Biz MIA modeli, otizm ve şizofreni araştırma ilerleme katkılarından dolayı merhum Dr. Paul H. Patterson onurlandırmak istiyorum. Biz bu protokole onun büyük destek Sarkis K. Mazmanian kabul; idari yardım için Ruben M. Bayon, Yvette Garcia-Flores, Karen C. Lencioni ve Leslie A. Neumann; filme yardım için Ali Khoshnan ve Jan C. Ko; MIA indüksiyon onların tavsiye için Elaine Y. Hsiao ve Natalia Malkova; kendi uzman hayvancılık için Jeffrey S. Cochrane, Joaquin Gutierrez, Kwan F. Lee, Jaime Rodriguez, Lorena C. Sandoval, ve Natalie A. Verduzco. Bu eser (Paul H. Patterson NIH 5P50MH086383-04) NIH Conte Merkezi Ödülü ile desteklenmiştir; Otizm (Paul H. Patterson # 7670) konuşuyor; (Sarkis K. Mazmanian için # 322839), Simons Vakfı; NIH Eğitim Grant (K.-HC NIH / NRSA T32GM07616); (ZY için) Caltech Yaz Lisans Araştırma Bursu (SURF); Amgen Akademisyenler Caltech&#39;te (ZY için) Programı; ve Doktora Sonrası Araştırma Bursu from Ulusal Bilim Konseyi, Tayvan (MGK 101-2917-I-564-039 W.-LW için).

Tüm protokoller Teknoloji Kurumsal Hayvan Bakım ve Kullanım Kurulu California Institute (IACUC) onayı altında gerçekleştirildi. Zamana-eşleşme çiftleri 1. Hazırlık <ol><li> gen ekspresyon analizi için en az 6, davranışsal deneyler için baraj ve 3 kullanın. Not: farelerin sadece% 50 zamanlı-çiftleşme gelen tıkanırlar olarak, tahmin edilen dişi farelerin iki kat kullanın. </li><li> daha önce hiçbir gebelik ve yaş 8-16 haftalık dişi fareler kullanın. NOT: Dişi fareler erkek farelere önce cinsel maruz kalma var ama hamile olmamıştır kabul edilebilir. </li><li> Ev dişi fareler ve birlikte yanyana onların östrus döngüsü senkronize etmek için kafesleri yerleştirin. 5 yetişkin farelerin konut sağlamak için 5.5 inç üzerinde bir yükseklikte ve 75 inç kare iç zemin ile standart fareler kafes kullanın. bir kulak yumruk kullanarak her kadın fare etiketleyin. </li></ol> 2. Zamanlı-mat kurmaing Çifti <ol><li> karanlık döngüsü başlamadan önce zamanlanmış-çiftleşme 0-2 saat ayarlayın. Her kafeste iki dişi farelerin yerleştirin. fareler çıkarın ve bunları tek tek tartın. Her dişi fare vücut ağırlığı kaydedin. </li><li> İki dişi fareler her kafesin içine bir erkek fare yerleştirin. baba karıştırıcı etkisini en aza indirmek için üçlü çiftleşme kullanın. </li></ol> 3. Vajinal Plug Kontrol (E0.5) <ol><li> karanlık döngüsü sona erdikten sonra dişi fareler 0-4 saat kontrol edin. Yavaşça kuyruk tabanından kadın fare kaldırın ve kablolu fare ızgara, kafes top, ya da kafes kenar kapmak için izin verir. </li><li> Vajinal fiş belirtilerini arayın: vajinal fiş vajinal açılışında görünür beyazımsı kitledir. Fiş açık değilse, yavaşça vajinal açılış içine 200 ul pipet yerleştirin. koagülasyon gelen direnç vajinal tıkacı oluşumunu onaylar. günde bir kez vajinal fişi kontrol edin. NOT: Vajinal fişi g nedenle değil çiftleşme oluştuğunu ancak bir göstergesidir veuarantee gebelik. Vajinal tamponun farelerin bazı suşları tespit etmek zor olabilir. Fiş kimlik doğruluğunu artırmak için deneyimli fareler bakıcı yardım isteyin. </li><li> Yeni bir kafese takılı fareler taşımak ve grup onlara ev. embriyonik 0.5 gün (E0.5) olarak vajinal fiş görünüm günü belirleyin. </li></ol> E10.5-11.5 4. Gebelik olup olmadığını kontrol edin <ol><li> Yavaşça kuyruk tabanını kaldırın ve kablolu fare ızgara, kafes top, ya da kafes kenar kapmak için izin verir. Gebelik, örneğin, karında bir çıkıntı (Şekil 1) belirtilerini kontrol etmek için karın alan gözlemleyin. NOT: Gebelik işareti her zaman E10.5 olduğundan daha E11.5 daha açıktır. </li><li> gebelik doğrulamak için fareler tartılır. Hamile fare genellikle E10.5 yaklaşık% 20 daha ağır ve bir gebe olmayan fare (Şekil 2) ile karşılaştırıldığında E12.5% ​​30 ağır bastığından. Tek Evi temiz kafeslerde hamile fareler. </li></ol> 5. 20 mg /kg Poli (I: C): <ol><li> gen ekspresyon analizi için grup başına en az 6 Davranış deneyler için grup başına baraj ve 3 kullanın. solüsyonu: poli (C I) tekabül eden miktar hazırlayın. </li><li> 40 mg / ml bir nihai konsantrasyon yapmak için bir 50 ml konik bir tüp içinde: (Cı) Toz poli tartılır. en aza indirmek ve enjeksiyon hacmi kaynaklanan stres standart poli 5 ul enjekte etmek için (I: C) fare vücut ağırlığı (5 ul / g veya 5 ml / kg) her bir gramı için çözüm. kg&#39;ı başına (Cı) MIA neden olmak için, poli 20 mg enjekte edilir. Not: poli konsantrasyonu (I: C) gerekli çözeltisi (20 mg / kg) / (5 ml / kg) = 4 mg / ml&#39;dir. poli yana (I: C) Toz,% 10 poli içeren çözelti (I: C), biz (4 mg / ml) /0.1= 40 mg / poli ml (Cı) bir son konsantrasyon yapmak gerekir. DİKKAT: poli (I: C) toz çok hafif. konik tüp spatula aktarma sırasında herhangi bir toz kaybetmemek için dikkatli olun. </li><li> Konik küvet içine,% 0.9 sodyum klorid (tuz) karşılık gelen ses eklemeE ve kapağını kapatın. Çözelti berrak olana kadar: (C I) toz hafifçe poli üzerinde tuzlu damlacık haddeleme tozu eritin. 1 dakika boyunca (Şekil 3C) 800 xg&#39;de konik tüp santrifüjleyin. (C I) 0.22 mikron filtre ile çözüm poli Filtre. Bir 1.5 ya da 2 ml mikrosantrifüj tüpüne (Cı) solüsyonu poli aktarın. İsteğe bağlı: Çözüm: poli (C I) 260/280 oranını ölçmek için bir spektrofotometre kullanın. Oranı, üretici tarafından tarif edildiği gibi 1,54-1,82 (Şekil 3) arasında olduğundan emin olun. NOT: (: C I) toz ve steril ve ilaç sınıf olmalıdır kontrol enjeksiyonu olarak hizmet poli eritmek için kullanılan tuz. </li></ol> 6. Salin ya da poli (I: C) E12.5 Enjeksiyon <ol><li> ölçekte fare tartılır ve kafes içine geri koymak. (C I) fareler: vücut ağırlığı (g) 5 ile çarpılarak = istenen enjeksiyon hacmi (ul) tuzlu ve poli hem de enjeksiyon hacmini hesaplamak için aşağıdaki formülü kullanın. 0.3 mi Insul kullanın(C I) çözüm, örneğin, bir 30 g fare için 150 ul şırınga tuzlu hesaplanan hacim veya 20 mg / kg poli hazırlamak için. </li><li> Yavaşça kuyruk tabanı ile fare pick up ve kafesin üstüne yerleştirin. stresi ile oluşturulan karıştırıcı etkileri önlemek için yavaşça fareyi tutun. Iki üst meme (Şekil 4) merkezi haline fare yaklaşık 20 ° göreceli, yukarı konik, iğne takın ve tuz ya da poli (I: C) enjekte çözüm. Not: iğne enjeksiyonundan sonra her bir fare için değiştirilmelidir. </li><li> geri evde kafes fare yerleştirin. diğer karıştırıcı etkilerini önlemek için sessiz, düşük trafik odasında kafesleri yerleştirin. </li></ol> 7. Poli Day After (I: C) Enjeksiyon (E13.5) <ol><li> Aşağıdaki sabah enjekte edilen fareler kontrol edin. vücut ağırlığını ölçmek için bir ölçek kullanın. NOT: Poly: tuzlu inj sonraki gün farelere enjekte daha (C) hamile fareler genellikle daha az kilo enjekteection. </li><li> yavrular doğar kadar fareler rahatsız etmeyin. </li></ol> MIA Offspring 8. Ölçer <ol><li> MIA indüksiyon karıştırıcı etkilerini en aza indirmek amacıyla, MIA yavruların kullanımını ölçmek için aşağıda listelenen yönergeleri izleyin. <ol><li> çöp boyutu 5&#39;ten küçük preterm veya gecikmiş doğuştan veya eğer ibrelerin hariç tutun. </li><li> Çöp boyutu 10 büyükse CO 2 tarafından aşırı yavrular euthanize. </li></ol></li></ol> 9. İsteğe bağlı: MIA sonra akut inflamatuar Tepki inceleyin <ol><li> kurumun Hayvan Bakım Komitesi tarafından onaylanmış bir protokol anlatılan yöntem kullanılarak enjeksiyon: tuzlu su ya da poli (Cı) sonra hamile farelere 3 saat Kurban. NOT: Servikal dislokasyon genellikle baraj ve embriyo üzerinde CO 2 / ötenazi ilaçların etkisini en aza indirir olarak tercih edilmektedir. </li><li> plasenta ve fetal sutyen erişkin gebe farelerin dalak toplayın ve izolestereomicroscope altında. <ol><li> dalak toplama, diseksiyon plaka üzerinde fare koymak ve hamile farelerin karın alanda% 70 etanol sprey. deri yoluyla göğüs kafesi altında karın alanının merkezinde dikey kesim yapmak için steril bir makas kullanın. </li><li> Dalak sol üst kadranda oturur. dalak izole etmek için forseps kullanabilir. organın etrafında yağ doku kaldırmak için hassas görev silecekleri üzerinde dalak yuvarlayın. dalak dokusunun yaklaşık 50 mg toplayın ve nükleik asit bozulmasını önlemek için tampon veya TRIzol stabilize 500 ul RNA ile Eppendorf tüpleri tek tek koyun. kullanılana kadar -80 ° C&#39;de derin dondurucuda Örnekleri saklayın. </li><li> plasenta toplanması için hafifçe vücuttan rahim boynuzları çekin. otoklavlanmış fosfat tamponlu tuzlu su (PBS) ile dolu bir Petri kabındaki rahim boynuzları yerleştirin ve buz üzerinde bir çanak bırakın. rahim duvarına açık gözyaşı ve amniyotik kese maruz iki forseps kullanabilir. <ol><li>Dikkatle plasenta ve fetusun zarar vermeden amniyotik kese açmak için forseps kullanabilir. fetus plasenta ayrılması ve mümkün olduğunca plasentaya yakın göbek kordonu kesti. Plasenta amniyon kesesi enkaz kaldırmak. tek tampon veya TRIzol stabilize 500 ul RNA ile Eppendorf tüpleri plasenta yerleştirin. kullanılıncaya kadar -80 ° C derin dondurucuda de örnek saklayın. </li></ol></li><li> fetal beyin koleksiyonu için, diseksiyon kadar adım 9.2.2 den tampon stabilize RNA fetusu saklayın. stereomicroscope altında hassas 5. forseps kullanarak beynin ventrikül pial zarı kapalı alay. Dikkatle fetal beyin tüm membran kaldırmak. tek tampon veya TRIzol stabilize 500 ul RNA ile Eppendorf tüpleri fetal beyinleri yerleştirin. kullanılıncaya kadar -80 ° C derin dondurucuda de örnek saklayın. </li></ol></li><li> doku RNA Özü ve cDNA&#39;ya RNA&#39;nın dönüştürün. Gerçek t cDNA Il6 gen ekspresyonunu analizime PCR. </li><li> TRIzol imalatı protokolünü takip ederek dokulardan RNA ayıklayın. dokular RNA stabilizasyonu tampon saklanır varsa. örnek çözülme ve tampon aşağı doğru döndürün. 500 ul TRIzol başka Eppendorf ucuyla doku aktarın ve RNA ekstraksiyon devam edin. </li><li> konsantrasyon, 260/280 ve 260/230 RNA oranını ölçmek için bir spektrofotometre kullanın. oranlar 2.0 üzerinde olduğundan emin olun. </li><li> 10 | il son hacim olması için işlemden DNase I Karışım 1 ug RNA, RNA, 1 ul 10x reaksiyon tamponu, 1 ul Rnaz içermeyen Dnaz ve nükleaz içermeyen su ile DNA kontaminasyonu ortadan kaldırır. 30 dakika boyunca 37 ° C&#39;de ana karışımı inkübe edin. reaksiyonu sonlandırmak için 1 ul DNaz durdurma çözüm ekleyin. 10 dakika boyunca 65 ° C&#39;de inkübe karışımı. </li><li> cDNA RNA&#39;yı ters. 20 ul reaksiyonları kullanın ve yukarı reaksiyon başına toplam RNA mikrogram ile 1. transkripsiyon (RT) reaksiyon karışımı tampon ters 5x 4 ul karıştırın, 1 ul reverse transkriptaz, DNaz I ve 4 ul nükleaz içermeyen H2O ile tedaviden sonra 11 ul RNA şablonu bir son 20 ul çözelti yapmak için. RT için termal döngü cihazı koşullarını programlayın. Genel bir durumu şunları içerir: Adım 1: 5 dakika boyunca 25 ° C; Aşama 2: 30 dakika boyunca 42 ° C; Adım 3: 5 dakika boyunca 85 ° C; Adım 4: 4 ° C&#39;de tutun. cDNA 5 kez seyreltilir. Kısa süreli depolama için, 4 ° C&#39;de cDNA saklayın. Uzun süreli depolama için, -20 ° C&#39;de cDNA dondurmak. </li><li> Gerçek zamanlı PCR ile cDNA Il6 gen ifadesini analiz etmek ve p-aktin için gen ekspresyonunu Il6 gen ekspresyonunu normalize. <ol><li> IL-6 ve β-aktin tespiti için bir master miks yapın. 25 ul reaksiyonu kullanın, her gen için master miks 12.5 ul SYBR Green Mix, 10 uM ileri primer 0.5 ul, 10 mM ters astar ve 6.5 ul nükleaz içermeyen H 2 O 0.5 ul içermektedir </li><li> 5 ul 5x seyreltilmiş cDNA a yerleştirinoptik 96 kuyulu reaksiyon plakası kuyunun dibine t. Pipet her bir kuyunun ana karışımı 20 ul son 25 ul PCR karışımı yapmak. Her bir örnek için her bir genin, üç kopya halinde. Optik yapışkan film ile plaka Seal. 4 ° C kullanımı gerçek zamanlı PCR standart bir program 3 dakika boyunca 800 x g&#39;de plaka Spin: Aşama 1: 50 ° C, 2 dakika için; Aşama 2: 10 dakika boyunca 95 ° C; Aşama 3: 15 saniye ve sıcaklık, 1 dakika boyunca 60 ° C sıcaklıkta 95 ° C 40 döngü. ayrışma eğrisi ek bir adım ekleyin. </li></ol></li></ol> 10. MIA Yetişkin Offspring Davranış Patolojilerin (İsteğe bağlı) inceleyin: <ol><li> 8-12 hafta yaşlarda davranış testleri gerçekleştirin. en az 3 gün test öncesi kafes yatakları değiştirin. En az 30 dakika test öncesi davranışsal test odasına fareler alıştırıldı. </li><li> prepulse inhibisyonu (ÜFE) için, bunun altında bir piezo-elektrikli sensörü ile pleksiglas silindir fareler dizginlemek. ÜFE fareler alıştırıldı5 dakika için bir oda oluşmaktadır. 120 dB beyaz gürültü (irkilme) 6 çalışmalar ile fareler Açığa. </li><li> Ardından 15 dB (15 dB daha yüksek arka plan gürültüsü 14 çalışmalarda, irkilme 14 çalışmalarda, prepulse 5 dB (5 dB arka plan gürültü daha yüksek) + irkilme (PPI5) 14 denemeler ve prepulse 14 çalışmaların randomize karışımları ile fareler maruz arka plan gürültüsü + irkilme (PPI15) daha. </li><li> 120 dB çalışmaların ilk 6 denemeleri için irkilme tepkisi ortalama. diğer bireysel uyarımlar için irkilme tepkisi ortalama. (- PPI5 veya PPI15 irkilme) / irkilme tarafından prepulse inhibisyonu değeri gizli. </li><li> Açık alan testi için açık bir kare arena (50 x 50 x 50 cm 3) köşesinde fare yerleştirin. Bir tavana monte kamera ile 10 dakika fare yörüngesini kaydedin. Merkez bölgesi (17 x 17 cm 2) olarak arena merkezini tanımlayın. manuel veya görüntü tabanlı otomatik analiz yazılımı tarafından merkez bölgede harcanan katedilen mesafeyi, merkez bölge girişleri ve zamanı ölçmek. </li&gt; <li> mermer gömme testi için 10 dakika boyunca sıkıştırılmış 5cm derin, temiz, Aspen çam yatak ile bir test kafesine fare gelmesini. onun homecage fare dönün. Yavaşça 4 x 5 düzenlemenin moda 20 lacivert 1.5 cm çapında cam bilye yerleştirin. 10 dakika boyunca mermerler test kafesine geri fare yerleştirin. 10 dk test süresi gömüldü mermerler sayın. </li></ol> 11. MIA Yetişkin çocuklarında Serebellar nöropatoloji (İsteğe bağlı) inceleyin: <ol><li> anestezi ile tuzlu ve MIA yetişkin döl euthanize. kalp-damar sistemi boyunca 50 mi, PBS ile fare ve daha sonra 50 mi% 4 paraformaldehid serpmek. </li><li> dikkatle beyin çıkarın ve 4 ° C&#39;de gece boyunca 4% paraformaldehid beyin postfix ° C. PBS ile üç kez beyin durulayın ve kullanılana kadar 4 ° C&#39;de buzdolabında% 0.02 sodyum azid içeren PBS beyin saklayın. NOT: sabitlendi beyin% 0.02 çim ile PBS içinde saklanabilirBir ay kadar buzdolabında yum azid. </li><li> Bölüm 50 mikron ince dilimler halinde beyin sagittally vibratome kullanarak. yumuşak bir fırça kalem kullanarak beyin bölümleri toplayın. Oda sıcaklığında 30 dakika için% 0.6 hidrojen peroksit bölümleri inkübe edilerek bir endojen peroksidaz etkinliğini iptal eder. </li><li> gece boyunca oda sıcaklığında bloke edici tampon (PBS içinde% 0.1 Triton X-100 ve% 0.02 sodyum azid ile% 10 keçi serumu) içinde seyreltilmiş anti-kalbindin antikoru bölümleri inkübe edin. Daha sonra, oda sıcaklığında 2 saat süre ile blokaj tamponu içinde seyreltilmiş biyotinlenmiş sekonder antikor tekabül eden bölümleri inkübe edin. </li><li> Avidin DH bölümleri inkübe - Biyotinile peroksidaz lH kompleksi tamponu, oda sıcaklığında 1 saat süre ile biyotin tespit etmek. antijeni görselleştirmek için peroksidaz substrat kullanılarak bölümleri geliştirin. adımlar arasında PBS ile üç kez bölümleri yıkayın. mikroskop lamı üzerine bölümleri monte edin. Resim mikroskop altında kesitler. </li></ol&gt;

<ol>
	<li>Brown, A. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Epidemiologic+studies+of+exposure+to+prenatal+infection+and+risk+of+schizophrenia+and+autism.">Epidemiologic studies of exposure to prenatal infection and risk of schizophrenia and autism.</a> Dev Neurobiol. 72 (10), 1272-1276 (2012).</li><li>Fatemi, S. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+viral+theory+of+schizophrenia+revisited:+abnormal+placental+gene+expression+and+structural+changes+with+lack+of+evidence+for+H1N1+viral+presence+in+placentae+of+infected+mice+or+brains+of+exposed+offspring.">The viral theory of schizophrenia revisited: abnormal placental gene expression and structural changes with lack of evidence for H1N1 viral presence in placentae of infected mice or brains of exposed offspring.</a> Neuropharmacology. 62 (3), 1290-1298 (2012).</li><li>Shi, L., Tu, N., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+influenza+infection+is+likely+to+alter+fetal+brain+development+indirectly:+the+virus+is+not+detected+in+the+fetus.">Maternal influenza infection is likely to alter fetal brain development indirectly: the virus is not detected in the fetus.</a> Int J Dev Neurosci. 23 (2-3), 299-305 (2005).</li><li>Knuesel, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+and+abnormal+brain+development+across+CNS+disorders.">Maternal immune activation and abnormal brain development across CNS disorders.</a> Nat Rev Neurol. 10 (11), 643-660 (2014).</li><li>Meyer, U. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+poly(i:C)+exposure+and+other+developmental+immune+activation+models+in+rodent+systems.">Prenatal poly(i:C) exposure and other developmental immune activation models in rodent systems.</a> Biol Psychiatry. 75 (4), 307-315 (2014).</li><li>Meyer, U., Feldon, J., Yee, B. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+review+of+the+fetal+brain+cytokine+imbalance+hypothesis+of+schizophrenia.">A review of the fetal brain cytokine imbalance hypothesis of schizophrenia.</a> Schizophr Bull. 35 (5), 959-972 (2009).</li><li>Boksa, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+prenatal+infection+on+brain+development+and+behavior:+a+review+of+findings+from+animal+models.">Effects of prenatal infection on brain development and behavior: a review of findings from animal models.</a> Brain Behav Immun. 24 (6), 881-897 (2010).</li><li>Hsiao, E. Y., McBride, S. W., Chow, J., Mazmanian, S. K., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+an+autism+risk+factor+in+mice+leads+to+permanent+immune+dysregulation.">Modeling an autism risk factor in mice leads to permanent immune dysregulation.</a> Proc Natl Acad Sci U S A. 109 (31), 12776-12781 (2012).</li><li>Ito, H. T., Smith, S. E., Hsiao, E., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+alters+nonspatial+information+processing+in+the+hippocampus+of+the+adult+offspring.">Maternal immune activation alters nonspatial information processing in the hippocampus of the adult offspring.</a> Brain Behav Immun. 24 (6), 930-941 (2010).</li><li>Smith, S. E., Li, J., Garbett, K., Mirnics, K., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+alters+fetal+brain+development+through+interleukin-6.">Maternal immune activation alters fetal brain development through interleukin-6.</a> J Neurosci. 27 (40), 10695-10702 (2007).</li><li>Shi, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+maternal+immune+system+alters+cerebellar+development+in+the+offspring.">Activation of the maternal immune system alters cerebellar development in the offspring.</a> Brain Behav Immun. 23 (1), 116-123 (2009).</li><li>Hsiao, E. Y., Patterson, P. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Activation+of+the+maternal+immune+system+induces+endocrine+changes+in+the+placenta+via+IL-6.">Activation of the maternal immune system induces endocrine changes in the placenta via IL-6.</a> Brain Behav Immun. 25 (4), 604-615 (2011).</li><li>Wu, W. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+interaction+between+maternal+immune+activation+and+alpha+7+nicotinic+acetylcholine+receptor+in+regulating+behaviors+in+the+offspring.">The interaction between maternal immune activation and alpha 7 nicotinic acetylcholine receptor in regulating behaviors in the offspring.</a> Brain Behav Immun. , (2015).</li><li>Garay, P. A., Hsiao, E. Y., Patterson, P. H., McAllister, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+causes+age-+and+region-specific+changes+in+brain+cytokines+in+offspring+throughout+development.">Maternal immune activation causes age- and region-specific changes in brain cytokines in offspring throughout development.</a> Brain Behav Immun. 31, 54-68 (2013).</li><li>Garbett, K. A., Hsiao, E. Y., Kalman, S., Patterson, P. H., Mirnics, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+maternal+immune+activation+on+gene+expression+patterns+in+the+fetal+brain.">Effects of maternal immune activation on gene expression patterns in the fetal brain.</a> Transl Psychiatry. 2, e98 (2012).</li><li>Hsiao, E. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Microbiota+modulate+behavioral+and+physiological+abnormalities+associated+with+neurodevelopmental+disorders.">Microbiota modulate behavioral and physiological abnormalities associated with neurodevelopmental disorders.</a> Cell. 155 (7), 1451-1463 (2013).</li><li>Naviaux, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antipurinergic+therapy+corrects+the+autism-like+features+in+the+poly(IC)+mouse+model.">Antipurinergic therapy corrects the autism-like features in the poly(IC) mouse model.</a> PLoS One. 8 (3), e57380 (2013).</li><li>Pratt, L., Ni, L., Ponzio, N. M., Jonakait, G. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+inflammation+promotes+fetal+microglial+activation+and+increased+cholinergic+expression+in+the+fetal+basal+forebrain:+role+of+interleukin-6.">Maternal inflammation promotes fetal microglial activation and increased cholinergic expression in the fetal basal forebrain: role of interleukin-6.</a> Pediatr Res. 74 (4), 393-401 (2013).</li><li>Schwartzer, J. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Maternal+immune+activation+and+strain+specific+interactions+in+the+development+of+autism-like+behaviors+in+mice.">Maternal immune activation and strain specific interactions in the development of autism-like behaviors in mice.</a> Transl Psychiatry. 3, e240 (2013).</li><li>Khan, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long-term+effects+of+maternal+immune+activation+on+depression-like+behavior+in+the+mouse.">Long-term effects of maternal immune activation on depression-like behavior in the mouse.</a> Transl Psychiatry. 4, e363 (2014).</li><li>Workman, A. D., Charvet, C. J., Clancy, B., Darlington, R. B., Finlay, B. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Modeling+transformations+of+neurodevelopmental+sequences+across+mammalian+species.">Modeling transformations of neurodevelopmental sequences across mammalian species.</a> J Neurosci. 33 (17), 7368-7383 (2013).</li><li>Abazyan, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+interaction+of+mutant+DISC1+and+immune+activation+produces+adult+psychopathology.">Prenatal interaction of mutant DISC1 and immune activation produces adult psychopathology.</a> Biol Psychiatry. 68 (12), 1172-1181 (2010).</li><li>Meyer, U., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adult+behavioral+and+pharmacological+dysfunctions+following+disruption+of+the+fetal+brain+balance+between+pro-inflammatory+and+IL-10-mediated+anti-inflammatory+signaling.">Adult behavioral and pharmacological dysfunctions following disruption of the fetal brain balance between pro-inflammatory and IL-10-mediated anti-inflammatory signaling.</a> Mol Psychiatry. 13 (2), 208-221 (2008).</li><li>Vuillermot, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prenatal+immune+activation+interacts+with+genetic+Nurr1+deficiency+in+the+development+of+attentional+impairments.">Prenatal immune activation interacts with genetic Nurr1 deficiency in the development of attentional impairments.</a> J Neurosci. 32 (2), 436-451 (2012).</li><li>Bechard, A., Nicholson, A., Mason, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Litter+size+predicts+adult+stereotypic+behavior+in+female+laboratory+mice.">Litter size predicts adult stereotypic behavior in female laboratory mice.</a> J Am Assoc Lab Anim Sci. 51 (4), 407-411 (2012).</li><li>Harvey, L., Boksa, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+stereological+comparison+of+GAD67+and+reelin+expression+in+the+hippocampal+stratum+oriens+of+offspring+from+two+mouse+models+of+maternal+inflammation+during+pregnancy.">A stereological comparison of GAD67 and reelin expression in the hippocampal stratum oriens of offspring from two mouse models of maternal inflammation during pregnancy.</a> Neuropharmacology. 62 (4), 1767-1776 (2012).</li></ol>

The authors have nothing to disclose.

farklı zaman camlara MIA indüksiyon kemirgenlerde farklı beyin geliştirme etkinlikleri bozan ve dolayısıyla yavrularda farklı davranış anormallikleri ve nöropatolijilerin yol açar. E12.5 enjeksiyon: Burada, poli (Cı I) farelerde MIA uyarılması için bir protokol tarif. MIA indüksiyon Bu yöntem davranışsal, nörolojik, immünolojik ve yavrularda 8,10,11,16 yılında otizm ve şizofreni ile ilişkili gastrointestinal anormallikler yol açar. MIA bir çevresel risk faktörü olduğu için, dikk...

Maternal immün aktivasyon kavramı (MIA) otizm ve şizofreni 1 ile maternal enfeksiyon dernek epidemiyolojik çalışmalar kaynaklanır. Plasentanın veya maternal viral enfeksiyondan 2,3 sonrasında fetal beyninde tespit replike viral patojen olmaması, yavru enfeksiyon etkisi oldukça patojenlere kendisinden daha anne bağışıklık sisteminin aktivasyonu neden olduğu varsayılmaktadır . polisitidilik asit: MIA ve psikiyatrik bozukluklar, kimyasal olarak sentezlenmiş viral taklit çift iplikli RNA Poliinosinik enjeksiyonu arasındaki neden-sonuç ilişkisini aydınlatmak için: Hamile kemirgenler içine (poli (C)) yaygın MIA için hayvan modeli olarak kullanılmıştır 4,5. Poli (I: C) Toll-benzeri reseptör 3 (TLR3) ve poli sistemik uygulama tarafından kabul edilmektedir (I: C) viral benzeri akut inflamatuar yanıtı indükler. mekanizmalardan biri olan poli (l: C) PRyavrularda oduces davranışsal anormallikler ve nöropatolojiler anne-plasental-fetal eksen 6 yanlısı ve anti-inflamatuvar sitokinlerin bir dengesizlik neden gereğidir. Çeşitli gruplar psikiyatrik bozuklukların 7 etiyolojisi anlamak için MIA modelini benimsedik ve bağlı araştırma grupları arasındaki farklı ilgi alanlarına, immün aktivasyon çeşitli zaman noktaları beyin gelişimi ve davranışları 7 farklı tedirginlikler elde etmek için kullanılmıştır. , Embriyonik 12.5 gün hamile farelere başarıyla MIA davranışsal, nörolojik indükleyebilen olduğunu göstermiştir (E12.5), (C I) California Institute of Technology Paul H. Patterson laboratuvar poli enjekte stratejisini benimsemektedir ve otizm ve şizofreni 8-11 ile ilişkili çocuklarında immünolojik değişiklikler. Bizim önceki çalışmalar MIA yavrular davranışsal anormallikler (örneğin, sosyal impairmen görüntülemek göstermektedirt, iletişim eksikliği, tekrarlayan davranış, anksiyete gibi davranış ve gizli inhibisyon açığı 8,10,12), bağışıklık düzensizliği ve sitokinler dengesizlik 8,13,14, fetal beyin gen ifadesinin 15 değişmesi, lobule VII Purkinje hücresinin kaybı beyincik 11, hipokampus 9 sinaptik özelliklerinin değiştirilmesi, gen x çevre etkileşiminin 13, bağırsak geçirgenliğinin değiştirilmesi ve bağırsak Mikrobiyota kompozisyon 16. Bundan başka, tedavi edici ve önleyici stratejileri, bu model sistemi 13,16,17 arasında geliştirilmiştir. E12.5 MIA uyararak, diğerleri MIA serebral sinaptozomal moleküllerinin 17 fetal mikroglial aktivasyon ve bazal ön beyin 18 kolinerjik gelişimsel değişiklik, soy spesifik etkileşim 19, beyin beyin sinaptozomal ultrastrüktürel anormallikleri, beyin mitokondriyal solunum zinciri hiperfonksiyon abnormalties, infekte ürettiğini göstermiştir ,depresif benzeri davranışlar, biliş ve hipokampal uzun vadeli potensiyalizasyon (LTP) bozulma ve yetişkin hipokampal nöron 20 açığı. (C I) yanı sıra, otizm ve şizofreni etiyolojisi incelemek için bu modeli uygulamak için nasıl paradigmaları Burada, poli tarafından E12.5 MIA ikna etmek nasıl ayrıntılı bir yöntem sağlar. MIA bozukluklarının 4 çeşitli bir risk faktörü olduğuna dikkat etmek önemlidir, ve sonuçları zaman ve indüksiyon yöntemi yanı sıra hamile barajlardan hayvancılık son derece duyarlıdır. Bu nedenle, laboratuarlar arasında bile küçük tutarsızlıklar genellikle düşük tekrarlanabilirlik ve / veya yavruda farklı fenotipleri neden olur. Bizim yöntem, özellikle otizm ve şizofreni için bir çevresel risk faktörü olarak MIA okuyan ilgilenenler için tasarlanmıştır ve ayrıntılı bir açıklama araştırmacılar verilerinin tekrarlanabilirlik geliştirmemize yardımcı olacaktır sağladı.

<table><tbody><tr><td>Polyinosinic&amp;ndash;polycytidylic acid potassium salt</td><td>SIGMA</td><td>P9582</td><td></td></tr><tr><td>0.9% sodium chloride INJ. USP</td><td>HOSPIRA</td><td>NDC 0409-4888-10</td><td></td></tr><tr><td>MONOJECT insuline syrinage 3/10 ml 29 G x 1/2&quot;</td><td>COVIDIEN</td><td>8881600145</td><td></td></tr><tr><td>50 ml conical screw cap tubes</td><td>USA SCIENTIFIC</td><td>1500-1211</td><td></td></tr><tr><td>Nanodrop 1000 spectrophotometer</td><td>THERMO SCIENTIFIC</td><td>1000</td><td>Optional</td></tr><tr><td>Stereomicroscope</td><td>Wild Heerbrugg</td><td>M5A</td><td>Optional</td></tr><tr><td>Dumont #5 Forceps Inox Tip Size .10 X .06 mm</td><td>Roboz</td><td>RS-5045</td><td>Optional</td></tr><tr><td>RNAlater RNA stabilization reagent</td><td>Qiagen</td><td>76104</td><td>Optional</td></tr><tr><td>TRIzol reagent</td><td>Life Technologies</td><td>15596-026&amp;nbsp;</td><td>Optional</td></tr><tr><td>RQ1 Rnase-free DNase</td><td>Promega</td><td>M610A</td><td>Optional</td></tr><tr><td>iScript cDNA synthesis kit</td><td>Bio-Rad</td><td>170-8891</td><td>Optional</td></tr><tr><td>FastStart universal SYBR green master mix with ROX&amp;nbsp;</td><td>Roche</td><td>4913922001</td><td>Optional</td></tr><tr><td>Real-time PCR</td><td>ABI</td><td>7300</td><td>Optional</td></tr><tr><td>Primer: Il6 forward</td><td>Life Technologies</td><td>TAGTCCTTCCTACCCCAATTTCC</td><td>Optional</td></tr><tr><td>Primer: Il6 Reverse</td><td>Life Technologies</td><td>TTGGTCCTTAGCCACTCCTTC</td><td>Optional</td></tr><tr><td>Primer: beta-actin forward</td><td>Life Technologies</td><td>AGAGGGAAATCGTGCGTGAC</td><td>Optional</td></tr><tr><td>Primer: beta-actin Reverse</td><td>Life Technologies</td><td>CAATAGTGATGACCTGGCCGT</td><td>Optional</td></tr><tr><td>MicroAmp optical 96-well reaction plate</td><td>Life Technologies</td><td>4306737</td><td>Optionl</td></tr><tr><td>MicroAmp optical adhesive film&amp;nbsp;</td><td>Life Technologies</td><td>4311971</td><td>Optionl</td></tr><tr><td>EthoVision</td><td>Noldus</td><td>EthoVision</td><td>Optionl</td></tr><tr><td>SR-LAB apparatus (PPI)</td><td>San Diego Instruments&amp;nbsp;</td><td>SR-LAB</td><td>Optionl</td></tr><tr><td>Marbles</td><td>PENN-PLAX</td><td>Blue gem stones marbles</td><td>Optionl</td></tr><tr><td>Dulbecco&#039;s Phosphate-Buffered Saline (DPBS)</td><td>Life Technologies</td><td>21600-069</td><td>Optionl</td></tr><tr><td>Paraformaldehyde</td><td>MACRON</td><td>2621-59</td><td>Optionl</td></tr><tr><td>Vibratome</td><td>Leica</td><td>VT1000 S</td><td>Optionl</td></tr><tr><td>Sodium azide</td><td>Sigma</td><td>S2002</td><td>Optionl</td></tr><tr><td>Triton x-100</td><td>Sigma</td><td>X100</td><td>Optionl</td></tr><tr><td>Hydrogen peroxide solution</td><td>Sigma</td><td>18312</td><td>Optionl</td></tr><tr><td>Goat serum</td><td>Vector Laboratories</td><td>S-1000</td><td>Optionl</td></tr><tr><td>Rabbit anti-calbindin antibody</td><td>Abcam</td><td>ab11426</td><td>Optionl</td></tr><tr><td>Biotinlyated goat anti-rabbit IgGantibody</td><td>Vector Laboratories</td><td>BA-1000</td><td>Optionl</td></tr><tr><td>VECTASTAIN ABC Kit</td><td>Vector Laboratories</td><td>PK-4000</td><td>Optionl</td></tr></tbody></table>

induction of maternal immune activation in mice at mid-gestation stage with viral mimic poly(i:c)

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric disorders. Numerous studies have demonstrated that MIA model is able to show face, construct, and predictive validity that are relevant to autism and schizophrenia. To model MIA, investigators often use viral mimic polyinosinic:polycytidylic acid (poly(I:C)) to activate the immune system in pregnant rodents. Generally, the offspring from immune activated dam exhibit behavioral abnormalities and physiological alterations that are associated with autism and schizophrenia. However, poly(I:C) injection with different dosages and at different time points could lead to different outcomes by perturbing brain development at different stages. Here we provide a detailed method of inducing MIA by intraperitoneal (i.p.) injection of 20 mg/kg poly(I:C) at mid-gestational embryonic 12.5 days (E12.5). This method has been shown to induce acute inflammatory response in the maternal-placental-fetal axis, which ultimately results in the brain perturbations and behavioral phenotypes that are associated with autism and schizophrenia.

<html> / Kg poli 20 mg Enjeksiyon: E12.5 (C) anne-plasental-fetal ekseninde bir akut enflamatuar yanıtı uyandırmak ve beyin gelişimi ve davranış fenotipleri 12,13 bir kronik etkisi hızlandırabilir olabilir. proinflamatuvar sitokin yüksek seviyeleri, İnterlökin (IL) -6, MIA sonrası akut inflamatuar yanıtın güvenilir bir göstergesidir. Enjeksiyon 12,13: Il6 gen plasenta ifade ve fetal beyin için zirve zamanı 3 saat sonrası poli (C I) yer alm...

Watch this Scientific Journal Video about Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C at JoVE.com

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C

(C I) Viral Mimik Poli ile Orta gebelik Sahnesi&#39;nde Farelerde Anne Bağışıklık aktivasyonu indüksiyon

Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.

Maternal immune activation (MIA) model is increasingly well appreciated as a rodent model for the environmental risk factor of various psychiatric ...

induction-maternal-immune-activation-mice-at-mid-gestation-stage-with

Research

JoVE Journal

Immunology and Infection

Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic Poly(I:C)

18.1K Görüntüleme.  California Institute of Technology. Maternal immune activation (MIA) is a model for an environmental risk factor of autism and schizophrenia. The goal of this article is to provide a step-by-step procedure of how to induce MIA in the pregnant mice in order to enhance the reproducibility of this model.

Video: Induction of Maternal Immune Activation in Mice at Mid-gestation Stage with Viral Mimic PolyI:C

Assessment of Maternal Vascular Remodeling During Pregnancy in the Mouse Uterus

The placenta mediates the exchange of factors such as gases and nutrients between mother and fetus and has specific demands for supply of blood from the maternal circulation. The maternal uterine vasculature needs to adapt to this temporary demand and the success of this arterial remodeling process has implications for fetal growth. Cells of the maternal immune system, especially natural killer (NK) cells, play a critical role in this process. Here we describe a method to assess the degree of remodeling of maternal spiral arteries during mouse pregnancy. Hematoxylin and eosin-stained tissue sections are scanned and the size of the vessels analysed. As a complementary validation method, we also present a qualitative assessment for the success of the remodeling process by immunohistochemical detection of smooth muscle actin (SMA), which normally disappears from within the arterial vascular media at mid-gestation. Together, these methods enable determination of an important parameter of the pregnancy phenotype. These results can be combined with other endpoints of mouse pregnancy to provide insight into the mechanisms underlying pregnancy-related complications.

This protocol describes a technique to assess changes in the maternal vasculature during pregnancy in mice. Using stereological methods, remodeling of the decidual spiral arteries is assessed quantitatively and the results confirmed qualitatively using immunohistochemistry.

Fare Uterus içinde Gebelikte maternal Vasküler Yaptırma Değerlendirilmesi

The placenta mediates the exchange of factors such as gases and nutrients between mother and fetus and has specific demands for supply of blood from the ...

Gelişim Biyolojisi

Use of In vivo Imaging to Monitor the Progression of Experimental Mouse Cytomegalovirus Infection in Neonates

Human Cytomegalovirus (HCMV or HHV-5) is a life-threatening pathogen in immune-compromised individuals. Upon congenital or neonatal infection, the virus can infect and replicate in the developing brain, which may induce severe neurological damage, including deafness and mental retardation. Despite the potential severity of the symptoms, the therapeutic options are limited by the unavailability of a vaccine and the absence of a specific antiviral therapy. Furthermore, a precise description of the molecular events occurring during infection of the central nervous system (CNS) is still lacking since observations mostly derive from the autopsy of infected children. Several animal models, such as rhesus macaque CMV, have been developed and provided important insights into CMV pathogenesis in the CNS. However, despite its evolutionary proximity with humans, this model was limited by the intracranial inoculation procedure used to infect the animals and consistently induce CNS infection. Furthermore, ethical considerations have promoted the development of alternative models, among which neonatal infection of newborn mice with mouse cytomegalovirus (MCMV) has recently led to significant advances. For instance, it was reported that intraperitoneal injection of MCMV to Balb/c neonates leads to infection of neurons and glial cells in specific areas of the brain. These findings suggested that experimental inoculation of mice might recapitulate the deficits induced by HCMV infection in children. Nevertheless, a dynamic analysis of MCMV infection of neonates is difficult to perform because classical methodology requires the sacrifice of a significant number of animals at different time points to analyze the viral burden and/or immune-related parameters. To circumvent this bottleneck and to enable future investigations of rare mutant animals, we applied in vivo imaging technology to perform a time-course analysis of the viral dissemination in the brain upon peripheral injection of a recombinant MCMV expressing luciferase to C57Bl/6 neonates.

Use of In vivo Imaging to Monitor the Progression of Experimental Mouse Cytomegalovirus Infection in Neonates

Human Cytomegalovirus (HCMV) infection of neonates represents an important cause of mental retardation, yet the molecular events leading to virus-induced pathogenesis are still poorly understood. To investigate the dynamics of brain infection, we adapted whole-animal in vivo imaging to perform time-course analysis of neonates infected with a luciferase-recombinant virus.

Kullanımı<em&gt; In vivo</em&gt; Görüntüleme Yenidoğanlar Deneysel Fare Sitomegalovirüs Enfeksiyon ilerleme Monitör

Human Cytomegalovirus (HCMV or HHV-5) is a life-threatening  pathogen in immune-compromised individuals. Upon congenital or neonatal  infection, the virus ...

İmmünoloji ve Enfeksiyon

Dissecting Innate Immune Signaling in Viral Evasion of Cytokine Production

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. Conversely, viruses have evolved intricate strategies to evade and exploit host immune signaling for survival and propagation. Viral immune evasion, entailing host defense and viral evasion, provides one of the most fascinating and dynamic interfaces to discern the host-virus interaction. These studies advance our understanding in innate immune regulation and pave our way to develop novel antiviral therapies.
Murine &#947;HV68 is a natural pathogen of murine rodents. &#947;HV68 infection of mice provides a tractable small animal model to examine the antiviral response to human KSHV and EBV of which perturbation of in vivo virus-host interactions is not applicable. Here we describe a protocol to determine the antiviral cytokine production. This protocol can be adapted to other viruses and signaling pathways.
Recently, we have discovered that &#947;HV68 hijacks MAVS and IKK&#946;, key innate immune signaling components downstream of the cytosolic RIG-I and MDA5, to abrogate NF&#922;B activation and antiviral cytokine production. Specifically, &#947;HV68 infection activates IKK&#946; and that activated IKK&#946; phosphorylates RelA to accelerate RelA degradation. As such, &#947;HV68 efficiently uncouples NF&#922;B activation from its upstream activated IKK&#946;, negating antiviral cytokine gene expression. This study elucidates an intricate strategy whereby the upstream innate immune activation is intercepted by a viral pathogen to nullify the immediate downstream transcriptional activation and evade antiviral cytokine production.

We describe a protocol to measure the antiviral cytokine production in mice infected with a model herpesvirus, murine gamma herpesvirus 68 (&#947;HV68) that is closely-related to human Kaposi&#8217;s sarcoma-associated herpesvirus (KSHV) and Epstein-Barr virus (EBV). Utilizing genetically modified mouse strains and mouse embryonic fibroblasts (MEFs), we assessed the antiviral cytokine production both in vivo and ex vivo. &#8220;Reconstituting&#8221; the expression of innate immune components in knockout embryonic fibroblasts by lentiviral transduction, we further pinpoint specific innate immune molecules and dissect the key signaling events that differentially regulate the antiviral cytokine production.

Sitokin Üretimi Viral Evasion Doğuştan Bağışıklık Sinyalizasyonu Diseksiyon

In response to a viral infection, the host innate immune response is activated to up-regulate gene expression and production of antiviral cytokines. ...

Mouse In Vivo Placental Targeted CRISPR Manipulation

The placenta is an essential organ that regulates and maintains mammalian development in utero. The placenta is responsible for the transfer of nutrients and waste between the mother and fetus and the production and delivery of growth factors and hormones. Placental genetic manipulations in mice are critical for understanding the placenta's specific role in prenatal development. Placental-specific Cre-expressing transgenic mice have varying effectiveness, and other methods for placental gene manipulation can be useful alternatives. This paper describes a technique to directly alter placental gene expression using CRISPR gene manipulation, which can be used to modify the expression of targeted genes. Using a relatively advanced surgical approach, pregnant dams undergo a laparotomy on embryonic day 12.5 (E12.5), and a CRISPR plasmid is delivered by a glass micropipette into the individual placentas. The plasmid is immediately electroporated after each injection. After dam recovery, the placentas and embryos can continue development until assessment at a later time point. The evaluation of the placenta and offspring after the use of this technique can determine the role of time-specific placental function in development. This type of manipulation will allow for a better understanding of how placental genetics and function impact fetal growth and development in multiple disease contexts.

Mouse In Vivo Placental Targeted CRISPR Manipulation

Here we describe a time-specific method to effectively manipulate critical developmental pathways in the mouse placenta in vivo. This is performed through the injection and electroporation of CRISPR plasmids into the placentas of pregnant dams on embryonic day 12.5.

Fare In Vivo Plasental Hedefli CRISPR Manipülasyonu

The placenta is an essential organ that regulates and maintains mammalian development in utero. The placenta is responsible for the transfer of nutrients ...

Genetik

Isolation of Leukocytes from the Murine Tissues at the Maternal-Fetal Interface

Immune tolerance in pregnancy requires that the immune system of the mother undergoes distinctive changes in order to accept and nurture the developing fetus. This tolerance is initiated during coitus, established during fecundation and implantation, and maintained throughout pregnancy. Active cellular and molecular mediators of maternal-fetal tolerance are enriched at the site of contact between fetal and maternal tissues, known as the maternal-fetal interface, which includes the placenta and the uterine and decidual tissues. This interface is comprised of stromal cells and infiltrating leukocytes, and their abundance and phenotypic characteristics change over the course of pregnancy. Infiltrating leukocytes at the maternal-fetal interface include neutrophils, macrophages, dendritic cells, mast cells, T cells, B cells, NK cells, and NKT cells that together create the local micro-environment that sustains pregnancy. An imbalance among these cells or any inappropriate alteration in their phenotypes is considered a mechanism of disease in pregnancy. Therefore, the study of leukocytes that infiltrate the maternal-fetal interface is essential in order to elucidate the immune mechanisms that lead to pregnancy-related complications. Described herein is a protocol that uses a combination of gentle mechanical dissociation followed by a robust enzymatic disaggregation with a proteolytic and collagenolytic enzymatic cocktail to isolate the infiltrating leukocytes from the murine tissues at the maternal-fetal interface. This protocol allows for the isolation of high numbers of viable leukocytes (&#62;70%) with sufficiently conserved antigenic and functional properties. Isolated leukocytes can then be analyzed by several techniques, including immunophenotyping, cell sorting, imaging, immunoblotting, mRNA expression, cell culture, and in vitro functional assays such as mixed leukocyte reactions, proliferation, or cytotoxicity assays.

Described herein is a protocol to isolate and analyze the infiltrating leukocytes of tissues at the maternal-fetal interface (uterus, decidua, and placenta) of mice. This protocol maintains the integrity of most cell surface markers and yields enough viable cells for downstream applications including flow cytometry analysis.

Maternal Fetal Arayüz at Fare Dokular lökosit İzolasyonu

Immune tolerance in pregnancy requires that the immune system of the mother undergoes distinctive changes in order to accept and nurture the developing ...

Intracerebroventricular and Intravascular Injection of Viral Particles and Fluorescent Microbeads into the Neonatal Brain

In the study on the pathogenesis of viral encephalitis, the infection method is critical. The first of the two main infectious routes to the brain is the hematogenous route, which involves infection of the endothelial cells and pericytes of the brain. The second is the intracerebroventricular (ICV) route. Once within the central nervous system (CNS), viruses may spread to the subarachnoid space, meninges, and choroid plexus via the cerebrospinal fluid. In experimental models, the earliest stages of CNS viral distribution are not well characterized, and it is unclear whether only certain cells are initially infected. Here, we have analyzed the distribution of cytomegalovirus (CMV) particles during the acute phase of infection, termed primary viremia, following ICV or intravascular (IV) injection into the neonatal mouse brain. In the ICV injection model, 5 &#181;l of murine CMV (MCMV) or fluorescent microbeads were injected into the lateral ventricle at the midpoint between the ear and eye using a 10-&#181;l syringe with a 27 G needle. In the IV injection model, a 1-ml syringe with a 35 G needle was used. A transilluminator was used to visualize the superficial temporal (facial) vein of the neonatal mouse. We infused 50 &#181;l of MCMV or fluorescent microbeads into the superficial temporal vein. Brains were harvested at different time points post-injection. MCMV genomes were detected using the in situ hybridization method. Fluorescent microbeads or green fluorescent protein expressing recombinant MCMV particles were observed by fluorescent microscopy. These techniques can be applied to many other pathogens to investigate the pathogenesis of encephalitis.

Here, we describe a simple method of intracerebroventricular and intravascular injection of viral particles or fluorescent microbeads into the neonatal mouse brain. The localization pattern of the virus and nanoparticles could be detected by microscopic evaluation or by in situ hybridization.

Yenidoğan Beyin içine Viral Parçacıklar ve Floresan mikro boncuklar intraserebroventriküler ve İntravasküler Enjeksiyon

In the study on the pathogenesis of viral encephalitis, the infection method is critical. The first of the two main infectious routes to the brain is the ...

Nörobilim

Evaluation of Zika Virus-specific T-cell Responses in Immunoprivileged Organs of Infected Ifnar1-/- Mice

The Zika virus (ZIKV) can induce inflammation in immunoprivileged organs (e.g., the brain and testis), leading to the Guillain-Barr&#233; syndrome and damaging the testes. During an infection with the ZIKV, immune cells have been shown to infiltrate into the tissues. However, the cellular mechanisms that define the protection and/or immunopathogenesis of these immune cells during a ZIKV infection are still largely unknown. Herein, we describe methods to evaluate the virus-specific T-cell functionality in these immunoprivileged organs of ZIKV-infected mice. These methods include a) a ZIKV infection and vaccine inoculation in Ifnar1-/- mice; b) histopathology, immunofluorescence, and immunohistochemistry assays to detect the virus infection and inflammation in the brain, testes, and spleen; c) the preparation of a tetramer of ZIKV-derived T-cell epitopes; d) the detection of ZIKV-specific T cells in the monocytes isolated from the brain, testes, and spleen. Using these approaches, it is possible to detect the antigen-specific T cells that have infiltrated into the immunoprivileged organs and to evaluate the functions of these T cells during the infection: potential immune protection via virus clearance and/or immunopathogenesis to exacerbate the inflammation. These findings may also help to clarify the contribution of T cells induced by the immunization against ZIKV.

Evaluation of Zika Virus-specific T-cell Responses in Immunoprivileged Organs of Infected Ifnar1-/- Mice

A protocol to evaluate antigen-specific T-cell responses in the immunoprivileged organs of the Ifnar1-/- murine model for the Zika virus (ZIKV) infection is described. This method is pivotal for investigating the cellular mechanisms of the protection and immunopathogenesis of ZIKV vaccines and is also valuable for their efficacy evaluation.

Virüslü Ifnar1- / - farelerin Immunoprivileged organlarında Zika virüs özgü T hücreli yanıt-e doğru değerlendirilmesi

The Zika virus (ZIKV) can induce inflammation in immunoprivileged organs (e.g., the brain and testis), leading to the Guillain-Barr&#233; syndrome and ...

C-section of Preclinical Animal Model of Chorioamnionitis Triggered by Group B Streptococcus (GBS)

Group B Streptococcus (GBS) is one of the most common bacteria isolated during human pregnancy. It is a leading cause of placental infection/inflammation, termed chorioamnionitis. Chorioamnionitis exposes the developing fetus to a high risk of organ injuries, perinatal morbidity, and mortality, as well as life-long neurobehavioral impairments and other non-neurological developmental issues. The two most frequent subtypes of GBS isolates from maternal and fetal tissues are serotypes Ia (13%-23%) and III (25%-53%). Our lab has developed and characterized a rat model of GBS-induced chorioamnionitis to study subsequent impacts on the central nervous system of the developing fetus and to understand underlying mechanistic aspects. This article presents the design as well as uses of the preclinical rat model, which closely reproduces the hallmark of GBS-induced chorioamnionitis in humans. This article aims to help scientists reproduce the experimental design as well as to provide support through examples of troubleshooting. The present model may also contribute to potential discoveries through uncovering causes, mechanisms, and novel therapeutic avenues, which remain unsettled in many developmental impairments arising from chorioamnionitis. Furthermore, the use of this model may be extended to the studies of perinatal non-neurological common and severe morbidities affecting, for instance, the retina, bowel, lung, and kidney. The main interest of this research is in the field of GBS-induced fetal neurodevelopmental impairments such as cerebral palsy (CP), attention deficit hyperactivity disorder (ADHD), and autism spectrum disorder (ASD). The rationale supporting this model is presented in this article, followed by procedures and results.

C-section of Preclinical Animal Model of Chorioamnionitis Triggered by Group B Streptococcus GBS

The goal of this protocol is to describe a preclinical animal model of Group B Streptococcus (GBS)-induced chorioamnionitis. The study is designed to investigate mechanistic processes, potential causal links with developmental impairments, and finally to develop translational anti-inflammatory placento- and neuro-protective treatments.

Group B Streptococcus (GBS) is one of the most common bacteria isolated during human pregnancy. It is a leading cause of placental infection/inflammation, ...

A Murine Model of Fetal Exposure to Maternal Inflammation to Study the Effects of Acute Chorioamnionitis on Newborn Intestinal Development

Chorioamnionitis is a common precipitant of preterm birth and is associated with many of the morbidities of prematurity, including necrotizing enterocolitis (NEC). However, a mechanistic link between these two conditions remains yet to be discovered. We have adopted a murine model of chorioamnionitis involving lipopolysaccharide (LPS)-induced fetal exposure to maternal inflammation (FEMI). This model of FEMI induces a sterile maternal, placental, and fetal inflammatory cascade, which is also present in many cases of clinical chorioamnionitis. Although models exist that utilize live bacteria and more accurately mimic the pathophysiology of an ascending infection resulting in chorioamnionitis, these methods may cause indirect effects on development of the immature intestinal tract and the associated developing microbiome. Using this protocol, we have demonstrated that LPS-induced FEMI results in a dose-dependent increase in pregnancy loss and preterm birth, as well as disruption of normal intestinal development in offspring. Further, we have demonstrated that FEMI significantly increases intestinal injury and serum cytokines in offspring, while simultaneously decreasing goblet and Paneth cells, both of which provide a first line of innate immunity against intestinal inflammation. Although a similar model of LPS-induced FEMI has been used to model the association between chorioamnionitis and subsequent abnormalities of the central nervous system, to our knowledge, this protocol is the first to attempt to elucidate a mechanistic link between chorioamnionitis and later perturbations in intestinal development as a potential link between chorioamnionitis and NEC.

We developed a model of chorioamnionitis to simulate fetal exposure to maternal inflammation (FEMI) without complications of live organisms to examine the effects of FEMI on development of the offspring&#8217;s intestinal tract. This allows for study of mechanistic causes for development of intestinal injury following chorioamnionitis.

Akut Chorioamnionitis'in Yenidoğan Bağırsak Gelişimi Üzerindeki Etkilerini İncelemek için Anne İltihaba Fetal MaruzIyetin Bir Murine Modeli

Chorioamnionitis is a common precipitant of preterm birth and is associated with many of the morbidities of prematurity, including necrotizing ...

Tıp

Generating a Reproducible Model of Mid-Gestational Maternal Immune Activation using Poly(I:C) to Study Susceptibility and Resilience in Offspring

Maternal immune activation (MIA) during pregnancy is consistently linked to increased risk of neurodevelopmental and neuropsychiatric disorders in offspring. Animal models of MIA are used to test causality, investigate mechanisms, and develop diagnostics and treatments for these disorders. Despite their widespread use, many MIA models suffer from a lack of reproducibility and almost all ignore two important aspects of this risk factor: (i) many offspring are resilient to MIA, and (ii) susceptible offspring can exhibit distinct combinations of phenotypes. To increase reproducibility and model both susceptibility and resilience to MIA, the baseline immunoreactivity (BIR) of female mice before pregnancy is used to predict which pregnancies will result in either resilient offspring or offspring with defined behavioral and molecular abnormalities after exposure to MIA. Here, a detailed method of inducing MIA via intraperitoneal (i.p.) injection of the double stranded RNA (dsRNA) viral mimic poly(I:C) at 12.5 days of gestation is provided. This method induces an acute inflammatory response in the dam, which results in perturbations in brain development in mice that map onto similarly impacted domains in human psychiatric and neurodevelopmental disorders (NDDs).

Generating a Reproducible Model of Mid-Gestational Maternal Immune Activation using PolyI:C to Study Susceptibility and Resilience in Offspring

Maternal infection is a risk factor for neurodevelopmental disorders. Mouse models of maternal immune activation (MIA) may elucidate infection's impact on brain development and function. Here, general guidelines and a procedure are provided to produce reliably resilient and susceptible offspring exposed to MIA.

Yavrularda Duyarlılık ve Esnekliği Incelemek için Poli (I: C) Kullanarak Orta Gebelik Maternal İmmün Aktivasyonun Yeniden Üretilebilir Bir Modelinin Oluşturulması

(C I) Viral Mimik Poli ile Orta gebelik Sahnesi'nde Farelerde Anne Bağışıklık aktivasyonu indüksiyon

Özet

Daha Fazla Video Keşfet

Bu videodaki bölümler