Name: xenopus laevis as a model to identify translation impairment
Uploaded: 2015-09-27T14:00:00.000+00:00
Duration: 10 min 24 s
Description: Watch this Scientific Journal Video about Xenopus laevis as a Model to Identify Translation Impairment at JoVE.com

This research was supported by grant from INSERM, University of Lille 1, University of Lille 2, Regional Hospital Center of Lille (CHR de Lille). MCCH acknowledges supports from the Fondation de France and wishes to thank IRCL, Pr. Sonenberg for the gift of the V5-plasmids, Dr. Dissous (Pasteur Institute, Lille) for the gift of anti-GFP antibodies, UMS 3387 (University of Rennes) where Xenopus oocytes are purchased and Dr Taymans (JPArc, Lille) for critical reading of the manuscript text.

모든 Xenopus의 실험은 실험실 동물 실험에 대한 유럽 공동체위원회 지침 (609분의 86 / EEC)의 규칙에 따라 릴 1 대학의 동물 시설에서 수행 하였다. 동물 프로토콜 (위원회 (CCT) 디부 Ethique 실내 실험 ANIMALE 노르 파 드 칼레 CEEA 07/2010)을 지역 기관 심사위원회에 의해 승인되었다. 1. 난자 처리 <ol><li> 마취 솔루션을 준비 : 멸균 물 1 L에 tricaine 메탄 설포 네이트 분말 1g을 용해. </li><li> 여성 Xenopus의이 솔루션에 laevis의 플 런지는 탈출을 방지하고 동물이 완전히 (다리 핀치에 어떤 반응없이) 진정 될 때까지 약 45 분을 기다리는 비커를 다룹니다. </li><li> 다음 깨끗한 알루미늄 호일에의 뒷면에있는 동물을 배치 비누로 개구리를 씻고 수돗물로 씻어. </li><li> 복부 측 부분과 집게 난소 레벨에서 피부 클램프.에탄올 70 %와 함께 사용하기 전에 청소 가위로 약 1cm의 절개를합니다. 섹션이 충분히 깊은 있는지 확인 및 개발의 여러 단계에서 여러 난자가 발견되는 난소 조직의 절제를 허용하는 기본 복벽에 도달 할 수 있습니다. </li><li> ND96 매체 (96 mM의 NaCl을, 2 밀리미터의 KCl와 페트리 접시 (50mm)에 그들에게 4 회 세척, 난소 로브를 해부, 1 밀리미터의 MgCl 2, 1.8 mM의 염화칼슘 2, 5 mM의 HEPES는 NaOH로 pH를 7.4로 조정 보충 50 μg의와 / ㎖ 스트렙토 마이신 / 페니실린, 225 μg의 / ㎖ 나트륨 피루 베이트, / ㎖ 대두 트립신 억제제 30 μg의 1 μL / ㎖ 테트라 사이클린) 피와 파편의 모든 흔적을 제거합니다. 참고 : 테트라 사이클린은 최적의 보존 및 미세 주사 치료 후 좋은 복구를 할 수 있습니다. </li><li> 일주일 동안 자신의 보존을 허용, 14 ° C에서 매체에 잠긴 덮여 페트리 접시에 저장합니다. </li><li> 복부 벽과 수의사 흡수 T와 피부 스티치hread 및 봉합 바늘 (3 또는 4 바늘이 필요합니다). </li><li> 물없이 비커에 동물을 놓고 개구리 다시 이동 될 때까지 수돗물로 피부를 축축한. 탈출을 방지하기 위해 비커를 커버. </li><li> 10 배 배율의 실체 현미경 집게 2 쌍을 이용하여 조심스럽게 5~10 난자 그룹 배지 난소 로브 별개. 단계 VI에서 선택 난자. 그들은 갈색 색소 동물 극과 직경 10 1.2 mm의 II) 크기 우수한 명확한 벨트로 구분 노란색 식물 극) 나는 그들의 모양과 색상을 인식 할 수있다. </li><li> (콜라게나 제는 난자 / 여포 세포 연결 다이제스트) 난자 defolliculation을 용이하게하기 위해 45 분 동안 교반과 아래 페트리 접시 (테트라 사이클린없이 ND96에 용해 상기 Clostridium histolyticum, 1 ㎎ / ㎖의 콜라게나) 콜라게나 제 용액에서 선택된 난자를 배양한다. ND96 매체에 3 ~ 4 시간은 14로 유지 난자를 씻어° C. 참고 : 난자 작거나 난자의 표면 단백질을 파괴하고 가난한 생존을 유발의 위험으로 인해 45 개 이상의 분 부화하지 마십시오. 콜라게나 제 처리는 자발적인 GVBD을 유도 할 수있다. </li><li> 3 ~ 4 시간 동안 매체에 난자를 품어. 양안 돋보기에서 미세 핀셋과 모낭 세포를 제거하고 ND96 배지에서 19 ℃에서 보관하십시오. </li></ol> mRNA의 합성 2. 준비 <ol><li> 나는 효소 PME를 사용하여 소화 효소에 의해 다음과 같은 플라스미드의 5 μg의 선형화. 참고 : pcDNA6.2 / 1599 아미노산 eIF4G1 cDNA를 야생형 (eIF4G1-WT; NM_198241)를 포함 V5-DEST 돌연변이 c.2105T과를, eIF4G1 지배적 인 부정의 cDNA (eIF4G1-DN)을 포함하는 pcDNA6.2 / V5-DEST &gt; G c.2106A&gt; C, c.2120-이&gt; G, c.2122T가&gt;, 2125T는&gt; - 그리고 c.2126T&gt; G는 해당 단백질의 618 위치 (612)에서 eIF4G1과의 eIF4E 사이의 상호 작용의 영역에 방해 상호 작용 betweEN eIF4G1과의 eIF4E 8, 클로람페니콜 아세틸 트랜스퍼를 포함 pcDNA6.2 / C-EmGFP (GFP). 3 플라스미드 각각 2 혼합물을 준비 : 나는 효소 처음 포함 PME와 두 번째 제어와 같은 효소없이. </li><li> 고전 에탄올 절차를 이용하여 플라스미드 DNA를 석출 클레아없는 H 2 O 20 μL에 재현 탁하여 </li><li> 분광 광도계를 사용하여 농도를 결정합니다. 농도가 된 cRNA를 전사 할 μL 150 NG / 우수해야한다. </li><li> 선형화 된 플라스미드를 확인하기 위해 1 ㎕의 시료와, 0.8 % 아가 로스 겔에 로딩 완충액 5 μL와의 컨트롤을 실행. </li><li> 시험 관내 전사 및 제조업체의 지침에 따라 cRNA를 정화 키트를 사용합니다. 전사 된 cRNA는 클레아없는 H 2 O 20 μL에 재현 탁 필요한 경우 샘플은 -80 ° C에서 저장 될 수있다. </li><li> 0.2 M MOPS (PH 7.0), 20m 함유 MOPS 10X 이주 버퍼를 준비M 아세트산 나트륨 및 10mM의 EDTA (PH 8.0). 0.45 μm의 필터 솔루션을 소독. 용액의 산화를 방지하기 위해 RT에서 빛으로부터 보호 용액 재고. </li><li> 수산화 나트륨, 염산으로 연속적으로 전기 탱크를 청소하고 철저 O위한 이중 여과하고, 물로 세정 / N이 된 RNase를 방지하고 RNA의 분해를 방지한다. </li><li> MOPS 및 포름 알데히드를 함유하는 1.5 % 아가 로스 겔 캐스팅. 완전한 아가로 오스 용해 될 때까지 따뜻한하고 55 ℃까지 냉각 할 수 있습니다. 흄 후드에서 MOPS 10 배의 0.1 볼륨, 포름 알데히드의 6.6 %와 에티 디움 브로마이드 4 μg의 (10 ㎎ / ㎖)를 추가합니다. 흄 후드에서 젤을 붓고 겔을 강화하는 약 1 시간을 기다립니다. 참고 : 포름 알데히드와 에티 디움 브로마이드 독성. </li><li> cRNA를 1 μL, 포름 알데히드 8.8 %, 포름 아미드의 60 %와 MOPS 10 배의 0.1 볼륨 0.2 ML 튜브에서 마이그레이션을위한 샘플을 준비합니다. 70 ℃에서 3 분 동안 품어 10 분 동안 얼음에 튜브를 넣어. 원심 분리기 샘플 몇 초에서5,000 × g으로. 젤 로딩 버퍼 2 μl를 추가합니다. 참고 : 포름 아미드 독성이다. </li><li> 90V에서 20 분 동안 샘플을 실행합니다. 된 cRNA 품질을 확인하기 위해 그것을 분석하기 전에 젤을 destain하는 뉴 클레아없는 H 2 OO / N에 젤을 만끽 해보세요. </li><li> 분광 광도계를 사용 된 cRNA 농도를 결정하고 -80 ℃에서 저장합니다. </li></ol> 신시 RNA와 난 모세포 성숙 자극 3. 미세 주입 <ol><li> 난자의 미세 주입에 필요한 장비를 준비합니다. 작은 유리 모세관을 당겨 마이크로 피펫 풀러를 사용합니다. 실체 현미경에서 무딘 끝을 생성하기 위해 핀셋으로 모세관의 말단을 끊다. 반대 말단에서 밀리 포아 0.45 μm의 필터로 1 ML의 주사기를 사용하여 미네랄 오일과 모세관 마이크로 피펫을 채 웁니다. 미세 주입 피펫 상에 마이크로 피펫을 마운트합니다. 적절한 유리 모세관와 함께 사용하면 좋은 정확성을 제공하기 위해 제조업체가 교정 정확한 마이크로 피펫을 선택합니다. </li><li> 미세 주입을 defolliculation 후 1 ~ 2 시간을 수행, 난자에 난자 복구에 필요한 지연은 14 ° C로 유지. 바닥에 사용 페트리 접시는 난자 용 접착제 표면을 만들고 ND96 매체를 채우기 위해 집게로 긁어. </li><li> 45 ° C의 각도 모세관 마이크로 피펫으로 난자의 연속 주입을 허용하는 페트리 접시에서 긁어 차선 따라 난자를 배열. </li><li> 세포질의 샘플 최적의 확산을 위해 착색 된 동물 영역 아래, 난자 적도 영역에 주입. 깊이 약 150 ~ 200 μm의에 모세관 팁의 얇은 부분을 삽입합니다. </li><li> 먼저 난자에 60 NL의 볼륨에 다른 플라스미드에서 각각 획득 된 cRNA의 30 NG를 주입한다. 주입 후, 샘플 탈출 (그림 2A)를 방지하기 위해 모세관 팁을 제거하기 전에 5 ~ 10 초 동안 기다립니다. 참고 : 120 NL을 초과하지 마십시오. 천천히 당신이 할 수있는 주입한다. 증류수로 제어하는​​ 것이 좋습니다. </li><li> 다음 난자를 주입하기 위해 수동으로 배양 접시를 이동합니다. 참고 : 끝이 2 ~ 3 microinjections 후 목욕 솔루션에서 작은 펄스를 생성하여 막혀 있지 않은지 확인합니다. </li><li> 24 웰 배양 플레이트에 전송 주입 된 난 모세포 (난자 10 / 웰) 신선한 ND96 매체의 3 ㎖로 가득하고 19 ° C에서 그들을 둡니다. </li><li> 19 ° C에서 감수 성숙 (GVBD)을 트리거하는 황체 호르몬 (PG) (2 μg의 / ml)로 ND96의 난자를 품어 15 시간 또는 pcDNA6.2 / V5-DESTeIF4G1 및 pcDNA6에서 각각 얻은 폴리아 데 닐화 된 cRNA의 미세 주입 후 4 시간 .2 / C-EmGFP는 제어 (그림 2A)로 사용. 참고 : cRNA를 형광 마커의 공동 주입 된 cRNA 주입하고 난 모세포에 남아되었는지 확인하는 좋은 도구입니다. GFP 태그 관심 된 cRNA를 이용한 예비 실험을 수행합니다. </li><li> Microinject 등의 # 3.5 다른 비율 (1 : 3, 2 : 2, 3 : 1) 테하기 위해 eIF4G1-WT 및 eIF4G1-DN 된 cRNA를 폴리아 데 닐화의세인트 돌연변이 표현형 (그림 2D)에 eIF4G1-WT의 cRNA를 번역 효과. </li></ol> 4. 어린 싹 소포 고장 결정 <ol><li> 실체와 검은 동물 극에 흰색 반점의 존재를 관찰하여 PG 자극 후 성숙 난자의 수를 계산합니다. 제 24 시간 (그림 2B, 2C)까지 계산 매 시간마다 반복합니다. </li></ol> 5. 웨스턴 블롯 (WB) 분석 <ol><li> 50 mM의 헤 페스, 산도 7.4, 500 mM의 염화나트륨, 0.05 % SDS, 5 밀리미터의 MgCl 2, 1 mg의 다음 버퍼에 200 μL에서 4 ° C에서, 10 백에 의해 난자와 마이크로 피펫 팁과 등 운동의 그룹을 균질화 / ㎖ 소 혈청 알부민, 10 ㎎ / ㎖ 류 펩틴, 10 ㎎ / ㎖ 아프로 티닌, 10 ㎎ / ㎖ 대두 트립신 억제제, 10 ㎎ / ㎖ 벤즈 아미 딘, 1mM의 PMSF, 1 mM의 나트륨 바나 데이트. </li><li> 10,000 XG에서 15 분 동안 원심 분리 샘플 지질 (상부 상)과 막 (하부 상) F를 제거ractions. 단백질 농도를 결정하고, 램리 또는 비스 - 트리스 완충액으로 샘플 잔여 완료 분취를 저장, 세포질 분획을 수집 (1 : 1). 주 : 비스 - 트리스 젤 로딩 버퍼에서 가수 분해 된 단백질을 보호 더 중성 pH를 가질 </li><li> 10 분 동안 95 ° C에서 20 μg의 샘플을 가열한다. 아크릴 아마이드 겔의 우물에 각각의 샘플을로드합니다. 적절한 버퍼 탱크에 젤을 놓습니다. </li><li> V. 200에서 1 시간 동안 전기 영동을 수행 </li><li> TBS pH의 WB 8.0 실현 (트리스 염산을 15 mM의 NaCl을 150 mm의 트윈 0.1 %를 함유하는 10 % 소 혈청 알부민) 염소 항 - 오로라 / EG2 (1 : 3,000, 2 시간) 또는 토끼 안티와 -Aurora / EG2-P (1 : 4 ° C에서 1,000, O / N), 마우스 항 - ERK2 (1 : 3,000, 2 시간), 염소 항 - ERK2-P (Tyr204) (1 : 3,000, 2 시간 10,000, 2 시간) 및 토끼 항 Rsk를 (1), 토끼 항 - MOS (1 : 5000, 4 시간), 토끼 항 GFP (1 : 3,000, 2 시간)을 antibodies.Use가 마우스 항 V5 항체 (1 :로드 컨트롤과 같은 1,000, 2 시간) (). </li><li> 빨래막 3 시간 10 분 TBS-트윈과 함께 1 시간을 품어 1의 희석에 항 - 마우스 또는 항 - 토끼 또는 방지 염소 (IgM의) 고추 냉이 퍼 옥시 다제 표지 된 이차 항체 중 : 5,000, 1 : 7,500 및 1 : 각각 5,000. </li><li> TBS-트윈에서 10 분간 3 회 세척을 수행하고 고급 ECL 검출 시스템과 항원 - 항체 복합체를 검출한다. </li></ol> 6. 폴리아 데 닐화 분석 <ol><li> 샘플 1.5 ml의 조건에서 당 5 난자. 핵산 분해 효소가없는 PBS 1X (PH 7.4) 1 ㎖로 씻어. 다음 단계는 흄 후드 될 것이다. </li><li> (제조업체의 지침을 참조하십시오) 고전 유기 절차를 사용하여 RNA를 추출합니다. </li><li> 4 ℃에서 5 분 동안 원심 분리 (10,000 XG)에 의해 RNA를 복구 할 수 있습니다. 10 분 동안 뜨는 공기 건조 RNA를 제거합니다. </li><li> 뉴 클레아없는 H 2 O의 30 μL에 재현 탁의 RNA 펠릿 </li><li> 새로운 튜브에 샘플의 15 μl를 타고 뉴 클레아없는 H 2 O의 85 μl를 추가 정리SE 샘플은 제조업체의 지시에 따라, 실리카 칼럼에의 품질을 향상시킬 수있다. 뉴 클레아 제 무 H 2 O 30 μL를 사용하여 RNA를 용출 </li><li> RNA의 무결성을 검사하기 위해 0.8 % 아가 로즈 겔에 로딩 완충액으로 5 μL 샘플 1 μL를 실행. </li><li> 분광 광도계를 사용하여 RNA 농도를 결정한다. </li><li> 조건 당 2 결찰 혼합물을 준비합니다 (즉, eIF4G1-WT, eIF4G1-DN과 H 2 O 제어) 다음과 같은 시약 : RNA 리가 10 U, 10X 버퍼의 0.1 볼륨, 1 mM의 ATP, PEG8000 50 %의 10 % , 프라이머 P1 (5&#39;-P-GGTCACCTTGATCTGAAGC-NH2-3 &#39;) (11) 및 뉴 클레아없는 H 2 O 10 μL에 최종 볼륨을 가지고 0.1 μg의 PG 자극없이 난자로부터 얻어진 제 1 혼합물의 RNA에 추가 PG로부터 얻어지는 제 2 혼합물의 RNA에서 난 모세포를 자극. </li><li> 효소를 불 활성화하기 위해 65 ℃에서 20 분 후, 37 ℃에서 1 시간 동안 배양한다. </li><li> 우리EA의 cDNA 역전사 (RT) 키트. 튜브 당, RT 혼합물을 제조 : 10X RT 버퍼의 0.1 볼륨, 뉴 클레아없는 H와 프라이머 P2 (5&#39;-GCTTCAGATCAAGGTGACCTTTTT) (10), 4 밀리미터의 dNTP 혼합물, 역전사 효소 50 U와 0.1 μg의 완료 최종 볼륨 2 O 10 μL의. 이전에 취득한 연결 반응의 10 μl를 추가합니다. 제조업체에서 기술 조건에서 RT를 수행합니다. </li><li> (PCR) 혼합물, 튜브 당 중합 효소 연쇄 반응을 준비 : 버퍼 10 배의 0.1 볼륨, 1.5 밀리미터의 MgCl 2, 133 μM의의 dNTP 혼합물, 0.2 μm의 특정 프라이머, 0.2 μm의 프라이머 (P2), 0.025 U의 Taq 중합 효소, cDNA를 1 μL하고 완전한와 뉴 클레아 제 무 50 μL의 최종 부피로 H 2 O. 다음과 같은 조건에서 PCR을 수행 : 50 ° C를 2 분, 10 분 동안 95 ° C [30 초 1 분 95 ° C, 56 ° C, 30 초, 72 ° C]에 대한 * 40주기, 72 ° C 10 분 9. 다음과 같이 특정 프라이머는 다음과 같습니다 MOS, GTTGCATTGCTGTTTAAGTGGTAA 히스톤 같은 B4, AGTGACAAACTAGGCTGATATACT; 시클 A1, CATTGAACTGCTTCATTTTCCCAG; 사이클린 B1 : GTGGCATTCCAATTGTGTATTGTT 9. </li><li> 3 % 아가 로스 젤을 준비합니다. 각각의 PCR 산물을 로딩 완충액 10 μL에 추가. 최적의 마이그레이션을 위해 110 V에서 샘플 10 μL와 젤을 실행합니다. 그들의 번역 조건이다 꼬리 폴리 (A) RNA 따라서 성숙의 길이를 반영 크기의 변화를 관찰하기 위해 10, 20 분 후에 겔을 분석한다. </li></ol>

<ol>
	<li>Jackson, R. J., Hellen, C. U., Pestova, T. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+mechanism+of+eukaryotic+translation+initiation+and+principles+of+its+regulation.">The mechanism of eukaryotic translation initiation and principles of its regulation.</a> Nat Rev Mol Cell Biol. 11 (2), 113-127 (2010).</li><li>Holcik, M., Sonenberg, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translational+control+in+stress+and+apoptosis.">Translational control in stress and apoptosis.</a> Nat Rev Mol Cell Bio. 6 (4), 318-327 (2005).</li><li>Lopez-Lastra, M., Rivas, A., Barria, M. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protein+synthesis+in+eukaryotes:+the+growing+biological+relevance+of+cap-independent+translation+initiation.">Protein synthesis in eukaryotes: the growing biological relevance of cap-independent translation initiation.</a> Biol Res. 38 (2-3), 121-146 (2005).</li><li>Terenin, I. M., Andreev, D. E., Dmitriev, S. E., Shatsky, I. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+novel+mechanism+of+eukaryotic+translation+initiation+that+is+neither+m7G-cap-,+nor+IRES-dependent.">A novel mechanism of eukaryotic translation initiation that is neither m7G-cap-, nor IRES-dependent.</a> Nucleic Acids Res. 41 (3), 1807-1816 (2013).</li><li>Sonenberg, N., Hinnebusch, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulation+of+translation+initiation+in+eukaryotes:+mechanisms+and+biological+targets.">Regulation of translation initiation in eukaryotes: mechanisms and biological targets.</a> Cell. 136 (4), 731-745 (2009).</li><li>Van der Knaap, M. S., Leegwater, P. A., K&#246;nst, A. A., Visser, A., Naidu, S., Oudejans, C. B., Schutgens, R. B., Pronk, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+each+of+the+five+subunits+of+translation+initiation+factor+eIF2B+can+cause+leukoencephalopathy+with+vanishing+white+matter.">Mutations in each of the five subunits of translation initiation factor eIF2B can cause leukoencephalopathy with vanishing white matter.</a> Ann Neurol. 51 (2), 264-270 (2002).</li><li>Sen&#233;e, V., Vattem, K. M., Del&#233;pine, M., Rainbow, L. A., Haton, C., Lecoq, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Wolcott-Rallison+Syndrome:+clinical,+genetic,+and+functional+study+of+EIF2AK3+mutations+and+suggestion+of+genetic+heterogeneity.">Wolcott-Rallison Syndrome: clinical, genetic, and functional study of EIF2AK3 mutations and suggestion of genetic heterogeneity.</a> Diabetes. 53 (7), 1876-1883 (2004).</li><li>Chartier-Harlin, M. C., Dachsel, J. C., Vilari&#241;o-G&#252;ell, C., Lincoln, S. J., Lepr&#234;tre, F., Hulihan, M. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translation+initiator+EIF4G1+mutations+in+familial+Parkinson+disease.">Translation initiator EIF4G1 mutations in familial Parkinson disease.</a> Am J Hum Genet. 89 (3), 398-406 (2011).</li><li>Charlesworth, A., Cox, L. L., MacNicol, A. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytoplasmic+polyadenylation+Element+(CPE)-+and+CPE-binding+Protein+(CPEB)-independent+mechanisms+regulate+early+class+maternal+mRNA+translational+activation+in+Xenopus+oocytes.">Cytoplasmic polyadenylation Element (CPE)- and CPE-binding Protein (CPEB)-independent mechanisms regulate early class maternal mRNA translational activation in Xenopus oocytes.</a> J Biol Chem. 279 (17), 17650-17659 (2004).</li><li>Dumont, J. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oogenesis+in+Xenopus+laevis.">Oogenesis in Xenopus laevis.</a> J Morphol. 136, 153-180 (1972).</li><li>Rassa, J. C., Wilson, G. M., Brewer, G. A., Parks, G. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spacing+constraints+on+reinitiation+of+paramyxovirus+transcription:+the+gene+end+U+tract+acts+as+a+spacer+to+separate+gene+end+from+gene+start+sites.">Spacing constraints on reinitiation of paramyxovirus transcription: the gene end U tract acts as a spacer to separate gene end from gene start sites.</a> Virology. 274, 438-449 (2000).</li><li>Lin, W., Wadlington, N. L., Chen, L., Zhuang, X., Brorson, J. R., Kang, U. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Loss+of+PINK1+attenuates+HIF-1&#945;+induction+by+preventing+4E-BP1-dependent+switch+in+protein+translation+under+hypoxia.">Loss of PINK1 attenuates HIF-1&#945; induction by preventing 4E-BP1-dependent switch in protein translation under hypoxia.</a> J Neurosci. 34 (8), 3079-3089 (2014).</li><li>Martin, I., Kim, J. W., Lee, B. D., Kang, H. C., Xu, J. C., Jia, H. 2., Stankowski, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ribosomal+protein+s15+phosphorylation+mediates+LRRK2+neurodegeneration+in+Parkinson's+disease.">Ribosomal protein s15 phosphorylation mediates LRRK2 neurodegeneration in Parkinson's disease.</a> Cell. 57 (2), 472-485 (2014).</li><li>Cohen, S., Au, S., Pant&#233;, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microinjection+of+Xenopus+laevis+oocytes.">Microinjection of Xenopus laevis oocytes.</a> J Vis Exp. (24), (2009).</li><li>Willis, J., DeStephanis, D., Patel, Y., Gowda, V., Yan, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Study+of+the+DNA+damage+checkpoint+using+Xenopus+egg+extracts.">Study of the DNA damage checkpoint using Xenopus egg extracts.</a> J Vis Exp. (69), e4449 (2012).</li><li>Keiper, B. D., Rhoads, R. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Translational+recruitment+of+Xenopus+maternal+mRNAs+in+response+to+poly(A)+elongation+requires+initiation+factor+eIF4G-1.">Translational recruitment of Xenopus maternal mRNAs in response to poly(A) elongation requires initiation factor eIF4G-1.</a> Dev Biol. 206 (1), 1-14 (1999).</li><li>Wakiyama, M., Imataka, H., Sonenberg, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interaction+of+eIF4G+with+poly(A)-binding+protein+stimulates+translation+and+is+critical+for+Xenopus.oocyte+maturation.">Interaction of eIF4G with poly(A)-binding protein stimulates translation and is critical for Xenopus.oocyte maturation.</a> Curr Biol. 10 (18), 1147-1150 (2000).</li><li>Sheets, M. D., Wu, M., Wickens, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyadenylation+of+c-mos+mRNA+as+a+control+point+in+Xenopus+meiotic+maturation.">Polyadenylation of c-mos mRNA as a control point in Xenopus meiotic maturation.</a> Nature. 374 (6522), 511-516 (1995).</li><li>Gebauer, F., Richter, J. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synthesis+and+function+of+Mos:+the+control+switch+of+vertebrate+oocyte+meiosis.">Synthesis and function of Mos: the control switch of vertebrate oocyte meiosis.</a> Bioessays. 19 (1), 23-28 (1997).</li><li>Le Sommer, C., Lerivray, H., Lesimple, M., Hardy, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Xenopus+as+a+model+to+study+alternative+splicing+in+vivo.">Xenopus as a model to study alternative splicing in vivo.</a> Biol Cell. 99 (1), 55-65 (2007).</li><li>Au, S., Cohen, S., Pant&#233;, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microinjection+of+Xenopus+laevis.oocytes+as+a+system+for+studying+nuclear+transport+of+viruses.">Microinjection of Xenopus laevis.oocytes as a system for studying nuclear transport of viruses.</a> Methods. 51 (1), 114-120 (2010).</li><li>Gotoh, T., Villa, L. M., Capelluto, D. G., Finkielstein, C. V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Regulatory+pathways+coordinating+cell+cycle+progression+in+early+Xenopus+development.">Regulatory pathways coordinating cell cycle progression in early Xenopus development.</a> Results Probl Cell Differ. 53, 171-199 (2011).</li><li>Schmidt, E. K., Clavarino, G., Ceppi, M., Pierre, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SUnSET,+a+nonradioactive+method+to+monitor+protein+synthesis.">SUnSET, a nonradioactive method to monitor protein synthesis.</a> Nat Methods. 6 (4), 275-277 (2009).</li><li>Moreno, J. A., Halliday, M., Molloy, C., Radford, H., Verity, N., Axten, J. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Oral+treatment+targeting+the+unfolded+protein+response+prevents+neurodegeneration+and+clinical+disease+in+prion-infected+mice.">Oral treatment targeting the unfolded protein response prevents neurodegeneration and clinical disease in prion-infected mice.</a> Sci Transl Med. 5 (206), 206ra138 (2013).</li><li>Doyle, K. M., Kennedy, D., Gorman, A. M., Gupta, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Unfolded+proteins+and+endoplasmic+reticulum+stress+in+neurodegenerative+disorders.">Unfolded proteins and endoplasmic reticulum stress in neurodegenerative disorders.</a> J Cell Mol Med. 15 (10), 2025-2039 (2011).</li><li>Gandin, V., Sikstr&#246;m, K., Alain, T., Morita, M., McLaughlan, S., Larsson, O., Topisirovic, I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polysome+fractionation+and+analysis+of+mammalian+translatomes+on+a+genome-wide+scale.">Polysome fractionation and analysis of mammalian translatomes on a genome-wide scale.</a> J Vis Exp. (87), e51455 (2014).</li></ol>

The authors have nothing to disclose.

번역은 여러 가지 신경 퇴행성 질환 등 다양한 인간 질환의 physiopathology에 관여하는 메커니즘입니다. 파킨슨 병의 예를 들어 여러 보고서 유전 변이 8,12,13과 관련된 번역에 손상을 제안했다. 여러 셀룰러 모델은 번역을 연구하는 데 사용할 수 있습니다. 여기서, eIF4G1 및 8의 eIF4E 파트너 간의 상호 작용을 감소시키는 등의 우성 네가티브 돌연변이 작용 eIF4G1에?...

단백질은 생물체의 큰 규모에 필수적인 세포 삶의 요소 때문에입니다. 이들은 구조, 운송, 반응 촉매, 조절, 유전자 발현 등 발현은 mRNA의 단백질로의 변환을 허용하는 번역 복잡한 메커니즘의 결과를 포함한 세포 기능의 대부분을 보장한다. 번역은 적응 및 발생과 분화, 노화, 스트레스 또는 생리 병리학 적 양상 동안, 셀의 요구에 따라 유전자 발현을 조절하는 각종 제어를 실시한다. 캡에 의존, 모자 독립적 인 내부 리보솜 항목 세그먼트 (IRES) 구조와 캡 독립 번역 약물 (경유 : 번역은 3 개시 번역 시스템이 요구에 대응하기 위해 3 단계 (개시, 신장 및 종료)와 선물로 분할된다 ) CITE. 대부분의 진핵 생물의 mRNA는 캡 depe로 번역된다단백질 합성시 인식 기능의 역할 7 methylguanosine 5&#39;- 삼인산 캡을 통해 ndent 방식. 이 모자의 eIF4E, eIF4G1 및 eIF4A와 eIF4F 단지의 구성 요소에 바인딩합니다. 폴리 (A) 결합 단백질 (PABP)와 같은 다른 파트너와 관련, eIF2-GTP-메트로-tRNA의 메트로,이 번역 개시 인자의 mRNA를 회람 및 인식 1 코돈 8 월 개시 될 때까지 형태 43S 복잡한 접근성을 개선 할 수 있습니다. 이 이벤트는 번역 개시 즉, 변환의 제 1 단계의 종료에 대응한다. 캡 독립적 번역 인스턴스 세포 증식 및 아폽토시스 유도에 대한 스트레스 조건 하에서 필수적인 단백질 mRNA의 인코딩에 의해 사용된다. 이 메커니즘은 mRNA의에 차 구조를 포함 5&#39; 번역되지 않은 지역 (UTR)는 IRES라고 eIF4A 및 43S 복합과 관련된 eIF4G1의 카르복시 말단. 이 43S 개시전 (C)의 결합IRES에 omplex은 eIF4E를 인자 2,3 필요없이 뚜껑 독립적 인 번역을 시작합니다. mRNA의 UTR 4 내에있는 구조를 인용을 통해 마지막으로, 아직 잘 이해되지 다른 변환 메커니즘은 스트레스 조건 하에서이 모자 독립적 인 번역 활동을 지원합니다. 그들의 개시 단계에서 다른 번역이 다양한 방식을 통해 변환이 셀룰러 항상성에 중요한 역할을하고, 따라서 큰 규모의 효과와 작은 유기체에 영향을 미칠 것이다 이러한 프로세스 중 하나에 변경을 수행한다. 실제로, 개시는 mRNA의 단백질로의 정확한 변환을 관리하는 프로세스 속도 제한 단계이며, 따라서 다수의 제어 및 조절 점 (5)의 목표이다. 이 후자의 또는 이러한 프로세스의 구성 요소에 대한 여부 하나에 결함이있는 것으로 밝혀지면, 그것은 셀의 설립 균형을 교란하고, 따라서 병리 콘돌리자으로 이어질 수TIONS. 이러한 맥락에서, 번역 인자의 돌연변이는 이러한 잠재적 흰색 matter&#39; (eIF2B1-5 서브 유닛) (6), 월콧 - Rallison 증후군 (PERK에 대한 EIF2AK3 유전자 인코딩) (7), 소멸과 백색질 뇌증 &#39;와 같은 퇴행성 신경 질환 등 여러 질환에 참여하고있다 파킨슨 병 (eIF4G1의 p.R1205H) 8. 이는 질병 개발 및 번역 개시의 일반적인 과정에 대한 우리의 지식을 증가시키는 이러한 돌연변이 단백질의 세포 및 분자 연구를 수행하는 것이 중요하다. 이 연구를 수행하기 위해, 이러한 돌연변이의 영향을 관찰하기 위해 가장 적절한 모델을 선택하는 것이 필수적이다 제노는 난자 특히 생리 학적 및 생화학 적 특성으로 인해 적응 laevis의 :. 생리 동시성 (세포주기의 단계 G2에서 차단) , 단백질 합성의 높은 용량 (200 ~ 400 NG / 일 / 난자), 추출 OOC의 높은 수같은 동물에서 ytes (800-1,000 난자 / 여성)과 조작을 용이하게 셀 크기 (직경 1.2-1.4 mm)이다. 합성의 mRNA와 제노 푸스 난 모세포의 마이크로 인젝션 쉽게 번역 단계를 해부하기 위해 수행 될 수있다. 이보기에 그것은 다른 장점을 제공합니다. 감수 분열의 진행의 속도와 번역의 mRNA의 미세 주입 (~ 24 시간) 후 감안할 때, Xenopus의 난자는 재구성 세포 (대장균에서 추출, 밀 세균 또는 토끼 망상 ...) 시스템의 mRNA가 인에 비해 빠른 시스템을 나타냅니다 감소 된 변환 속도와 낮은 속도로 번역했다. 따라서 mRNA의 도입으로 돌연변이의 효과를 신속하고 용이하게 관찰 할 수있는 여러 개의 난 모세포에서 연구 될 것이다. 제노 푸스 난 모세포의 또 다른 장점은 모체의 mRNA가 잠재되어 단백질 번역을 프로게스테론 자극 전에 차단된다는 것이다. 프로게스테론 첨가 따라서 변환 유도를 제어하는​​ 좋은 방법이다. 세포질 Polyadenylation는 oogenesis 동안 발생하지 않습니다. 그것은 시간적 순서에 프로게스테론 자극 난자에 난자 성숙 과정 시작과 초기 개발을 통해 계속 번역의 다른 단계를 연구하는 데 사용할 수 있습니다. MOS의 mRNA의 폴리아 데 닐화가 발생하는 첫 번째 중 하나입니다 그것은 찰스 워드 등에 정의 된 &quot;조기 성숙&quot;유전자의 클래스에 오로라 / EG2, 히스톤 같은 B4의 mRNA에 속한다. (2004) 9. 이러한 사이클린 A1과​​ B1 사이클린 등의 &quot;말&quot;의 mRNA의 번역 유도 새싹 소포 고장 (GVBD)의시기에 발생합니다. MOS의 mRNA는 세린 / 트레오닌 - 단백질 키나아제를 암호화한다. 이 간접적으로 난자의 성숙을 활성화 MAP 키나제 캐스케이드을 유도하기 때문에 그것의 번역은 매우 중요하다. 사실, 황체 호르몬에 대한 응답으로, MOS의 mRNA의 폴리아 데 닐화는 EG2 조절 단백질과 일 다른 RNA 결합 단백질을 오로라 /를 포함하는 과정을 통해 강화된다MOS의 mRNA의 전자 3&#39;UTR. MOS의 mRNA의 폴리아 데 닐화 증가 차례로 MEK1를 활성화 MOS 단백질 수준의 증가를 이끈다. 이 과정은 세포 외 신호 조절 키나아제 2 (ERK2) (도 1)의 활성화를 매개한다. 이 시그널링 캐스케이드 다음 요인을 촉진 성숙 M 상, 사이클린 B 및 Cdc2 키나제에 의해 형성된 복합체를 유발하며 결국 감수 재개 야기 할 수있다. 제노 푸스는 난자 laevis의 그러므로, 이러한 MOS 등 산모의 mRNA의 연구는 쉽게 여러 MOS 부품 시그널링도 GVBD 레이트의 판정 등의 번역 그들의 효율적인 폴리아 데 닐화에서 여러 엔드 포인트와 그 번역 가능성을 테스트하기 위해 사용될 수있다. 이 시스템은 신규의 mRNA의 전사 또는 형질 감염 효율의 간섭없이 번역 개시 인자의 돌연변이의 첫번째 결과를 평가하는 것이 흥미 롭다는 문제가 종종 함께 발생 eukary귀 세포 연구. 여기에, 프로토콜은 Xenopus의이 난자를 laevis의 산모의 mRNA의 번역 시험에서 돌연변이 eIF4G1의 mRNA를가 미세 주입되는 경우 설정됩니다. 난자 감수 세포주기를 통해 초기와 후기 클래스의 mRNA의 후속 번역 진행을 위해 필수적이다 GVBD 진행에 결함, MOS mRNA의 폴리아 데 닐화의 존재에서 확인된다. 인산화 오로라 / EG2와 ERK는 MOS의 deregulation.Thus의 결과를 확인하기 위해 연구되고, Xenopus의 난자는 mRNA의 번역의 다른 단계를 분석하는 간단한 방법을 나타냅니다.

<table><tbody><tr><td>Tricaine methane sulphonate</td><td>Sandoz</td><td>MS-222</td><td>oocytes handling</td></tr><tr><td>Forceps</td><td>Moria</td><td>Dumont MC40</td><td></td></tr><tr><td>Streptomycin/penicillin</td><td>Sigma</td><td>781</td><td></td></tr><tr><td>Sodium pyruvate</td><td>Sigma</td><td>P2256</td><td></td></tr><tr><td>Soybean trypsin inhibitor</td><td>Sigma</td><td>T9128</td><td></td></tr><tr><td>Tetracyclin</td><td>Sigma</td><td>T7660</td><td></td></tr><tr><td>Veterinarian absorbable Vicryl thread</td><td>Johnson&amp;amp;Johson Intl</td><td>JV1205</td><td></td></tr><tr><td>Collagenase A</td><td>Roche diagnostics</td><td>10103586001</td><td></td></tr><tr><td>PmeI</td><td>New England Biolabs</td><td>R0560S</td><td>Preparation of synthetic mRNA</td></tr><tr><td>DNAse/RNAse free H&lt;sub&gt;2&lt;/sub&gt;O</td><td>Life Technologies</td><td>10977</td><td></td></tr><tr><td>Sodium Acetate</td><td>Merck</td><td>6268</td><td></td></tr><tr><td>Absolute ethanol</td><td>Sigma</td><td>02854</td><td></td></tr><tr><td>Nano Drop</td><td>Thermo Scientific</td><td></td><td></td></tr><tr><td>TBE 10X</td><td>Eppendorf</td><td>0032006.507</td><td></td></tr><tr><td>Ethidium bromide 10 mg/ml</td><td>Life Technologies</td><td>15585-011</td><td></td></tr><tr><td>mMESSAGE mMACHINE Kit</td><td>Ambion by Life Technologies</td><td>AM1344</td><td></td></tr><tr><td>MOPS</td><td>Sigma</td><td>M1254</td><td></td></tr><tr><td>EDTA</td><td>Fluka</td><td>03609</td><td></td></tr><tr><td>Agarose</td><td>Life Technologies</td><td>16500-500</td><td></td></tr><tr><td>Formaldehyde 37%</td><td>Merck</td><td>1.04003.1000</td><td></td></tr><tr><td>Formamide</td><td>Fluka</td><td>47671</td><td></td></tr><tr><td>Gel Doc Imager</td><td>Biorad</td><td></td><td></td></tr><tr><td>Oocyte Pipet with 100 8&quot; Glass Capillaries</td><td>Drummond Scientific Company</td><td>3-000-510-X</td><td>microinjection</td></tr><tr><td>Replacement Glass 8&quot;</td><td>Drummond Scientific Company</td><td>3-000-210-G8</td><td></td></tr><tr><td>0.45 &amp;micro;m filter</td><td>Millipore</td><td>SLHA025NB</td><td></td></tr><tr><td>Progesterone</td><td>Sigma</td><td>P0130</td><td></td></tr><tr><td>Hepes</td><td>Sigma</td><td>H3375</td><td>Western Blot</td></tr><tr><td>NaCl</td><td>Sigma</td><td>S5886</td><td></td></tr><tr><td>SDS</td><td>Biorad</td><td>161-0301</td><td></td></tr><tr><td>MgCl&lt;sub&gt;2&lt;/sub&gt;</td><td>Sigma</td><td>A3294</td><td></td></tr><tr><td>Bovine serum albumin</td><td>Sigma</td><td>A4612</td><td></td></tr><tr><td>leupeptin</td><td>Sigma</td><td>L8511</td><td></td></tr><tr><td>aprotinin</td><td>Sigma</td><td>A1153</td><td></td></tr><tr><td>benzamidine</td><td>Sigma</td><td>B6506</td><td></td></tr><tr><td>PMSF</td><td>Sigma</td><td>P7626</td><td></td></tr><tr><td>sodium vanadate</td><td>Sigma</td><td>S6508</td><td></td></tr><tr><td>Laemmli buffer</td><td>Biorad</td><td>161-0737</td><td></td></tr><tr><td>NuPAGE Novex 4-12% Bis-Tris Protein Gels, 1.0 mm, 15 well</td><td>Life Technologies</td><td>NP0323BOX</td><td></td></tr><tr><td>SDS-PAGE electrophoresis, mini-Protean TGX</td><td>Biorad</td><td>456-1036 and -1096</td><td></td></tr><tr><td>horizontal semi-dry blotting system</td><td>W.E.P. Compagny</td><td></td><td></td></tr><tr><td>Glycine</td><td>Biorad</td><td>161-0718</td><td></td></tr><tr><td>Tris-HCl</td><td>Biorad</td><td>161-0719</td><td></td></tr><tr><td>Hybond ECL Membrane</td><td>Amersham Life Science</td><td>10401180</td><td></td></tr><tr><td>Methanol</td><td>VWR</td><td>20846-292</td><td></td></tr><tr><td>Ponceau Red (0.5%)</td><td>Sigma</td><td>P3504</td><td></td></tr><tr><td>Tween 20</td><td>Sigma</td><td>P2287</td><td></td></tr><tr><td>anti-GFP</td><td>Life Technologies</td><td>A11122</td><td></td></tr><tr><td>anti-V5</td><td>Santa Cruz Biotechnology</td><td>sc-58052</td><td></td></tr><tr><td>anti-Eg2</td><td>Santa Cruz Biotechnology</td><td>sc-27884</td><td></td></tr><tr><td>anti-Eg2-P</td><td>Cell Signaling</td><td>C39D8</td><td></td></tr><tr><td>anti-ERK2</td><td>Santa Cruz Biotechnology</td><td>sc-1647</td><td></td></tr><tr><td>anti-ERK2-P (Tyr204)</td><td>Santa Cruz Biotechnology</td><td>sc-7976</td><td></td></tr><tr><td>anti-Rsk</td><td>Santa Cruz Biotechnology</td><td>sc-231</td><td></td></tr><tr><td>anti-mos</td><td>Santa Cruz Biotechnology</td><td>sc-86</td><td></td></tr><tr><td>anti-mouse horseradish peroxidase labeled secondary antibody</td><td>Santa Cruz Biotechnology</td><td>sc-2005</td><td></td></tr><tr><td>anti-rabbit horseradish peroxidase labeled secondary antibody</td><td>Santa Cruz Biotechnology</td><td>sc-2812</td><td></td></tr><tr><td>anti-goat horseradish peroxidase labeled secondary antibody</td><td>Santa Cruz Biotechnology</td><td>sc-2378</td><td></td></tr><tr><td>Advanced ECL Detection System</td><td>Amershan Life Science</td><td>RPN2135</td><td></td></tr><tr><td>PBS 1x</td><td>Sigma</td><td>P4417</td><td>polyadenylation assay</td></tr><tr><td>TRIZOL (Qiazol Lysis Reagent)</td><td>Qiagen</td><td>79306</td><td></td></tr><tr><td>Chloroform</td><td>Sigma</td><td>31998-8</td><td></td></tr><tr><td>Isopropanol</td><td>Sigma</td><td>278475-1L</td><td></td></tr><tr><td>RNeasy mini kit</td><td>Qiagen</td><td>74106</td><td></td></tr><tr><td>RTL buffer&amp;nbsp;</td><td>Qiagen</td><td>79216</td><td></td></tr><tr><td>RNAse free DNAse set</td><td>Qiagen</td><td>79254</td><td></td></tr><tr><td>Primers</td><td>Eurogentec</td><td></td><td></td></tr><tr><td>T4 RNA ligase 1&amp;nbsp;</td><td>New England Biolabs</td><td>M0204S</td><td></td></tr><tr><td>High capacity c-DNA Reverse Transcription kit</td><td>Applied Biosystems, Life Technologies</td><td>4368813</td><td></td></tr><tr><td>Taq polymerase</td><td>Life Technologies</td><td>10342020</td><td></td></tr></tbody></table>

xenopus laevis as a model to identify translation impairment

단백질 합성은 다양한 생물학적 과정, 특히 환경 조건에 적응에 영향을 미치는 유전자 발현에 중요한 공정이다. mRNA의 개시 코돈, eIF4G1을 포함하여 참여 개시 인자의 리보솜 서브 유닛의 조립을 포함 개시 단계. 번역의 속도 제한 단계에서의 결함은 다양한 질환에 연결되어 있습니다. 이러한 규제 완화의 잠재적 결과를 연구하기 위해, 제노 푸스는 난자가 인간에 필수적인 세포 및 분자 메커니즘의 보존의 높은 학위를 가진 매력적인 모델을 구성 laevis의. 또한, 감수 성숙하는 동안, 난 모세포는 전사적으로 억압하고 필요한 모든 단백질은 기존의, 모계 유래의 mRNA에서 변환됩니다. 이 저렴한 모델은 효과적인 번역과 완벽하게 통합 될 외인성 mRNA를 할 수 있습니다. 여기에 (여기 eIF4G1) 관심 요인으로 번역을 평가 STOR 사용을위한 프로토콜을 설명하는가장 먼저 그 어머니의 mRNA의 에드 폴리아 데 닐화 및 생리 학적 판독으로 난자의 성숙하는 동안 번역합니다. 처음에는 mRNA의 관심의 플라스미드 (여기 eIF4G1)의 시험 관내 전사에 의해로 합성하는 것은 어린 싹 소포 고장 감지하여 난자와 난자의 성숙의 역학에 주입이 결정된다. 연구 모체 mRNA의 타깃은 세린 / 트레오닌 - 단백질 키나아제 MOS이다. 그 폴리아 데 닐화 및 그 이후의 번역은 난자의 성숙에 관여 폭포 신호 MOS의 단백질의 발현 및 인산화와 함께 조사하고 있습니다. 현재 프로토콜의 변화는 앞으로 넣어 번역 결함은 또한 일반적인 적용 성을 강조하기 위해 제안되었다. 비정상적인 단백질 합성은 신경 질환의 병인에 관여 할 수 있다는 증거를 부상에 비추어, 그러한 모델은 쉽게 손상을 평가하고, 새로운 대상을 식별 할 수있는 기회를 제공한다.

PG 자극의 24 시간 (도 2B, 2C) 후 Xenopus의 난자와 백분율 난자 GVBD 결정의 운동 성숙 : eIF4G1-DN 돌연변이 병진 영향을 연구하기 위해, 제노 푸스에서 PG에 대한 응답은 (H 2 O, GFP) eIF4G1-WT와 다른 제어 상태와 비교 된 cRNA eIF4G1-DN 마이크로 인젝션 된 난자 laevis의. 컨트롤에 관계없이 주입 된 cRNA 또는 eIF4G1 과발현의 성격의 난자 미세 주사의 발?...

Watch this Scientific Journal Video about Xenopus laevis as a Model to Identify Translation Impairment at JoVE.com

Xenopus laevis as a Model to Identify Translation Impairment

Protein synthesis control occurs mainly at the translation initiation step, deficiencies in which are linked to diverse disorders. To better understand their etiology, we described here a protocol using Xenopus laevis oocytes assessing the translation of mos transcript in the presence of a mutant of translation initiation factor eIF4G1.

Xenopus의 번역 손상을 식별 할 수있는 모델로 laevis의

Protein synthesis is a fundamental process to gene expression impacting diverse biological processes notably adaptation to environmental conditions. The ...

xenopus-laevis-as-a-model-to-identify-translation-impairment

Research

JoVE Journal

Biology

Xenopus laevis as a Model to Identify Translation Impairment

10.7K 조회수.  INSERM UMR-S1172, CHRU Lille, University of Lille 1 and Lille 2. Protein synthesis control occurs mainly at the translation initiation step, deficiencies in which are linked to diverse disorders. To better understand their etiology, we described here a protocol using Xenopus laevis oocytes assessing the translation of mos transcript in the presence of a mutant of translation initiation factor eIF4G1.

비디오: Xenopus laevis as a Model to Identify Translation Impairment

Quantitative Immunofluorescence to Measure Global Localized Translation

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and organogenesis, as well as in multiple diseases. Numerous publications have convincingly shown that specific mechanisms tightly regulate mRNA translation. Increased interest in the translation-induced regulation of protein expression has led to the development of novel methods to study and follow de novo protein synthesis in cellulo. However, most of these methods are complex, making them costly and often limiting the number of mRNA targets that can be studied. This manuscript proposes a method that requires only basic reagents and a confocal fluorescence imaging system to measure and visualize the changes in mRNA translation that occur in any cell line under various conditions. This method was recently used to show localized translation in the subcellular structures of adherent cells over a short period of time, thus offering the possibility of visualizing de novo translation for a short period during a variety of biological processes or of validating changes in translational activity in response to specific stimuli.

This manuscript describes a method to visualize and quantify localized translation events in subcellular compartments. The approach proposed in this manuscript requires a basic confocal imaging system and reagents and is rapid and cost-effective.

정량적 면역 형광 측정 글로벌 현지화 번역

The mechanisms regulating mRNA translation are involved in various biological processes, such as germ line development, cell differentiation, and ...

연구

생화학

Polysome Profiling in Leishmania, Human Cells and Mouse Testis

Proper protein expression at the right time and in the right amounts is the basis of normal cell function and survival in a fast-changing environment. For a long time, the gene expression studies were dominated by research on the transcriptional level. However, the steady-state levels of mRNAs do not correlate well with protein production, and the translatability of mRNAs varies greatly depending on the conditions. In some organisms, like the parasite Leishmania, the protein expression is regulated mostly at the translational level. Recent studies demonstrated that protein translation dysregulation is associated with cancer, metabolic, neurodegenerative and other human diseases. Polysome profiling is a powerful method to study protein translation regulation. It allows to measure the translational status of individual mRNAs or examine translation on a genome-wide scale. The basis of this technique is the separation of polysomes, ribosomes, their subunits and free mRNAs during centrifugation of a cytoplasmic lysate through a sucrose gradient. Here, we present a universal polysome profiling protocol used on three different models - parasite Leishmania major, cultured human cells and animal tissues. Leishmania cells freely grow in suspension and cultured human cells grow in adherent monolayer, while mouse testis represents an animal tissue sample. Thus, the technique is adapted to all of these sources. The protocol for the analysis of polysomal fractions includes detection of individual mRNA levels by RT-qPCR, proteins by Western blot and analysis of ribosomal RNAs by electrophoresis. The method can be further extended by examination of mRNAs association with the ribosome on a transcriptome level by deep RNA-seq and analysis of ribosome-associated proteins by mass spectroscopy of the fractions. The method can be easily adjusted to other biological models.

Polysome Profiling in Leishmania, Human Cells and Mouse Testis

The overall goal of polysome profiling technique is analysis of translational activity of individual mRNAs or transcriptome mRNAs during protein synthesis. The method is important for studies of protein synthesis regulation, translation activation and repression in health and multiple human diseases.

Polysome Leishmania, 인간 세포 및 마우스 고환에서 프로 파일링

Proper protein expression at the right time and in the right amounts is the basis of normal cell function and survival in a fast-changing environment. For ...

Defining the Program of Maternal mRNA Translation during In vitro Maturation using a Single Oocyte Reporter Assay

Events associated with oocyte nuclear maturation have been well described. However, much less is known about the molecular pathways and processes that take place in the cytoplasm in preparation for fertilization and acquisition of totipotency. During oocyte maturation, changes in gene expression depend exclusively on the translation and degradation of maternal messenger RNAs (mRNAs) rather than on transcription. Execution of the translational program, therefore, plays a key role in establishing oocyte developmental competence to sustain embryo development. This paper is part of a focus on defining the program of maternal mRNA translation that takes place during meiotic maturation and at the oocyte-to-zygote transition. In this method paper, a strategy is presented to study the regulation of translation of target mRNAs during in vitro oocyte maturation. Here, a Ypet reporter is fused to the 3&#39; untranslated region (UTR) of the gene of interest and then micro-injected into oocytes together with polyadenylated mRNA encoding for mCherry to control for injected volume. By using time-lapse microscopy to measure reporter accumulation, translation rates are calculated at different transitions during oocyte meiotic maturation. Here, the protocols for oocyte isolation and injection, time-lapse recording, and data analysis have been described, using the Ypet/interleukin-7 (IL-7)-3&#39; UTR reporter as an example.

This protocol describes a reporter assay to study the regulation of mRNA translation in single oocytes during in vitro maturation.

단일 난사 기자 분석기를 사용하여 체외 성숙 중 모성 mRNA 번역 프로그램 정의

Events associated with oocyte nuclear maturation have been well described. However, much less is known about the molecular pathways and processes that ...

발생학

An Efficient Protocol to Assess ERK Activity Modulation in Early Zebrafish Noonan Syndrome Models via Live FRET Microscopy and Immunofluorescence

RASopathies are genetic syndromes caused by ERK hyperactivation and resulting in multisystemic diseases that can also lead to cancer predisposition. Despite a broad genetic heterogeneity, germline gain-of-function mutations in key regulators of the RAS-MAPK pathway underlie the majority of the cases, and, thanks to advanced sequencing techniques, potentially pathogenic variants affecting the RAS-MAPK pathway continue to be identified. Functional validation of the pathogenicity of these variants, essential for accurate diagnosis, requires fast and reliable protocols, preferably in vivo. Given the scarcity of effective treatments in early childhood, such protocols, especially if scalable in cost-effective animal models, can be instrumental in offering a preclinical ground for drug repositioning/repurposing. 
Here we describe step-by-step the protocol for rapid generation of transient RASopathy models in zebrafish embryos and direct inspection of live disease-associated ERK activity changes occurring already during gastrulation through real-time multispectral F&#246;rster resonance energy transfer (FRET) imaging. The protocol uses a transgenic ERK reporter recently established and integrated with the hardware of commercial microscopes. We provide an example application for Noonan syndrome (NS) zebrafish models obtained by expression of the Shp2D61G. We describe a straightforward method that enables registration of ERK signal change in the NS fish model before and after pharmacological signal modulation by available low-dose MEK inhibitors. We detail how to generate, retrieve, and assess ratiometric FRET signals from multispectral acquisitions before and after treatment and how to cross-validate the results via classical immunofluorescence on whole embryos at early stages. We then describe how, via examining standard morphometric parameters, to query late changes in embryo shape, indicative of a resulting impairment of gastrulation, in the same embryos whose ERK activity is assessed by live FRET at 6 h post fertilization.

RASopathies are multisystem genetic syndromes caused by RAS-MAPK pathway hyperactivation. Potentially pathogenic variants awaiting validation emerge continuously while poor preclinical evidence limits therapy. Here, we describe our in vivo protocol to test and cross-validate RASopathy-associated ERK activation levels and its pharmacological modulation during embryogenesis by live FRET imaging in Teen-reporter zebrafish.

Live FRET 현미경 검사 및 면역형광을 통해 초기 제브라피시 누난 증후군 모델에서 ERK 활동 조절을 평가하기 위한 효율적인 프로토콜

RASopathies are genetic syndromes caused by ERK hyperactivation and resulting in multisystemic diseases that can also lead to cancer predisposition. ...

Measurement of Specific Mycobacterial Mistranslation Rates with Gain-of-function Reporter Systems

The translation of genes into proteins is prone to errors. Although the average rate of translational error in model systems is estimated to be 1/10,000 per codon, the actual error rates vary widely, depending on the species, environment, and codons being studied. We have previously shown that mycobacteria use a two-step pathway for the generation of aminoacylated glutamine and asparagine tRNAs and that this is specifically associated with relatively high error rates due to the modulation of mistranslation rates by an essential component of the pathway, the amidotransferase GatCAB. We modified a previously employed Renilla-Firefly dual-luciferase system that had been used to measure mistranslation rates in Escherichia coli for use in mycobacteria to measure specific mistranslation rates of glutamate at glutamine codons and aspartate for asparagine codons. Although this reporter system was suitable for the accurate estimation of specific error rates, lack of sensitivity and requirements for excessive manipulation steps made it unsuitable for high-throughput applications. Therefore, we developed a second gain-of-function reporter system, using Nluc luciferase and green fluorescent protein (GFP), which is more amenable to medium/high-throughput settings. We used this system to identify kasugamycin as a small molecule that can decrease mycobacterial mistranslation. Although the reporters that we describe here have been used to measure specific types of mycobacterial mistranslation, they may be modified to measure other types of mistranslation in a number of model systems.

In this article, we present two complementary methods to measure specific rates of translational error and mistranslation in the model mycobacterium, Mycobacterium smegmatis, using gain-of-function reporter systems. The methods can be employed to measure accurate error rates in low throughput or relative error rates in a more high-throughput setting.

기능 리포터 시스템으로 특정 진 균의 오 번역 비율 측정

The translation of genes into proteins is prone to errors. Although the average rate of translational error in model systems is estimated to be 1/10,000 ...

면역학 및 감염병학

Functional Evaluation of Olfactory Pathways in Living Xenopus Tadpoles

Xenopus tadpoles offer a unique platform to investigate the function of the nervous system. They provide multiple experimental advantages, such as accessibility to numerous imaging approaches, electrophysiological techniques and behavioral assays. The Xenopus tadpole olfactory system is particularly well suited to investigate the function of synapses established during normal development or reformed after injury. Here, we describe methodologies to evaluate the processing of olfactory information in living Xenopus larvae. We outline a combination of in vivo measurements of presynaptic calcium responses in glomeruli of the olfactory bulb with olfactory-guided behavior assays. Methods can be combined with the transection of olfactory nerves to study the rewiring of synaptic connectivity. Experiments are presented using both wild-type and genetically modified animals expressing GFP reporters in central nervous system cells. Application of the approaches described to genetically modified tadpoles can be useful for unraveling the molecular bases that define vertebrate behavior.

Functional Evaluation of Olfactory Pathways in Living Xenopus Tadpoles

Xenopus tadpoles offer a unique platform to investigate the function of the nervous system in vivo. We describe methodologies to evaluate the processing of olfactory information in living Xenopus larvae in normal rearing conditions or after injury.

생활 Xenopus Tadpoles에 후 각 통로의 기능 평가

Xenopus tadpoles offer a unique platform to investigate the function of the nervous system. They provide multiple experimental advantages, such as ...

신경과학

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present methods for the development of assays to query potentially clinically significant nonsynonymous changes using in vivo complementation in zebrafish. Zebrafish (Danio rerio) are a useful animal system due to their experimental tractability; embryos are transparent to enable facile viewing, undergo rapid development ex vivo, and can be genetically manipulated.1 These aspects have allowed for significant advances in the analysis of embryogenesis, molecular processes, and morphogenetic signaling. Taken together, the advantages of this vertebrate model make zebrafish highly amenable to modeling the developmental defects in pediatric disease, and in some cases, adult-onset disorders. Because the zebrafish genome is highly conserved with that of humans (~70% orthologous), it is possible to recapitulate human disease states in zebrafish. This is accomplished either through the injection of mutant human mRNA to induce dominant negative or gain of function alleles, or utilization of morpholino (MO) antisense oligonucleotides to suppress genes to mimic loss of function variants. Through complementation of MO-induced phenotypes with capped human mRNA, our approach enables the interpretation of the deleterious effect of mutations on human protein sequence based on the ability of mutant mRNA to rescue a measurable, physiologically relevant phenotype. Modeling of the human disease alleles occurs through microinjection of zebrafish embryos with MO and/or human mRNA at the 1-4 cell stage, and phenotyping up to seven days post fertilization (dpf). This general strategy can be extended to a wide range of disease phenotypes, as demonstrated in the following protocol. We present our established models for morphogenetic signaling, craniofacial, cardiac, vascular integrity, renal function, and skeletal muscle disorder phenotypes, as well as others.

In Vivo Modeling of the Morbid Human Genome using Danio rerio

Here, we present a systematic approach for developing physiologically relevant, sensitive and specific in vivo assays for interpreting variation in human pathology. Transient genetic manipulation via microinjection of WT and mutant human mRNA and morpholino (MO) antisense oligonucleotides harness the tractability of the developing zebrafish embryo to rapidly assay pathogenic mutations, especially, but not exclusively, in the context of human developmental disorders.

Danio rerio를 사용하여 병적 인 인간 게놈의 생체 모델링에

Here,  we present methods for the development of assays to query potentially clinically  significant nonsynonymous changes using in  vivo complementation ...

생물학

Production of Xenopus tropicalis Egg Extracts to Identify Microtubule-associated RNAs

Many organisms localize mRNAs to specific subcellular destinations to spatially and temporally control gene expression. Recent studies have demonstrated that the majority of the transcriptome is localized to a nonrandom position in cells and embryos. One approach to identify localized mRNAs is to biochemically purify a cellular structure of interest and to identify all associated transcripts. Using recently developed high-throughput sequencing technologies it is now straightforward to identify all RNAs associated with a subcellular structure. To facilitate transcript identification it is necessary to work with an organism with a fully sequenced genome. One attractive system for the biochemical purification of subcellular structures are egg extracts produced from the frog Xenopus laevis. However, X. laevis currently does not have a fully sequenced genome, which hampers transcript identification. In this article we describe a method to produce egg extracts from a related frog, X. tropicalis, that has a fully sequenced genome. We provide details for microtubule polymerization, purification and transcript isolation. While this article describes a specific method for identification of microtubule-associated transcripts, we believe that it will be easily applied to other subcellular structures and will provide a powerful method for identification of localized RNAs.

Production of Xenopus tropicalis Egg Extracts to Identify Microtubule-associated RNAs

We describe the collection of unfertilized Xenopus tropicalis eggs and production of a meiosis II-arrested egg extract. This egg extract can be used to purify microtubules and microtubule-associated RNAs.

생산<em&gt; Xenopus의 tropicalis</em&gt; 달걀은 미세 소관 관련 RNA를 식별하기 위해 추출

Many  organisms localize mRNAs to specific subcellular destinations to spatially and  temporally control gene expression. Recent studies have demonstrated ...

Analysis of Translation in the Developing Mouse Brain using Polysome Profiling

The proper development of the mammalian brain relies on a fine balance of neural stem cell proliferation and differentiation into different neural cell types. This balance is tightly controlled by gene expression that is fine-tuned at multiple levels, including transcription, post-transcription and translation. In this regard, a growing body of evidence highlights a critical role of translational regulation in coordinating neural stem cell fate decisions. Polysome fractionation is a powerful tool for the assessment of mRNA translational status at both global and individual gene levels. Here, we present an in-house polysome profiling pipeline to assess translational efficiency in cells from the developing mouse cerebral cortex. We describe the protocols for sucrose gradient preparation, tissue lysis, ultracentrifugation and fractionation-based analysis of mRNA translational status.

The development of the mammalian brain requires proper control of gene expression at the level of translation. Here, we describe a polysome profiling system with an easy-to-assemble sucrose gradient-making and fractionation platform to assess the translational status of mRNAs in the developing brain.

다각형 프로파일링을 사용하여 개발 마우스 뇌의 번역 분석

The proper development of the mammalian brain relies on a fine balance of neural stem cell proliferation and differentiation into different neural cell ...

Assessment of Selective mRNA Translation in Mammalian Cells by Polysome Profiling

Regulation of protein synthesis represents a key control point in cellular response to stress. In particular, discreet RNA regulatory elements were shown to allow to selective translation of specific mRNAs, which typically encode for proteins required for a particular stress response. Identification of these mRNAs, as well as the characterization of regulatory mechanisms responsible for selective translation has been at the forefront of molecular biology for some time. Polysome profiling is a cornerstone method in these studies. The goal of polysome profiling is to capture mRNA translation by immobilizing actively translating ribosomes on different transcripts and separate the resulting polyribosomes by ultracentrifugation on a sucrose gradient, thus allowing for a distinction between highly translated transcripts and poorly translated ones. These can then be further characterized by traditional biochemical and molecular biology methods. Importantly, combining polysome profiling with high throughput genomic approaches allows for a large scale analysis of translational regulation.

The ability of cells to adapt to stress is crucial for their survival. Regulation of mRNA translation is one such adaptation strategy, providing for rapid regulation of the proteome. Here, we provide a standardized polysome profiling protocol to identify specific mRNAs that are selectively translated under stress conditions.

Polysom​​e 프로파일 링 포유 동물 세포에 선택적 mRNA의 번역 평가

Regulation of protein synthesis represents a key control point in cellular response to stress. In particular, discreet RNA regulatory elements were shown ...

Xenopus의 번역 손상을 식별 할 수있는 모델로 laevis의

요약

더 많은 비디오 탐색

이 비디오의 챕터

정량적 면역 형광 측정 글로벌 현지화 번역

Polysome Leishmania, 인간 세포 및 마우스 고환에서 프로 파일링

단일 난사 기자 분석기를 사용하여 체외 성숙 중 모성 mRNA 번역 프로그램 정의

Live FRET 현미경 검사 및 면역형광을 통해 초기 제브라피시 누난 증후군 모델에서 ERK 활동 조절을 평가하기 위한 효율적인 프로토콜

기능 리포터 시스템으로 특정 진 균의 오 번역 비율 측정

생활 Xenopus Tadpoles에 후 각 통로의 기능 평가

Danio rerio를 사용하여 병적 인 인간 게놈의 생체 모델링에

생산

다각형 프로파일링을 사용하여 개발 마우스 뇌의 번역 분석

Polysome 프로파일 링 포유 동물 세포에 선택적 mRNA의 번역 평가

Xenopus의 번역 손상을 식별 할 수있는 모델로 laevis의

요약

더 많은 비디오 탐색

이 비디오의 챕터

정량적 면역 형광 측정 글로벌 현지화 번역

Polysome Leishmania, 인간 세포 및 마우스 고환에서 프로 파일링

단일 난사 기자 분석기를 사용하여 체외 성숙 중 모성 mRNA 번역 프로그램 정의

Live FRET 현미경 검사 및 면역형광을 통해 초기 제브라피시 누난 증후군 모델에서 ERK 활동 조절을 평가하기 위한 효율적인 프로토콜

기능 리포터 시스템으로 특정 진 균의 오 번역 비율 측정

생활 Xenopus Tadpoles에 후 각 통로의 기능 평가

Danio rerio를 사용하여 병적 인 인간 게놈의 생체 모델링에

생산

다각형 프로파일링을 사용하여 개발 마우스 뇌의 번역 분석

Polysom​​e 프로파일 링 포유 동물 세포에 선택적 mRNA의 번역 평가

Polysome 프로파일 링 포유 동물 세포에 선택적 mRNA의 번역 평가