, 153-180 (1972).</li><li>Rassa, J. C., Wilson, G. M., Brewer, G. A., Parks, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spacing+constraints+on+reinitiation+of+paramyxovirus+transcription:+the+gene+end+U+tract+acts+as+a+spacer+to+separate+gene+end+from+gene+start+sites.">Spacing constraints on reinitiation of paramyxovirus transcription: the gene end U tract acts as a spacer to separate gene end from gene start sites.</a> Virology. 274, 438-449 (2000).</li><li>Lin, W., Wadlington, N. L., Chen, L., Zhuang, X., Brorson, J. R., Kang, U. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loss+of+PINK1+attenuates+HIF-1&#945;+induction+by+preventing+4E-BP1-dependent+switch+in+protein+translation+under+hypoxia.">Loss of PINK1 attenuates HIF-1&#945; induction by preventing 4E-BP1-dependent switch in protein translation under hypoxia.</a> J Neurosci. 34 (8), 3079-3089 (2014).</li><li>Martin, I., Kim, J. W., Lee, B. D., Kang, H. C., Xu, J. C., Jia, H. 2., Stankowski, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ribosomal+protein+s15+phosphorylation+mediates+LRRK2+neurodegeneration+in+Parkinson's+disease.">Ribosomal protein s15 phosphorylation mediates LRRK2 neurodegeneration in Parkinson's disease.</a> Cell. 57 (2), 472-485 (2014).</li><li>Cohen, S., Au, S., Pant&#233;, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microinjection+of+Xenopus+laevis+oocytes.">Microinjection of Xenopus laevis oocytes.</a> J Vis Exp. (24), (2009).</li><li>Willis, J., DeStephanis, D., Patel, Y., Gowda, V., Yan, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Study+of+the+DNA+damage+checkpoint+using+Xenopus+egg+extracts.">Study of the DNA damage checkpoint using Xenopus egg extracts.</a> J Vis Exp. (69), e4449 (2012).</li><li>Keiper, B. D., Rhoads, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translational+recruitment+of+Xenopus+maternal+mRNAs+in+response+to+poly(A)+elongation+requires+initiation+factor+eIF4G-1.">Translational recruitment of Xenopus maternal mRNAs in response to poly(A) elongation requires initiation factor eIF4G-1.</a> Dev Biol. 206 (1), 1-14 (1999).</li><li>Wakiyama, M., Imataka, H., Sonenberg, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interaction+of+eIF4G+with+poly(A)-binding+protein+stimulates+translation+and+is+critical+for+Xenopus.oocyte+maturation.">Interaction of eIF4G with poly(A)-binding protein stimulates translation and is critical for Xenopus.oocyte maturation.</a> Curr Biol. 10 (18), 1147-1150 (2000).</li><li>Sheets, M. D., Wu, M., Wickens, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyadenylation+of+c-mos+mRNA+as+a+control+point+in+Xenopus+meiotic+maturation.">Polyadenylation of c-mos mRNA as a control point in Xenopus meiotic maturation.</a> Nature. 374 (6522), 511-516 (1995).</li><li>Gebauer, F., Richter, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+and+function+of+Mos:+the+control+switch+of+vertebrate+oocyte+meiosis.">Synthesis and function of Mos: the control switch of vertebrate oocyte meiosis.</a> Bioessays. 19 (1), 23-28 (1997).</li><li>Le Sommer, C., Lerivray, H., Lesimple, M., Hardy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Xenopus+as+a+model+to+study+alternative+splicing+in+vivo.">Xenopus as a model to study alternative splicing in vivo.</a> Biol Cell. 99 (1), 55-65 (2007).</li><li>Au, S., Cohen, S., Pant&#233;, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microinjection+of+Xenopus+laevis.oocytes+as+a+system+for+studying+nuclear+transport+of+viruses.">Microinjection of Xenopus laevis.oocytes as a system for studying nuclear transport of viruses.</a> Methods. 51 (1), 114-120 (2010).</li><li>Gotoh, T., Villa, L. M., Capelluto, D. G., Finkielstein, C. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulatory+pathways+coordinating+cell+cycle+progression+in+early+Xenopus+development.">Regulatory pathways coordinating cell cycle progression in early Xenopus development.</a> Results Probl Cell Differ. 53, 171-199 (2011).</li><li>Schmidt, E. K., Clavarino, G., Ceppi, M., Pierre, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SUnSET,+a+nonradioactive+method+to+monitor+protein+synthesis.">SUnSET, a nonradioactive method to monitor protein synthesis.</a> Nat Methods. 6 (4), 275-277 (2009).</li><li>Moreno, J. A., Halliday, M., Molloy, C., Radford, H., Verity, N., Axten, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oral+treatment+targeting+the+unfolded+protein+response+prevents+neurodegeneration+and+clinical+disease+in+prion-infected+mice.">Oral treatment targeting the unfolded protein response prevents neurodegeneration and clinical disease in prion-infected mice.</a> Sci Transl Med. 5 (206), 206ra138 (2013).</li><li>Doyle, K. M., Kennedy, D., Gorman, A. M., Gupta, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unfolded+proteins+and+endoplasmic+reticulum+stress+in+neurodegenerative+disorders.">Unfolded proteins and endoplasmic reticulum stress in neurodegenerative disorders.</a> J Cell Mol Med. 15 (10), 2025-2039 (2011).</li><li>Gandin, V., Sikstr&#246;m, K., Alain, T., Morita, M., McLaughlan, S., Larsson, O., Topisirovic, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polysome+fractionation+and+analysis+of+mammalian+translatomes+on+a+genome-wide+scale.">Polysome fractionation and analysis of mammalian translatomes on a genome-wide scale.</a> J Vis Exp. (87), e51455 (2014).</li></ol>

The authors have nothing to disclose.

Tercüme birkaç nörodejeneratif hastalıklar dahil olmak üzere sayısız insan bozukluklarının patofizyolojisinde rol bir mekanizmadır. Parkinson hastalığında Örneğin çeşitli raporlar kalıtsal mutasyonlara 8,12,13 ile bağlantılı tercüme edilen değer göstermiştir. Çeşitli hücresel modeller çeviri incelemek için kullanılabilir. Burada, eIF4G1 ve eIF4E mümkün 8 arasındaki etkileşimi azaltmak gibi baskın negatif mutasyonu hareket eIF4G1 bir m...

Proteinler organizmanın daha büyük ölçekte temel hücresel yaşam elemanları ve bu nedenle bulunmaktadır. Onlar yapısı, ulaşım, reaksiyon kataliz, yönetmelik, gen ifadesi vb Onların ifade protein içine bir mRNA&#39;nın dönüşümünü sağlayan çeviri karmaşık bir mekanizmanın sonucudur içeren hücresel fonksiyonlarının çoğunu sağlamaktadır. Için uyarlamak ve gelişme ve farklılaşma, yaşlanma, fizyolojik baskılara ya da patolojik seyri sırasında, hücre ihtiyaçlarına göre gen ifadesini düzenlemek için çeşitli kontroller tabi tutulur. Kap-bağımlı, kap-bağımsız İç Ribozom Giriş Segment (IRES) yapıları ve kap-Bağımsız Çeviri arttırıcılar (via: Çeviri 3 başlatma çeviri sistemleri bu ihtiyaçlara cevap vermek amacıyla, 3 aşamadan (başlatma, uzama ve sonlandırma) ve hediyeler ayrılmıştır ) CITE. Çoğu eukaryotik mRNA bir kap-Depe çevrilirProtein sentezi sırasında bir tanıma özelliği olarak hizmet vermektedir 7-methylguanosine 5&#39;-trifosfat kapağı aracılığıyla ndent şekilde. Bu kapak eIF4E, eIF4G1 ve eIF4A ile eIF4F kompleksi bileşenine bağlanır. Poli (A) bağlayıcı protein (PABP) gibi diğer ortaklarla ilişkili elF2-GTP-Met-tRNA Met, bu çeviri başlatma faktörleri mRNA sirküler ve tanınması 1 kodon Ağustos başlatılması kadar formlara 43S kompleksi olan erişilebilirliği iyileştirmek için izin verir. Bu olay, translasyon başlatma yani, çeviri birinci etabının sonuna karşılık gelmektedir. Cap bağımsız için, örneğin hücre çoğalmasının ve apoptozun için neden stresli koşullar altında esas proteinler için kodlayan mRNA tarafından kullanılır. Bu mekanizma, mRNA ikincil yapısını içerir 5&#39;-çevrilmemiş bölümü (UTR) IRES adlandırılan eIF4A ve 43S kompleksi ile ilişkili eIF4G1 karboksi-terminal ucu. Bu 43S, ön başlatma c bağlanmasınınIRES için omplex eIF4E faktörü 2,3 gerek kalmadan kapak bağımsız çeviri başlatır. MRNA UTR 4 içinde yer alan yapıların CITE aracılığıyla Nihayet, yine iyi anlaşılmış değildir başka bir çeviri mekanizması vurguladı şartlar altında bu kap-bağımsız çeviri etkinliğini destekler. Kendi başlatma aşamalarının göre farklı tercüme bu çeşitli modları ile, çeviri, hücresel homeostazında kritik bir rol ve böylece büyük ölçekli etkileri küçük organizmaya etkisi olur, bu işlemlerin biri herhangi bir değişiklik oynar. Nitekim, başlatma proteinlere mRNA doğru çeviri süreçlerini yöneten bir oran sınırlayıcı bir adımdır ve bu nedenle çok sayıda kontrol ve düzenleme noktalarının 5 hedefidir. Ikincisi için ya da bu işlemlerin bileşenleri için olsun biri arızalı olduğu ortaya çıkarsa, bu hücrede kurulan dengeyi bozacak ve böylece patolojik Condi yol açabilirleri. Bu bağlamda, çeviri faktörlerinin mutasyonlar, potansiyel olarak, beyaz matter&#39; (eIF2B1-5 alt-birimi) 6, Walcott-Rallison sendromunda (Perk için EIF2AK3 kodlayan gen) 7, ufuk ile lökoensefalopati `gibi nörodejeneratif bozukluklar dahil olmak üzere çeşitli hastalıklarda yer almışlardır Parkinson hastalığı (eIF4G1 p.R1205H) 8. Bu hastalık gelişimi üzerine ve çeviri inisiyasyon genel sürecine bilgimizi artırmak için bu mutant proteinlerin hücresel ve moleküler çalışmalar yapmak için bu nedenle önemlidir. Bu çalışmaları yürütmek için, bu mutasyonların sonuçlarını gözlemlemek için en uygun modelleri seçmek için esastır Xenopus oositler, özellikle de onların fizyolojik ve biyokimyasal özellikleri nedeniyle uyarlanmış laevis. Fizyolojik eşzamanlılık (hücre döngüsünün faz G2 bloke) , protein sentezinin yüksek kapasiteli (200-400 ng / gün / oosit), ekstre solüsyonu ° yüksek sayıdaaynı hayvandan ytes (800-1.000 oosit / kadın) ve manipülasyonunu daha da kolaylaştırır hücre boyutu (çapı 1.2-1.4 mm). Sentezlenen mRNA ile Xenopus oosit Mikroenjeksiyon kolayca tercüme adımları incelemek için yapılabilir. Bu görüşe göre, diğer avantajlar sağlar. Mayoz ilerleme hızı ve çevirinin mRNA mikroenjeksiyon (~ 24 saat) sonra göz önüne alındığında, Xenopus oosit yeniden hücresel (E.coli çıkarılan, buğday mikroplar veya tavşan retikülosit ...) sistemleri bir mRNA olduğu karşılaştırıldığında hızlı bir sistemi temsil azaltılmış tercüme oranıyla ve düşük bir hızda çevrilmiştir. Yani, bir mRNA tanıtılan bir mutasyonun etkisi hızla gözlemlenebilir ve kolayca birkaç oositlerinde okudu olacaktır. Xenopus oositleri diğer bir avantajı, maternal mRNA&#39;lar latent ve protein için projesteron uyarması önce engellenmiş olmasıdır. Progesteron eklenmesi dolayısıyla çeviri indüksiyon kontrol için iyi bir araçtır. Sitoplazmik polyadenylation oogenez sırasında meydana gelmez. Bu zamansal sırayla progesteron uyarılmış oosit oosit olgunlaşması sırasında başlar ve erken gelişme boyunca devam eder ve çevirinin farklı adımları incelemek için kullanılabilir. Mos mRNA poliadenilasyon meydana ilk arasındadır ve Charlesworth ark tanımlanan &quot;erken olgunlaşma&quot; genlerin sınıfına Aurora A / EG2, Histone Benzeri B4 mRNA ile aittir. (2004) 9. Böyle Cyclin A1 ve B1 Siklin olarak &quot;geç&quot; mRNA öteleme indüksiyon germinal vezikül arıza (GVBD) zamanında etrafında oluşur. Mos mRNA, bir serin / treonin protein kinazın-kodlar. Dolaylı oosit olgunlaşmasını aktive MAP kinaz kaskad indükler beri çeviri önemlidir. Gerçekten de, progesteron tepki olarak, mos mRNA poliadenilasyon eg2 düzenleyici proteinleri ve inci başka RNA bağlanma proteinleri Aurora A / kapsayan bir işlem ile arttırılırmos mRNA&#39;nın e 3&#39;UTR içerir. Mos mRNA bu artan poliadenilasyon da MEK1 aktive mos proteini seviyesinin bir artışa yol açar. Bu işlem, hücre dışı bir sinyal ayarlı kinaz 2-(ERK2) (Şekil 1) ait aktivasyon aracılık eder. Bu sinyal yolunun daha sonra faktör teşvik olgunlaşma M-fazı, Siklin B, Cdc2 kinaz tarafından oluşturulan bir kompleks tetikler ve sonunda öz değişmesine ait yeniden başlamasını sonuçlanır olabilir. Xenopus oosit laevis nedenle, bu tür mos gibi anne mRNA çalışma kolayca birkaç mos, bileşenler sinyal de GVBD oranının belirlenmesi de dahil olmak üzere çeviri onların verimli poliadenilasyonu birkaç uç noktaları ile çevirilebilirlik test etmek için kullanılabilir. Bu sistem, yeni transkripsiyonu mRNA veya transfeksiyon verimlilik müdahalesi olmadan çeviri başlatma faktörleri mutasyonların ilk sonuçlarını değerlendirmek, bu nedenle ilginç sorunlar sıklıkla eukary ile meydana gelenotik hücre çalışmaları. Burada, bir protokol Xenopus oosit laevis ve anne mRNA çeviri test edilir mutant eIF4G1 mRNAlar microinjected nerede kurulmuştur. Oosit mayoz hücre döngüsü boyunca ve erken ve geç sınıf mRNA&#39;larının sonraki çeviri için ilerlemesi için gerekli olan bir GVBD ilerlemesinde defekt, mos mRNA polidenilasyondan huzurunda tespit edilmiştir. Fosforilasyonu Aurora A / EG2 ve ERK de mos deregulation.Thus sonucunu doğrulamak için çalışılmıştır, Xenopus oositler mRNA çeviri farklı adımlar analiz için basit bir yol gösterir.

<table border="0" cellpadding="0" cellspacing="0">
	<tbody>
		<tr>
			<td>Tricaine methane sulphonate</td>
			<td>Sandoz</td>
			<td>MS-222</td>
			<td rowspan="8">oocytes handling</td>
		</tr>
		<tr>
			<td>Forceps</td>
			<td>Moria</td>
			<td>Dumont MC40</td>
		</tr>
		<tr>
			<td>Streptomycin/penicillin</td>
			<td>Sigma</td>
			<td>781</td>
		</tr>
		<tr>
			<td>Sodium pyruvate</td>
			<td>Sigma</td>
			<td>P2256</td>
		</tr>
		<tr>
			<td>Soybean trypsin inhibitor</td>
			<td>Sigma</td>
			<td>T9128</td>
		</tr>
		<tr>
			<td>Tetracyclin</td>
			<td>Sigma</td>
			<td>T7660</td>
		</tr>
		<tr>
			<td>Veterinarian absorbable Vicryl thread</td>
			<td>Johnson&#38;Johson Intl</td>
			<td>JV1205</td>
		</tr>
		<tr>
			<td>Collagenase A</td>
			<td>Roche diagnostics</td>
			<td>10103586001</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>PmeI</td>
			<td>New England Biolabs</td>
			<td>R0560S</td>
			<td rowspan="14">Preparation of synthetic mRNA</td>
		</tr>
		<tr>
			<td>DNAse/RNAse free H2O</td>
			<td>Life Technologies</td>
			<td>10977</td>
		</tr>
		<tr>
			<td>Sodium Acetate</td>
			<td>Merck</td>
			<td>6268</td>
		</tr>
		<tr>
			<td>Absolute ethanol</td>
			<td>Sigma</td>
			<td>02854</td>
		</tr>
		<tr>
			<td>Nano Drop</td>
			<td>Thermo Scientific</td>
			<td></td>
		</tr>
		<tr>
			<td>TBE 10X</td>
			<td>Eppendorf</td>
			<td>0032006.507</td>
		</tr>
		<tr>
			<td>Ethidium bromide 10 mg/mL</td>
			<td>Life Technologies</td>
			<td>15585-011</td>
		</tr>
		<tr>
			<td>mMESSAGE mMACHINE&#174; Kit</td>
			<td>Ambion by Life Technologies</td>
			<td>AM1344</td>
		</tr>
		<tr>
			<td>MOPS</td>
			<td>Sigma</td>
			<td>M1254</td>
		</tr>
		<tr>
			<td>EDTA</td>
			<td>Fluka</td>
			<td>03609</td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Life Technologies</td>
			<td>16500-500</td>
		</tr>
		<tr>
			<td>Formaldehyde 37%</td>
			<td>Merck</td>
			<td>1.04003.1000</td>
		</tr>
		<tr>
			<td>Formamide</td>
			<td>Fluka</td>
			<td>47671</td>
		</tr>
		<tr>
			<td>Gel Doc Imager</td>
			<td>Biorad</td>
			<td></td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Oocyte Pipet with 100 8&#34; Glass Capillaries</td>
			<td>Drummond Scientific Company</td>
			<td>3-000-510-X</td>
			<td rowspan="4">microinjection</td>
		</tr>
		<tr>
			<td>Replacement Glass 8&#34;</td>
			<td>Drummond Scientific Company</td>
			<td>3-000-210-G8</td>
		</tr>
		<tr>
			<td>0,45 &#181;m filter</td>
			<td>Millipore</td>
			<td>SLHA025NB</td>
		</tr>
		<tr>
			<td>Progesterone</td>
			<td>Sigma</td>
			<td>P0130</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Hepes</td>
			<td>Sigma</td>
			<td>H3375</td>
			<td rowspan="32">Western Blot</td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Sigma</td>
			<td>S5886</td>
		</tr>
		<tr>
			<td>SDS</td>
			<td>Biorad</td>
			<td>161-0301</td>
		</tr>
		<tr>
			<td>MgCl2</td>
			<td>Sigma</td>
			<td>A3294</td>
		</tr>
		<tr>
			<td>Bovine serum albumin</td>
			<td>Sigma</td>
			<td>A4612</td>
		</tr>
		<tr>
			<td>leupeptin</td>
			<td>Sigma</td>
			<td>L8511</td>
		</tr>
		<tr>
			<td>aprotinin</td>
			<td>Sigma</td>
			<td>A1153</td>
		</tr>
		<tr>
			<td>benzamidine</td>
			<td>Sigma</td>
			<td>B6506</td>
		</tr>
		<tr>
			<td>PMSF</td>
			<td>Sigma</td>
			<td>P7626</td>
		</tr>
		<tr>
			<td>sodium vanadate</td>
			<td>Sigma</td>
			<td>S6508</td>
		</tr>
		<tr>
			<td>Laemmli buffer</td>
			<td>Biorad</td>
			<td>161-0737</td>
		</tr>
		<tr>
			<td>NuPAGE Novex 4-12% Bis-Tris Protein Gels, 1.0 mm, 15 well</td>
			<td>Life Technologies</td>
			<td>NP0323BOX</td>
		</tr>
		<tr>
			<td>SDS-PAGE electrophoresis, mini-Protean TGX</td>
			<td>Biorad</td>
			<td>456-1036 and -1096</td>
		</tr>
		<tr>
			<td>horizontal semi-dry blotting system</td>
			<td>W.E.P. Compagny</td>
			<td></td>
		</tr>
		<tr>
			<td>Glycine</td>
			<td>Biorad</td>
			<td>161-0718</td>
		</tr>
		<tr>
			<td>Tris-HCl</td>
			<td>Biorad</td>
			<td>161-0719</td>
		</tr>
		<tr>
			<td>Hybond ECL Membrane</td>
			<td>Amersham Life Science</td>
			<td>10401180</td>
		</tr>
		<tr>
			<td>Methanol</td>
			<td>VWR</td>
			<td>20846-292</td>
		</tr>
		<tr>
			<td>Ponceau Red (0,5%)</td>
			<td>Sigma</td>
			<td>P3504</td>
		</tr>
		<tr>
			<td>Tween 20</td>
			<td>Sigma</td>
			<td>P2287</td>
		</tr>
		<tr>
			<td>anti-GFP</td>
			<td>Life Technologies</td>
			<td>A11122</td>
		</tr>
		<tr>
			<td>anti-V5</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-58052</td>
		</tr>
		<tr>
			<td>anti-Eg2</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-27884</td>
		</tr>
		<tr>
			<td>anti-Eg2-P</td>
			<td>Cell Signaling</td>
			<td>C39D8</td>
		</tr>
		<tr>
			<td>anti-ERK2</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-1647</td>
		</tr>
		<tr>
			<td>anti-ERK2-P (Tyr204)</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-7976</td>
		</tr>
		<tr>
			<td>anti-Rsk</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-231</td>
		</tr>
		<tr>
			<td>anti-mos</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-86</td>
		</tr>
		<tr>
			<td>anti-mouse horseradish peroxidase labeled secondary antibody</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-2005</td>
		</tr>
		<tr>
			<td>anti-rabbit horseradish peroxidase labeled secondary antibody</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-2812</td>
		</tr>
		<tr>
			<td>anti-goat horseradish peroxidase labeled secondary antibody</td>
			<td>Santa Cruz Biotechnology</td>
			<td>sc-2378</td>
		</tr>
		<tr>
			<td>Advanced ECL Detection System</td>
			<td>Amershan Life Science</td>
			<td>RPN2135</td>
		</tr>
		<tr>
			<td></td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>PBS 1x</td>
			<td>Sigma</td>
			<td>P4417</td>
			<td rowspan="11">polyadenylation assay</td>
		</tr>
		<tr>
			<td>TRIZOL (Qiazol Lysis Reagent)</td>
			<td>Qiagen</td>
			<td>79306</td>
		</tr>
		<tr>
			<td>Chloroform</td>
			<td>Sigma</td>
			<td>31998-8</td>
		</tr>
		<tr>
			<td>Isopropanol</td>
			<td>Sigma</td>
			<td>278475-1L</td>
		</tr>
		<tr>
			<td>RNeasy mini kit</td>
			<td>Qiagen</td>
			<td>74106</td>
		</tr>
		<tr>
			<td>RTL buffer&#160;</td>
			<td>Qiagen</td>
			<td>79216</td>
		</tr>
		<tr>
			<td>RNAse free DNAse set</td>
			<td>Qiagen</td>
			<td>79254</td>
		</tr>
		<tr>
			<td>Primers</td>
			<td>Eurogentec</td>
			<td></td>
		</tr>
		<tr>
			<td>T4 RNA ligase 1&#160;</td>
			<td>New England Biolabs</td>
			<td>M0204S</td>
		</tr>
		<tr>
			<td>High capacity c-DNA Reverse Transcription kit</td>
			<td>Applied Biosystems, Life Technologies</td>
			<td>4368813</td>
		</tr>
		<tr>
			<td>Taq polymerase</td>
			<td>Life Technologies</td>
			<td>10342020</td>
		</tr>
	</tbody>
</table>

xenopus laevis as a model to identify translation impairment

Protein sentezi, çeşitli biyolojik süreçleri çevresel koşullara özellikle adaptasyon etkileyen gen ifadesi temel bir süreçtir. MRNA başlangıç ​​kodonu da dahil olmak üzere ilgili eIF4G1 başlatma faktörü ribozomal alt birimlerinin düzenlenmesine içeren başlangıç ​​aşaması. Çevirinin bu oran sınırlayıcı bir aşama kusurlar, çeşitli bozuklukları ile bağlantılıdır. Bu tür özerkleştirmeler olası sonuçlarını incelemek için, Xenopus oositler insanla temel hücresel ve moleküler mekanizmaları korunması yüksek derecede çekici bir model teşkil laevis. Buna ek olarak, mayoz olgunlaşma sırasında, oosit transkripsiyonel bastırılmış ve gerekli tüm proteinleri önceden var, maternal mRNA&#39;lardan çevrilir. Bu ucuz modeli etkin bir çeviri ile mükemmel entegre olmak için eksojen mRNA sağlar. Burada (eIF4G1 here) ilgi konusu bir faktör ile çeviri değerlendirmek stor kullanmak için bir protokol açıklananİlk olduklarını anne mRNA ed poliadenile ve fizyolojik okuma olarak oosit olgunlaşması sırasında tercüme edilecek. İlk başta, mRNA ilgi plazmidler (buradan eIF4G1) in vitro transkripsiyonu ile sentezlenmiş oluşum safhası torbacığı yarılmasının tespiti ile oosit ve oosit olgunlaşma kinetiği enjekte edilir belirlenir. Çalışılan anne mRNA hedef, serin / treonin protein kinaz mos olup. Bu poliadenilasyon ve daha sonraki için oosit olgunlaşmasında yer alan sinyalleme kaskadında mos proteinlerinin ekspresyonu ve fosforilasyon ile birlikte incelenmiştir. Geçerli protokol Varyasyonları ortaya koymak için öteleme kusurları da genel uygulanabilirliğini vurgulamak için önerilmiştir. Anormal protein sentezinin nörolojik bozuklukların patogenezinde olabilir dair kanıtlar ortaya ışığında, böyle bir model kolayca bu bozukluğunu değerlendirmek ve yeni hedefler belirlemek için bir fırsat sunuyor.

PG stimülasyon 24 saat (Şekil 2B, 2C) sonra, Xenopus oositlerde ve yüzde oosit GVBD belirlenmesi kinetik olgunlaşma EIF4G1-DN mutasyon translasyon sonuçlarını incelemek için, Xenopus PG&#39;ye yanıtı (2 H, O, GFP) eIF4G1-WT ve diğer kontrol koşulları mukayese edilir cRNA eIF4G1-DN microinjected oosit laevis. Kontroller bakılmaksızın enjekte cRNA veya eIF4G1 aşın doğanın oosit mikroenjeksiyon insidansını değerlendir...

Watch this Scientific Journal Video about Xenopus laevis as a Model to Identify Translation Impairment at JoVE.com

Xenopus laevis as a Model to Identify Translation Impairment

Protein synthesis control occurs mainly at the translation initiation step, deficiencies in which are linked to diverse disorders. To better understand their etiology, we described here a protocol using Xenopus laevis oocytes assessing the translation of mos transcript in the presence of a mutant of translation initiation factor eIF4G1.

Ksenopus Translation Düşüklüğü Belirlemek için Bir Model Olarak laevis

Protein synthesis is a fundamental process to gene expression impacting diverse biological processes notably adaptation to environmental conditions. The ...

xenopus-laevis-as-a-model-to-identify-translation-impairment

Research

JoVE Journal

Biology

Xenopus laevis as a Model to Identify Translation Impairment

10.6K Görüntüleme.  INSERM UMR-S1172, CHRU Lille, University of Lille 1 and Lille 2. Protein synthesis control occurs mainly at the translation initiation step, deficiencies in which are linked to diverse disorders. To better understand their etiology, we described here a protocol using Xenopus laevis oocytes assessing the translation of mos transcript in the presence of a mutant of translation initiation factor eIF4G1.

Video: Xenopus laevis as a Model to Identify Translation Impairment

Dissection of Organizer and Animal Pole Explants from Xenopus laevis Embryos and Assembly of a Cell Adhesion Assay

This video demonstrates the technique used for preparation of organizer and animal pole explants from Xenopus laevis embryos, including the use of the eyebrow knife - a specialized dissection tool made of one's eyebrow. The protocol for assembling an adhesion assay is also given, which probes for the presence of key adhesion molecules present on the surface organizer or animal pole cells that are critical for proper development.

Organizatör ve Hayvan Kutbu eksplantlar Xenopus laevis Embriyolar ve Hücre Yapışma Testi Meclisi diseksiyonu

Biyoloji

Plastic Embedding and Sectioning of Xenopus laevis Embryos

Plastic sections maintain true tissue morphology in thin sections of tissue that can be immunostained with fluorescent secondary antibodies, making this method more useful than paraffin-embedded or frozen sections for many types of tissue. The method for staining, plastic embedding, and sectioning is demonstrated in this video.

Plastik gömülmesi ve Xenopus laevis Embriyolar Kesit

Obtaining Eggs from Xenopus laevis Females

The eggs of Xenopus laevis intact, lysed, and/or fractionated are useful for a wide variety of experiments. This protocol shows how to induce egg laying, collect and dejelly the eggs, and sort the eggs to remove any damaged eggs.

The eggs of Xenopus laevis intact, lysed, and/or fractionated are useful for a wide variety of experiments. This protocol shows how to induce egg laying, collect and dejelly the eggs, and sort the eggs to remove any damaged eggs.

Xenopus laevis Dişiler Yumurta Alınması

The eggs of Xenopus laevis intact, lysed, and/or fractionated are useful for a wide variety of experiments. This protocol shows how to induce egg laying, ...

Preparation and Fractionation of Xenopus laevis Egg Extracts

Crude and fractionated Xenopus egg extracts can be used to provide ingredients for reconstituting cellular processes for morphological and biochemical analysis. Egg lysis and differential centrifugation are used to prepare the crude extract which in turn in used to prepare fractionated extracts and light membrane preparations.

Crude and fractionated Xenopus egg extracts can be used to provide ingredients for reconstituting cellular processes for morphological and biochemical analysis. Egg lysis and differential centrifugation are used to prepare the crude extract which in turn in used to prepare fractionated extracts and light membrane preparations.

Xenopus laevis Yumurta hazırlanması ve Fraksiyonu ayıklar.

Crude and fractionated Xenopus egg extracts can be used to provide ingredients for reconstituting cellular processes for morphological and biochemical ...

Microinjection of Xenopus Laevis Oocytes

Microinjection of Xenopus laevis oocytes followed by thin-sectioning electron microscopy (EM) is an excellent system for studying nucleocytoplasmic transport. Because of its large nucleus and high density of nuclear pore complexes (NPCs), nuclear transport can be easily visualized in the Xenopus oocyte. Much insight into the mechanisms of nuclear import and export has been gained through use of this system (reviewed by Pant&eacute;, 2006). In addition, we have used microinjection of Xenopus oocytes to dissect the nuclear import pathways of several viruses that replicate in the host nucleus. 
Here we demonstrate the cytoplasmic microinjection of Xenopus oocytes with a nuclear import substrate. We also show preparation of the injected oocytes for visualization by thin-sectioning EM, including dissection, dehydration, and embedding of the oocytes into an epoxy embedding resin. Finally, we provide representative results for oocytes that have been microinjected with the capsid of the baculovirus Autographa californica nucleopolyhedrovirus (AcMNPV) or the parvovirus Minute Virus of Mice (MVM), and discuss potential applications of the technique.

Here we demonstrate cytoplasmic microinjection of Xenopus laevis oocytes with a nuclear import substrate, as well as preparation of the injected oocytes for visualization by thin-sectioning electron microscopy.

Xenopus laevis Oosit, Mikroenjeksiyon

Microinjection of Xenopus laevis oocytes followed by thin-sectioning electron microscopy (EM) is an excellent system for studying nucleocytoplasmic ...

Tissue Determination Using the Animal Cap Transplant (ACT) Assay in Xenopus laevis

Many proteins play a dual role in embryonic development. Those that regulate cell fate determination in a specific tissue can also affect the development of a larger region of the embryo. This makes defining its role in a particular tissue difficult to analyze. For example, noggin overexpression in Xenopus laevis embryos causes the expansion of the entire anterior region, including the eye1,2. From this result, it is not known if Noggin plays a direct role in eye determination or that by causing an expansion of neural tissue, Noggin indirectly affects eye formation. Having this complex phenotype makes studying its eye-specific role in cell fate determination difficult to analyze. We have developed an assay that overcomes this problem. Taking advantage of the pluripotent nature of the Xenopus laevis animal cap 3, we have developed an assay to test the ability of gene product(s), like noggin or the eye field transcription factors (EFTFs), to transform caps into particular tissue or cell types by transplanting this tissue onto the side of the embryo 4. While we have found either Noggin protein treatment or a collection of transcription factors can determine retinal cell fate in animal caps, this procedure could be used to identify gene product(s) involved in specifying other tissues as well.

Tissue Determination Using the Animal Cap Transplant ACT Assay in Xenopus laevis

Animal caps overexpressing gene product(s) are transplanted to the flank of developing Xenopus laevis embryos in order to establish whether tissue is determined.

Doku belirlenmesi Hayvan Cap Nakli (ACT) Testi Xenopus laevis</em

Many proteins play a dual role in embryonic development. Those that regulate cell fate determination in a specific tissue can also affect the development ...

Live-cell Imaging and Quantitative Analysis of Embryonic Epithelial Cells in Xenopus laevis

Embryonic epithelial cells serve as an ideal model to study morphogenesis where multi-cellular tissues undergo changes in their geometry, such as changes in cell surface area and cell height, and where cells undergo mitosis and migrate. Furthermore, epithelial cells can also regulate morphogenetic movements in adjacent tissues1. A traditional method to study epithelial cells and tissues involve chemical fixation and histological methods to determine cell morphology or localization of particular proteins of interest. These approaches continue to be useful and provide "snapshots" of cell shapes and tissue architecture, however, much remains to be understood about how cells acquire specific shapes, how various proteins move or localize to specific positions, and what paths cells follow toward their final differentiated fate. High resolution live imaging complements traditional methods and also allows more direct investigation into the dynamic cellular processes involved in the formation, maintenance, and morphogenesis of multicellular epithelial sheets. Here we demonstrate experimental methods from the isolation of animal cap tissues from Xenopus laevis embryos to confocal imaging of epithelial cells and simple measurement approaches that together can augment molecular and cellular studies of epithelial morphogenesis.

Live-cell Imaging and Quantitative Analysis of Embryonic Epithelial Cells in Xenopus laevis

Xenopus embryonic epithelia are an ideal model system to study cell behaviors such as polarity development and shape change during epithelial morphogenesis. Traditional histology of fixed samples is increasingly being complemented by live-cell confocal imaging. Here we demonstrate methods to isolate frog tissues and visualize live epithelial cells and their cytoskeleton using live-cell confocal microscopy.

Canlı hücre Görüntüleme ve Kantitatif Analiz Embriyonik Epitel Hücreleri Xenopus laevis</em

Embryonic epithelial cells serve as an ideal model to study morphogenesis where multi-cellular tissues undergo changes in their geometry, such as changes ...

Production of Transgenic Xenopus laevis by Restriction Enzyme Mediated Integration and Nuclear Transplantation

Stable integration of cloned gene products into the Xenopus genome is necessary to control the time and place of expression, to express genes at later stages of embryonic development, and to define how enhancers and promoters regulate gene expression within the embryo. The protocol demonstrated here can be used to efficiently produce transgenic Xenopus laevis embryos. This transgenesis approach involves three parts: 1. Sperm nuclei are isolated from adult X. laevis testis by treatment with lysolecithin, which permeabilizes the sperm plasma membrane. 2. Egg extract is prepared by low speed centrifugation, addition of calcium to cause the extract to progress to interphase of the cell cycle, and a high-speed centrifugation to isolate interphase cytosol. 3. Nuclear transplantation: the nuclei and extract are combined with the linearized plasmid DNA to be introduced as the transgene and a small amount of restriction enzyme. During a short reaction, egg extract partially decondenses the sperm chromatin and the restriction enzyme generates chromosomal breaks that promote recombination of the transgene into the genome. The treated sperm nuclei are then transplanted into unfertilized eggs. Integration of the transgene usually occurs prior to the first embryonic cleavage such that the resulting embryos are not chimeric. These embryos can be analyzed without any need to breed to the next generation, allowing for efficient and rapid generation of transgenic embryos for analyses of promoter and gene function. Adult X. laevis resulting from this procedure also propagate the transgene through the germline and can be used to generate lines of transgenic animals for multiple purposes.

Production of Transgenic Xenopus laevis by Restriction Enzyme Mediated Integration and Nuclear Transplantation

This video protocol demonstrates a method for generating transgenic Xenopus laevis by introduction of transgenes into sperm nuclei followed by nuclear transplantation into unfertilized eggs.

Transgenik, üretimi Xenopus laevis Kısıtlama Enzim aracılığı ile Entegrasyon ve Nükleer Nakli

Stable integration of cloned gene products into the Xenopus genome is necessary to control the time and place of expression, to express genes at later ...

Production of Xenopus tropicalis Egg Extracts to Identify Microtubule-associated RNAs

Many organisms localize mRNAs to specific subcellular destinations to spatially and temporally control gene expression. Recent studies have demonstrated that the majority of the transcriptome is localized to a nonrandom position in cells and embryos. One approach to identify localized mRNAs is to biochemically purify a cellular structure of interest and to identify all associated transcripts. Using recently developed high-throughput sequencing technologies it is now straightforward to identify all RNAs associated with a subcellular structure. To facilitate transcript identification it is necessary to work with an organism with a fully sequenced genome. One attractive system for the biochemical purification of subcellular structures are egg extracts produced from the frog Xenopus laevis. However, X. laevis currently does not have a fully sequenced genome, which hampers transcript identification. In this article we describe a method to produce egg extracts from a related frog, X. tropicalis, that has a fully sequenced genome. We provide details for microtubule polymerization, purification and transcript isolation. While this article describes a specific method for identification of microtubule-associated transcripts, we believe that it will be easily applied to other subcellular structures and will provide a powerful method for identification of localized RNAs.

Production of Xenopus tropicalis Egg Extracts to Identify Microtubule-associated RNAs

We describe the collection of unfertilized Xenopus tropicalis eggs and production of a meiosis II-arrested egg extract. This egg extract can be used to purify microtubules and microtubule-associated RNAs.

Üretimi<em&gt; Xenopus tropicalis</em&gt; Yumurta Mikrotubul ilişkili RNA&#39;lar tanımak ayıklar

Many  organisms localize mRNAs to specific subcellular destinations to spatially and  temporally control gene expression. Recent studies have demonstrated ...

Facial Transplants in Xenopus laevis Embryos

Craniofacial birth defects occur in 1 out of every 700 live births, but etiology is rarely known due to limited understanding of craniofacial development. To identify where signaling pathways and tissues act during patterning of the developing face, a 'face transplant' technique has been developed in embryos of the frog Xenopus laevis. A region of presumptive facial tissue (the "Extreme Anterior Domain" (EAD)) is removed from a donor embryo at tailbud stage, and transplanted to a host embryo of the same stage, from which the equivalent region has been removed. This can be used to generate a chimeric face where the host or donor tissue has a loss or gain of function in a gene, and/or includes a lineage label. After healing, the outcome of development is monitored, and indicates roles of the signaling pathway within the donor or surrounding host tissues. Xenopus is a valuable model for face development, as the facial region is large and readily accessible for micromanipulation. Many embryos can be assayed, over a short time period since development occurs rapidly. Findings in the frog are relevant to human development, since craniofacial processes appear conserved between Xenopus and mammals.

Facial Transplants in Xenopus laevis Embryos

A technique for transplanting "Extreme Anterior Domain" facial tissue between Xenopus laevis embryos has been developed. Tissue can be moved from one gene expression background into another, allowing the study of local requirements for craniofacial development and for signaling interactions between facial regions.

Yüz Nakli<em&gt; Xenopus laevis</em&gt; Embriyolar

Craniofacial birth defects occur in 1 out of every 700 live births, but etiology is rarely known due to limited understanding of craniofacial development. ...