Name: generation of discriminative human monoclonal antibodies from rare antigen-specific b cells circulating in blood
Uploaded: 2018-02-06T14:00:00
Description: Watch this Scientific Journal Video about Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood at JoVE.com

We thank the Cytometry Facility &#34;CytoCell&#34; (SFR Sant&#233;, Biogenouest, Nantes) for expert technical assistance. We thank also all the staff of recombinant protein production (P2R) and of IMPACT platforms (INSERM 1232, SFR Sant&#233;, Biogenouest, Nantes) for their technical support. We thank Emmanuel Scotet and Richard Breathnach for constructive comments on the manuscript. This work was financially supported by the IHU-Cesti project funded by the &#171; Investissements d&#39;Avenir &#187; French Government program, managed by the French National Research Agency (ANR) (ANR-10-IBHU-005). The IHU-Cesti project is also supported by Nantes M&#233;tropole and R&#233;gion Pays de la Loire. This work was realized in the context of the LabEX IGO program supported by the National Research Agency via the investment of the future program ANR-11-LABX-0016-01.

All human peripheral blood samples were obtained from anonymous adult donors after informed consent, in accordance with the local ethics committee (Etablissement Fran&#231;ais du Sang, EFS, Nantes, procedure PLER NTS-2016-08).
1. Isolation of Human Peripheral Blood Mononuclear Cells
NOTE: Starting material can be total human peripheral blood or cytapheresis samples. Samples should not be older than 8 h and supplemented with anticoagulants (e.g., heparin)....

<ol>
	<li>Buss, N. A., Henderson, S. J., McFarlane, M., Shenton, J. M., de Haan, L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monoclonal+antibody+therapeutics:+history+and+future.">Monoclonal antibody therapeutics: history and future.</a> Curr Opin Pharmacol. 12 (5), 615-622 (2012).</li><li>Park, J., Kwon, M., Shin, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+checkpoint+inhibitors+for+cancer+treatment.">Immune checkpoint inhibitors for cancer treatment.</a> Arch Pharm Res. 39 (11), 1577-1587 (2016).</li><li>Pendley, C., Schantz, A., Wagner, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunogenicity+of+therapeutic+monoclonal+antibodies.">Immunogenicity of therapeutic monoclonal antibodies.</a> Curr Opin Mol Ther. 5 (2), 172-179 (2003).</li><li>Kwakkenbos, M. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+stable+monoclonal+antibody-producing+B+cell+receptor-positive+human+memory+B+cells+by+genetic+programming.">Generation of stable monoclonal antibody-producing B cell receptor-positive human memory B cells by genetic programming.</a> Nat Med. 16 (1), 123-128 (2010).</li><li>Tiller, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Efficient+generation+of+monoclonal+antibodies+from+single+human+B+cells+by+single+cell+RT-PCR+and+expression+vector+cloning.">Efficient generation of monoclonal antibodies from single human B cells by single cell RT-PCR and expression vector cloning.</a> J Immunol Methods. 329 (1-2), 112-124 (2008).</li><li>Franz, B., May, K. F., Dranoff, G., Wucherpfennig, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ex+vivo+characterization+and+isolation+of+rare+memory+B+cells+with+antigen+tetramers.">Ex vivo characterization and isolation of rare memory B cells with antigen tetramers.</a> Blood. 118 (2), 348-357 (2011).</li><li>Morris, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+a+human+anti-HIV+gp41+membrane+proximal+region+neutralizing+antibody+by+antigen-specific+single+B+cell+sorting.">Isolation of a human anti-HIV gp41 membrane proximal region neutralizing antibody by antigen-specific single B cell sorting.</a> PLoS One. 6 (9), e23532 (2011).</li><li>Iizuka, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+of+cytomegalovirus+(CMV)pp65+antigen-specific+human+monoclonal+antibodies+using+single+B+cell-based+antibody+gene+cloning+from+melanoma+patients.">Identification of cytomegalovirus (CMV)pp65 antigen-specific human monoclonal antibodies using single B cell-based antibody gene cloning from melanoma patients.</a> Immunol Lett. 135 (1-2), 64-73 (2011).</li><li>Ouisse, L. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antigen-specific+single+B+cell+sorting+and+expression-cloning+from+immunoglobulin+humanized+rats:+a+rapid+and+versatile+method+for+the+generation+of+high+affinity+and+discriminative+human+monoclonal+antibodies.">Antigen-specific single B cell sorting and expression-cloning from immunoglobulin humanized rats: a rapid and versatile method for the generation of high affinity and discriminative human monoclonal antibodies.</a> BMC Biotechnol. 17 (1), 3 (2017).</li><li>Kerkman, P. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterisation+of+citrullinated+antigen-specific+B+cells+in+peripheral+blood+of+patients+with+rheumatoid+arthritis.">Identification and characterisation of citrullinated antigen-specific B cells in peripheral blood of patients with rheumatoid arthritis.</a> Ann Rheum Dis. , (2015).</li><li>Hamilton, J. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=General+Approach+for+Tetramer-Based+Identification+of+Autoantigen-Reactive+B+Cells:+Characterization+of+La-+and+snRNP-Reactive+B+Cells+in+Autoimmune+BXD2+Mice.">General Approach for Tetramer-Based Identification of Autoantigen-Reactive B Cells: Characterization of La- and snRNP-Reactive B Cells in Autoimmune BXD2 Mice.</a> J Immunol. 194 (10), 5022-5034 (2015).</li><li>Sanjuan Nandin, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Novel+in+vitro+booster+vaccination+to+rapidly+generate+antigen-specific+human+monoclonal+antibodies.">Novel in vitro booster vaccination to rapidly generate antigen-specific human monoclonal antibodies.</a> J Exp Med. , (2017).</li><li>Bowers, P. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mammalian+cell+display+for+the+discovery+and+optimization+of+antibody+therapeutics.">Mammalian cell display for the discovery and optimization of antibody therapeutics.</a> Methods. 65 (1), 44-56 (2014).</li></ol>

The proposed protocol is a powerful method for the generation of human mAbs directly from Ag-specific B cells circulating in the blood. It combines three important aspects: (i) the use of a tetramer-associated magnetic enrichment, which allows an ex vivo isolation of even rare Ag-binding B cells; (ii) a gating strategy that uses three Ag tetramers (two relevant ones and one irrelevant one) labelled with three different fluorochromes to isolate, by flow cytometry, only the B cells expressing a BCR specific for th...

An erratum was issued for: <a href="https://www.jove.com/video/56508/generation-discriminative-human-monoclonal-antibodies-from-rare">Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood</a>.
The Affiliations section was corrected from:
Marie-Claire Devilder1,2,&#160;M&#233;linda Moyon1,2,&#160;Xavier Saulquin1, Laetitia Gautreau-Rolland1 
1Centre R&#233;gional de Recherche en Canc&#233;rologie et Immunologie Nantes/Angers, INSERM 1232, LabEx IGO, Universit&#233; de Nantes 
2CHU Nantes
to:
Marie-Claire Devilder1,2,3,&#160;M&#233;linda Moyon1,2,3,&#160;Xavier Saulquin1,2, Laetitia Gautreau-Rolland1,2&#160; 
1CRCINA, Inserm, CNRS, Universit&#233; d&#39;Angers, Universit&#233; de Nantes 
2LabEx IGO, &#34;Immunotherapy, Graft, Oncology&#34; 
3CHU, Nantes, France

An erratum was issued for: <a href="https://www.jove.com/video/56508/generation-discriminative-human-monoclonal-antibodies-from-rare">Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood</a>

Erratum: Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood

The method described here allows the rapid and versatile production of fully human monoclonal antibodies (mAbs) against a desired antigen (Ag). mAbs are essential tools in many fundamental research applications in vitro and in vivo: flow cytometry, histology, western-blotting, and blocking experiments for example. Furthermore, mAbs are being used more and more in medicine to treat autoimmune diseases, cancer, and to control transplantation rejection1. For example, anti-CTLA-4 and anti-PD-1 (or anti-PD-L1) mAbs were recently used as immune checkpoint inhibitors in cancer treatments2.
The first mAbs were produced by immunoglobulin (Ig)-secreting hybridomas obtained from the splenic cells of immunized mice or rats. However, the strong immune response against murine or rat mAbs hampers their therapeutic use in humans, due to their rapid clearance and the probable induction of hypersensitivity reactions3. To tackle this problem, animal protein sequences of mAbs have been partially replaced by human ones to generate so-called chimeric mouse-human or humanized antibodies. However, this strategy only partially decreases immunogenicity, while substantially increasing both the cost and the time-scale of production. A better solution is to generate human mAbs directly from human B cells and several strategies for this are available. One of them is the use of phage or yeast display. This involves displaying variable domains from a combinatorial library of random human Ig heavy and light chains on phages or yeasts, and carrying out a selection step using the specific antigen of interest. A major drawback of this strategy is that heavy and light chains are randomly associated, leading to a very large increase in the diversity of generated antibodies. Antibodies obtained are unlikely to correspond to those that would arise from a natural immune response against a particular Ag. Moreover, human protein folding and post-translational modifications are not systematically reproduced in prokaryotes or even in yeasts. A second human mAb production method is the immortalization of natural human B cells, by Epstein-Barr virus infection or expression of the anti-apoptotic factors BCL-6 and BCL-XL4. However, this method is applicable only to memory B cells and is inefficient, requiring screening of numerous mAb-producing immortalized B cells to identify the few (if any) mAb clones with the desired antigenic specificity. The method is thus both costly and time consuming.
A new protocol has recently been described for production of human mAbs from isolated single B cells5. It relies on an optimized single-cell Reverse Transcription-Polymerase Chain Reaction (RT-PCR) for amplification of both the heavy- and light-chain encoding segments from a single sorted B cell. This is followed by the cloning and expression of these segments in a eukaryotic expression system, thus allowing reconstruction of a fully human mAb. This protocol has been used successfully starting from B cells from vaccinated donors. Cells were harvested several weeks after vaccination to obtain higher frequencies of B cells directed against the desired Ag, and thus limit the time required for screening6. Other fully human mAbs have also been produced from HIV+ (Human Immunodeficiency Virus) infected patients7 and melanoma patients8. Despite these advances, there is still no procedure available that enables the isolation of Ag-specific B cells independent of their memory phenotype or frequency.
The procedure described here leads to efficient ex vivo isolation of human circulating B cells based on their BCR specificity, followed by the production of fully human antigen-specific mAbs in high yield and with a low screening time. The method is not restricted to memory B cells or antibody-secreting B cells induced after an immune response, but can also be applied to the human na&#239;ve B cell repertoire. That it works even starting from Ag-specific B cells present at very low frequencies is a good indication of its efficiency. The principle of the method is as follows: Peripheral Blood Mononuclear Cells (PBMC) are stained with two tetramers presenting the antigen of interest, each labeled with a different fluorochrome (e.g., Phycoerythrin (PE) and Allophycocyanin (APC)), and a third tetramer presenting a closely related antigen conjugated with a third fluorochrome (e.g., Brillant Violet 421 (BV421)). To enrich for antigen-binding cells, cells are then incubated with beads coated with anti-PE and anti-APC Abs, and sorted in cell separation columns. The PE+ APC+ cell fraction is selected, stained with a variety of mAbs specific for different PBMC cell types to permit identification of B cells, and subjected to flow cytometry cell sorting. B cells which are PE+ and APC+, but Brilliant Violet-, are isolated. This step counter-selects cells which are not B cells or do not bind to the tetramerized antigen, but do bind to either PE or APC (these cells will be PE+ APC- or PE- APC+) or to the non-antigen part of the tetramers used (these cells will be BV421+). B cells not highly specific for the epitope of interest are also counter-selected at this step (these cells will also be BV421+). Thus, this method can purify highly specific B cells expressing B-cell Receptors (BCRs) able to discriminate between two very closely related antigens. Single specific B cells are collected in tubes and their PCR-amplified Ig cDNAs (complementary deoxyribonucleic acids) cloned and expressed by a human cell line as secreted IgG mAbs.
As a proof of concept, this study describes the efficient generation of human mAbs, which recognize a peptide presented by a major histocompatibility complex class I (MHC-I) molecule and can discriminate between this peptide and other peptides loaded on the same MHC-I allele. Although the level of complexity of this Ag is important, this method allows (i) high yield recovery of Ag-specific mAbs; (ii) production of mAbs able to discriminate between two structurally close Ags. This approach can be extended to vaccinated or infected patients without any protocol modification, and has also already been successfully implemented in a humanized rat system9. Thus, this study describes a versatile and efficient approach to generate fully human mAbs that can be used in basic research and immunotherapy.

<table>
	<tbody>
		<tr>
			<td>HEK 293A cell line</td>
			<td>Thermo Fisher scientific</td>
			<td>R70507</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM (1X) Dulbecco&#39;s Modified Eagle Medium</td>
			<td>Gibco by life technologies</td>
			<td>21969-035</td>
			<td>(+) 4,5g/L D-Glucose 
			0,11g/L Sodium Pyruvate 
			(-) L-Glutmine</td>
		</tr>
		<tr>
			<td>RPMI medium1640 (1X)</td>
			<td>Gibco by life technologies</td>
			<td>31870-025</td>
			<td></td>
		</tr>
		<tr>
			<td>Bovine Serum Albumine (BSA)</td>
			<td>PAA</td>
			<td>K45-001</td>
			<td></td>
		</tr>
		<tr>
			<td>Nutridoma-SP</td>
			<td>Roche</td>
			<td>11011375001</td>
			<td>100X Conc</td>
		</tr>
		<tr>
			<td>PBS-Phosphate Buffered Saline (10X) pH 7,4</td>
			<td>Ambion</td>
			<td>AM9624</td>
			<td></td>
		</tr>
		<tr>
			<td>EDTA (Ethylenediaminetetraacetic acid) 0,5M pH=8</td>
			<td>Invitrogen by Life Technologies</td>
			<td>15575-020</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine serum (FBS)</td>
			<td>Dominique Dutscher</td>
			<td>S1810-500</td>
			<td></td>
		</tr>
		<tr>
			<td>Ficoll - lymphocytes separation medium</td>
			<td>EuroBio</td>
			<td>CMSMSL01-01</td>
			<td>density 1,0777+/-0,001</td>
		</tr>
		<tr>
			<td>streptavidin R-phycoerythrin conjugate</td>
			<td>Invitrogen by Life Technologies</td>
			<td>S21388</td>
			<td>premiun grade 1mg/ml contains 5mM sodium azide</td>
		</tr>
		<tr>
			<td>Streptavidin, allophycocyanin conjugate</td>
			<td>Invitrogen by thermoFisher scientific</td>
			<td>S32362</td>
			<td>1mg/ml 
			2mM azide premium grade</td>
		</tr>
		<tr>
			<td>Brilliant violet 421 streptavidin</td>
			<td>Biolegend</td>
			<td>405225</td>
			<td>conc : 0,5mg/ml</td>
		</tr>
		<tr>
			<td>Anti-PE conjugated magnetic MicroBeads</td>
			<td>Miltenyi Biotec</td>
			<td>130-048-801</td>
			<td></td>
		</tr>
		<tr>
			<td>Anti-APC conjugated magnetic MicroBeads</td>
			<td>Miltenyi Biotec</td>
			<td>130-090-855</td>
			<td></td>
		</tr>
		<tr>
			<td>MidiMACs or QuadroMACS separotor</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-302/130-090-976</td>
			<td></td>
		</tr>
		<tr>
			<td>LS Columns</td>
			<td>Miltenyi Biotec</td>
			<td>130-042-401</td>
			<td></td>
		</tr>
		<tr>
			<td>CD3 BV510 BD horizon</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>563109</td>
			<td>Used dilution 1:20</td>
		</tr>
		<tr>
			<td>CD19 FITC</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>345788</td>
			<td>Used dilution 1:20</td>
		</tr>
		<tr>
			<td>CD14 PerCPCy5.5</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>561116</td>
			<td>Used dilution 1:50</td>
		</tr>
		<tr>
			<td>CD16 PerCPCy5.5</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>338440</td>
			<td>Used dilution 1:50</td>
		</tr>
		<tr>
			<td>7AAD</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>51-68981E (559925)</td>
			<td>Used dilution 1:1000</td>
		</tr>
		<tr>
			<td>FACS ARIA III Cell Sorter Cytometer</td>
			<td>BD Biosciences</td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>8-strip PCR tubes</td>
			<td>Axygen</td>
			<td>321-10-061</td>
			<td></td>
		</tr>
		<tr>
			<td>Racks for 96 microtubes</td>
			<td>Dominique Dutscher</td>
			<td>45476</td>
			<td></td>
		</tr>
		<tr>
			<td>RNAseOUT Ribonuclease Inhibitor (recombinant)</td>
			<td>Invitrogen by thermoFisher scientific</td>
			<td>10777-019</td>
			<td>qty:5000U (40U/ul)</td>
		</tr>
		<tr>
			<td>Distilled Water Dnase/Rnase Free</td>
			<td>Gibco</td>
			<td>10977-035</td>
			<td></td>
		</tr>
		<tr>
			<td>Oligod(T)18 mRNA Primer</td>
			<td>New England BioLabs</td>
			<td>S1316S</td>
			<td>5.0 A260unit</td>
		</tr>
		<tr>
			<td>Random hexamers</td>
			<td>Invitrogen by thermoFisher scientific</td>
			<td>N8080127</td>
			<td>qty : 50uM, 5nmoles</td>
		</tr>
		<tr>
			<td>Superscript III Reverse transcriptase</td>
			<td>Invitrogen by thermoFisher scientific</td>
			<td>18080-044</td>
			<td>qty : 10000U (200U/ul)</td>
		</tr>
		<tr>
			<td>GoTaq G2 Flexi DNA polymerase</td>
			<td>Promega</td>
			<td>M7805</td>
			<td></td>
		</tr>
		<tr>
			<td>dNTP Set, Molecular biology grade</td>
			<td>Thermo Scientific</td>
			<td>R0182</td>
			<td>4*100umol</td>
		</tr>
		<tr>
			<td>5LVH1</td>
			<td>Eurofins</td>
			<td>ACAGGTGCCCACT 
			CCCAGGTGCAG</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers</td>
		</tr>
		<tr>
			<td>5LVH3</td>
			<td>Eurofins</td>
			<td>AAGGTGTCCAGTG 
			TGARGTGCAG</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers</td>
		</tr>
		<tr>
			<td>5LVL4_6</td>
			<td>Eurofins</td>
			<td>CCCAGATGGGTCC 
			TGTCCCAGGTGCAG</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers</td>
		</tr>
		<tr>
			<td>5LVH5</td>
			<td>Eurofins</td>
			<td>CAAGGAGTCTGTT 
			CCGAGGTGCAG</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers - Forward Prmers</td>
		</tr>
		<tr>
			<td>3HuIgG_const_anti</td>
			<td>Eurofins</td>
			<td>TCTTGTCCACCTT 
			GGTGTTGCT</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers -Reverse primers for human Ig- Bacteria PCR screening</td>
		</tr>
		<tr>
			<td>3CuCH1</td>
			<td>Eurofins</td>
			<td>GGGAATTCTCACA 
			GGAGACGA</td>
			<td>First round of PCR - Amplification of heavy chains - Outer primers -Reverse primers for human Ig</td>
		</tr>
		<tr>
			<td>5AgeIVH1_5_7</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			GAGGTGCAGCTGGTGCAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH3</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCT 
			GAGGTGCAGCTGGTGGAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH3_23</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCT 
			GAGGTGCAGCTGTTGGAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH4</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			CAGGTGCAGCTGCAGGAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH4_34</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			CAGGTGCAGCTACAGCAGTG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH1_18</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			CAGGTTCAGCTGGTGCAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH1_24</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			CAGGTCCAGCTGGTACAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH3__9_30_33</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCT 
			GAAGTGCAGCTGGTGGAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5AgeIVH6_1</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCC 
			CAGGTACAGCTGCAGCAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>3SalIJH1_2_4_5</td>
			<td>Eurofins</td>
			<td>TGCGAAGTCGACG 
			CTGAGGAGACGGTGACCAG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Reverse primers</td>
		</tr>
		<tr>
			<td>3SalIJH3</td>
			<td>Eurofins</td>
			<td>TGCGAAGTCGACG 
			CTGAAGAGACGGTGACCATTG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Reverse primers</td>
		</tr>
		<tr>
			<td>3SalIJH6</td>
			<td>Eurofins</td>
			<td>TGCGAAGTCGACG 
			CTGAGGAGACGGTGACCGTG</td>
			<td>Second round of PCR - Amplification of heavy chains - Inner primers -Reverse primers</td>
		</tr>
		<tr>
			<td>5&#39;LVk1_2</td>
			<td>Eurofins</td>
			<td>ATGAGGSTCCCYG 
			CTCAGCTGCTGG</td>
			<td>First round of PCR - Amplification of light chains k - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVk3</td>
			<td>Eurofins</td>
			<td>CTCTTCCTCCTGC 
			TACTCTGGCTCCCAG</td>
			<td>First round of PCR - Amplification of light chains k - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVk4</td>
			<td>Eurofins</td>
			<td>ATTTCTCTGTTGC 
			TCTGGATCTCTG</td>
			<td>First round of PCR - Amplification of light chains k - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>3&#39;Ck543_566</td>
			<td>Eurofins</td>
			<td>GTTTCTCGTAGTC 
			TGCTTTGCTCA</td>
			<td>First round of PCR - Amplification of light chains k - Outer primers -Reverse primers- Bacteria PCR screening</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVk1</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCT 
			GACATCCAGATGACCCAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVk1_9_1&#8211;13</td>
			<td>Eurofins</td>
			<td>TTGTGCTGCAACCGGTGTAC 
			ATTCAGACATCCAGTTGACCCAGTCT</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVk1D_43_1_8</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTGT 
			GCCATCCGGATGACCCAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVk2</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATGGG 
			GATATTGTGATGACCCAGAC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVk2_28_2_30</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATGGG 
			GATATTGTGATGACTCAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeVk3_11_3D_11</td>
			<td>Eurofins</td>
			<td>TTGTGCTGCAACCGGTGTAC 
			ATTCAGAAATTGTGTTGACACAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeVk3_15_3D_15</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCA 
			GAAATAGTGATGACGCAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeVk3_20_3D_20</td>
			<td>Eurofins</td>
			<td>TTGTGCTGCAACCGGTGTAC 
			ATTCAGAAATTGTGTTGACGCAGTCT</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeVk4_1</td>
			<td>Eurofins</td>
			<td>CTGCAACCGGTGTACATTCG 
			GACATCGTGATGACCCAGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>3&#39;BsiWIJk1_2_4</td>
			<td>Eurofins</td>
			<td>GCCACCGTACGTT 
			TGATYTCCACCTTGGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>3&#39;BsiWIJk3</td>
			<td>Eurofins</td>
			<td>GCCACCGTACGTT 
			TGATATCCACTTTGGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>3&#39;BsiWIJk5</td>
			<td>Eurofins</td>
			<td>GCCACCGTACGTT 
			TAATCTCCAGTCGTGTC</td>
			<td>Second round of PCR - Amplification of light chains k - Inner primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl1</td>
			<td>Eurofins</td>
			<td>GGTCCTGGGCCCA 
			GTCTGTGCTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl2</td>
			<td>Eurofins</td>
			<td>GGTCCTGGGCCCA 
			GTCTGCCCTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl3</td>
			<td>Eurofins</td>
			<td>GCTCTGTGACCTC 
			CTATGAGCTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl4_5</td>
			<td>Eurofins</td>
			<td>GGTCTCTCTCSCA 
			GCYTGTGCTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl6</td>
			<td>Eurofins</td>
			<td>GTTCTTGGGCCAA 
			TTTTATGCTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;LVl7</td>
			<td>Eurofins</td>
			<td>GGTCCAATTCYCA 
			GGCTGTGGTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5LVl8</td>
			<td>Eurofins</td>
			<td>GAGTGGATTCTCA 
			GACTGTGGTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>3&#39;Cl</td>
			<td>Eurofins</td>
			<td>CACCAGTGTGGCC 
			TTGTTGGCTTG</td>
			<td>First round of PCR - Amplification of light chains &#955; - Outer primers -Forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl1</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCCTGGGCC 
			CAGTCTGTGCTGACKCAG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl2</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCCTGGGCC 
			CAGTCTGCCCTGACTCAG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl3</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCTGTGACC 
			TCCTATGAGCTGACWCAG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl4_5</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCTCTCTCS 
			CAGCYTGTGCTGACTCA</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl6</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCTTGGGCC 
			AATTTTATGCTGACTCAG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>5&#39;AgeIVl8</td>
			<td>Eurofins</td>
			<td>CTGCTACCGGTTCCAATTCY 
			CAGRCTGTGGTGACYCAG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -forward primers</td>
		</tr>
		<tr>
			<td>3&#39;XhoICl</td>
			<td>Eurofins</td>
			<td>CTCCTCACTCGAG 
			GGYGGGAACAGAGTG</td>
			<td>Second round of PCR - Amplification of light chains &#955; - Inner primers -Reverse primers - Bacteria PCR screening</td>
		</tr>
		<tr>
			<td>Ab-vec-sense</td>
			<td>Eurofins</td>
			<td>GCTTCGTTAGAAC 
			GCGGCTAC</td>
			<td>Bacteria PCR screening</td>
		</tr>
		<tr>
			<td>QA Agarose-TM, Molecular Biology Grade</td>
			<td>MP Bio</td>
			<td>AGAH0500</td>
			<td></td>
		</tr>
		<tr>
			<td>NucleoFast 96 PCR Plate</td>
			<td>Macherey Nagel</td>
			<td>743.100.100</td>
			<td></td>
		</tr>
		<tr>
			<td>Enzyme Age I HF</td>
			<td>New England Biolabs</td>
			<td>R3552L</td>
			<td>20000U/ml</td>
		</tr>
		<tr>
			<td>Enzyme SalI HF</td>
			<td>New England Biolabs</td>
			<td>R3138L</td>
			<td>20000U/ml</td>
		</tr>
		<tr>
			<td>Enzyme Xho I</td>
			<td>New England Biolabs</td>
			<td>R0146L</td>
			<td>20000U/ml</td>
		</tr>
		<tr>
			<td>Enzyme BSIWI</td>
			<td>New England Biolabs</td>
			<td>R0553L</td>
			<td>10000U/ml</td>
		</tr>
		<tr>
			<td>HCg1 (Genbank accession number FJ475055)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>LCk (Genbank accession number FJ475056 )</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>LCl (Genbank accession number FJ517647)</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>T4 DNA ligase</td>
			<td>Invitrogen by thermoFisher scientific</td>
			<td>15224.017</td>
			<td>100U (1U/ul)</td>
		</tr>
		<tr>
			<td>2X YT medium</td>
			<td>Sigma Aldrich</td>
			<td>Y1003-500ML</td>
			<td></td>
		</tr>
		<tr>
			<td>Ampicillin</td>
			<td>Sigma Aldrich</td>
			<td>10835242001</td>
			<td></td>
		</tr>
		<tr>
			<td>LB (Luria Bertani) Broth (Lennox)</td>
			<td>Sigma Aldrich</td>
			<td>L3022-250G</td>
			<td></td>
		</tr>
		<tr>
			<td>Nucleospin Plasmid DNA, RNA and protein purification</td>
			<td>Macherey Nagel</td>
			<td>740588.250</td>
			<td></td>
		</tr>
		<tr>
			<td>Jet PEI DNA transfection reagent</td>
			<td>PolyPlus</td>
			<td>101-40</td>
			<td></td>
		</tr>
		<tr>
			<td>Flat bottom96-well plate</td>
			<td>Falcon</td>
			<td>353072</td>
			<td></td>
		</tr>
		<tr>
			<td>V-bottom 96-well plate</td>
			<td>Nunc/Thermofisher</td>
			<td>055142</td>
			<td></td>
		</tr>
		<tr>
			<td>Nunc easy 175 cm2 flasks</td>
			<td>Nunc/Thermofisher</td>
			<td>12-562-000</td>
			<td></td>
		</tr>
		<tr>
			<td>ELISA/ELISPOT coating buffer</td>
			<td>eBiosciences</td>
			<td>00-0044-59</td>
			<td></td>
		</tr>
		<tr>
			<td>Nunc maxisorp flat bottom 96 well ELISA plates</td>
			<td>Nunc/Thermofisher</td>
			<td>44-2404-21</td>
			<td>high protein binding</td>
		</tr>
		<tr>
			<td>Anti-human IgG Ab conjugated to horseradish peroxidase (HRP)</td>
			<td>BD Pharmingen / BD Biosciences</td>
			<td>55788</td>
			<td></td>
		</tr>
		<tr>
			<td>TMB substrate</td>
			<td>BD Biosciences</td>
			<td>555214</td>
			<td></td>
		</tr>
		<tr>
			<td>Streptavidin</td>
			<td>Sigma</td>
			<td>S0677</td>
			<td></td>
		</tr>
		<tr>
			<td>1 mL-HiTrap protein A HP column</td>
			<td>GE Healthcare</td>
			<td>17-0402-01</td>
			<td></td>
		</tr>
		<tr>
			<td>&#196;KTA FPLC</td>
			<td>GE Healthcare</td>
			<td>18190026</td>
			<td></td>
		</tr>
		<tr>
			<td>Superdex 200 10/300 GL column</td>
			<td>GE Healthcare</td>
			<td>17517501</td>
			<td></td>
		</tr>
		<tr>
			<td>NGC Quest 10 Plus Chromatography System</td>
			<td>BioRad</td>
			<td>7880003</td>
			<td></td>
		</tr>
	</tbody>
</table>

generation of discriminative human monoclonal antibodies from rare antigen-specific b cells circulating in blood

Monoclonal antibodies (mAbs) are powerful tools useful for both fundamental research and in biomedicine. Their high specificity is indispensable when the antibody needs to distinguish between highly related structures (e.g., a normal protein and a mutated version thereof). The current way of generating such discriminative mAbs involves extensive screening of multiple Ab-producing B cells, which is both costly and time consuming. We propose here a rapid and cost-effective method for the generation of discriminative, fully human mAbs starting from human blood circulating B lymphocytes. The originality of this strategy is due to the selection of specific antigen binding B cells combined with the counter-selection of all other cells, using readily available Peripheral Blood Mononuclear Cells (PBMC). Once specific B cells are isolated, cDNA (complementary deoxyribonucleic acid) sequences coding for the corresponding mAb are obtained using single cell Reverse Transcription-Polymerase Chain Reaction (RT-PCR) technology and subsequently expressed in human cells. Within as little as 1 month, it is possible to produce milligrams of highly discriminative human mAbs directed against virtually any desired antigen naturally detected by the B cell repertoire.

Starting from PBMC from healthy donors, this project presents the generation of human mAbs, which recognize the peptide Pp65495 (Pp65, from human cytomegalovirus) presented by the major histocompatibility complex class I (MHC-I) molecule HLA-A*0201 (HLA-A2). These mAbs can discriminate between this complex and complexes representing other peptides loaded onto the same MHC-I molecule.
PBMC were stained with HLA-A2/Pp65...

Watch this Scientific Journal Video about Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood at JoVE.com

Generation of Discriminative Human Monoclonal Antibodies from Rare Antigen-specific B Cells Circulating in Blood

We describe a method for the production of human antibodies specific for an antigen of interest, starting from rare B cells circulating in human blood. Generation of these natural antibodies is efficient and rapid, and the antibodies obtained can discriminate between highly related antigens.

Monoclonal antibodies (mAbs) are powerful tools useful for both fundamental research and in biomedicine. Their high specificity is indispensable when the ...

The overall goal of this procedure is to produce fully human monoclonal antibodies against a desired antigen starting from human B lymphocytes circulating in the blood. This protocol allows the generation of monoclonal antibodies that can discriminate between highly related antigens. For some applications such as immunotherapy, precise targeting of an antigen can be indispensable.The advantages of this technique are that this can be performed starting from the blood of healthy or immunized donors and allows the isolation of even rare antigen-binding B cells. While this method is described starting from human samples, it can also be applied to animals that can be pre-immunized. Visual demonstration of this method is critical as the procedure really is under quite complex multiple analytic gating strategy of discriminated B lymphocytes.The procedure will be performed by Melinda. She is an assistant engineer from our laboratory. First pipette 35 milliliters of diluted cell suspension on 15 milliliters of density gradient in a 50 milliliter conical tube.Then place the conical tube in a swing bucket rotor with brakes off and centrifuge at 1290 times gravity for 25 minutes at room temperature. Next, at the interface of the density gradient medium and plasma layer, carefully aspirate the mononuclear cell layer and transfer it to a new 50 milliliter conical tube. Add the cell suspension to a 15 milliliter conical tube and centrifuge at 460 times gravity for five minutes.Then, resuspend the pellet in 200 microliters of phosphate buffered saline with 2%fetal bovine serum. Add conjugated tetramers to a final concentration of 10 micrograms per milliliter. Mix well and then incubate at room temperature for 30 minutes in the Laminar flow hood, protected from the light.Then add 10 milliliters of ice cold cell separation buffer to the cell suspension. Centrifuge the cell suspension at 460 times gravity for five minutes. To the cell pellet obtained, add 500 microliters of ice cold cell separation buffer and 50 microliters of two variants of magnetic microbeads and incubate the cell suspension for 20 minutes.Next, resuspend the cell pellet in ice cold cell separation buffer. Carefully transfer the cell suspension on the top of an equilibrated column and let it drain completely. Then rinse the tube with three milliliters of cell separation buffer and transfer the buffer to the column.After rinsing the column three times, remove it from the magnet and place on a 25 milliliter conical collecting tube. After adding five milliliters of ice cold separation buffer on top of the column, quickly flush the cells from the column with the help of a plunger. Resuspend the cell pellet with a cocktail of anti-human antibodies and 7AAD in a total volume of 100 microliters of phosphate buffered saline with 2%fetal bovine serum.Then, incubate the cells at four degrees Celsius for 30 minutes. Next, use a cell sorter cytometer to sort specific B cells at the single cell level not exceeding beyond on 1, 000 events per second. Then, collect the single sorted B cells into 8-strip PCR tubes previously filled with 10 microliters of 1X phosphate buffered saline and 10 units of RNAse inhibitor and place on a rack for 96 microtubes.Quickly freeze the tubes at negative 80 degrees Celsius. Heat the frozen samples in a dry bath maintained at 70 degrees Celsius for five minutes to lyse the cells. Then place the strip on ice and start constituting the reverse transcription master-mix.Once the reverse transcription master-mix is prepared, program instruct thermocycler. At the end of the reverse transcription, perform nested PCRs to amplify immunoglobulin genes. Identify the positive clones by visualizing on a 1.5%agarose gel the migration of a 500 base pair PCR product for variable heavy chain and coding segments and 350 base pair PCR product for variable light chain encoding segments.Add one microliter of the cloning product to 45 microliters of electrocompetent TOP10 E.coli cells.Electroporate. Then quickly add 500 microliters of 2X YT medium to the cells and incubate in a water bath at 37 degrees Celsius for 30 minutes. Spread the transformed bacteria on 2X YT ampicillin plate.Then, incubate the plates overnight at 37 degrees Celsius. Next, setup a reaction premix and add 25 microliters of it in per 8-strip PCR tube kept on ice. Then, use a sterile toothpick to pick colonies and streak the colonies on the 2X YT ampicillin plate.Then, dip the toothpicks in the PCR reaction tube. Identify the positive clones by visualizing on a 1.5%agarose gel the migration of an 850 base pair PCR product for the heavy chain vector and a 600 base pair PCR product for the light chain vector. In two milliliters of LB medium, inoculate four positive colonies.Incubate the inoculate at 37 degrees Celsius overnight at 200 revolutions per minute shaking. Seed 15, 000 human embryonic kidney cells in 200 microliters of Dulbecco's Modified Eagle Medium supplemented with 10%fetal bovine serum in each well of a flat bottom 96 well plate a day before the transfection. Then incubate the plate at 37 degrees Celsius overnight at 5%carbon dioxide.Cotransfect the cells using a linear polyethylenimine derivative transfection reagent. Dilute 0.5 microliters of DNA transfection reagent with 10 microliters of 150 millimolar of sodium chloride. Next, dilute 0.125 microgram of each variable heavy and light chain expressing vectors in 10 microliters of 150 millimolar sodium chloride.Vortex all the dilutions for 10 seconds each. Then, mix the previously diluted DNA transfection reagent with 10 microliters of DNA solution. Quickly vortex the DNA transfection mixture for 15 seconds and incubate for 15 minutes at room temperature.Add the DNA transfection mixture drop-wise on the cells and then gently swirl the plate. Replace the medium 16 hours after transfection and culture the cells for five days in serum-free medium at 37 degrees Celsius. Next, use a multichannel pipette, to aspirate the supernatant, and transfer it into the v-bottom 96 well plate.Coat each well in a 96 well ELISA plate with relevant antigen at four degrees Celsius for overnight in 100 microliters of reconstituted ELISA coating buffer at a final concentration of two micrograms per milliliter. Next add 50 microliters of a transfected cell supernatant to the wells of a 96 well ELISA plate and incubate the plate for two hours at room temperature. Then add 100 microliters of antihuman immunoglobulin G antibody conjugated to horseradish peroxidase enzyme at one microgram per milliliter concentration and incubate the well at room temperature for one hour.Finally, add 50 microliters of chromogenic substrate to the well and incubate for another 20 minutes. At the end of incubation, read the optical density at 450 nanometers on a spectrophotometer. To isolate the specific B cells a gating strategy was used that discriminated the B cells expressing receptors against the HLA-A2/Pp65 complex.Initially, the cells were CD19 positive, CD3 negative gated. Finally, cells were stained with both HLA-A2/Pp65PE and HLA-A2/Pp65APC, but not HLA-A2/MelABV421 tetramers, were gated to obtain the highly specific B cells. Using this gating strategy, selective B cells can be isolated, which can differentiate between HLA-A2/Pp65 and other related HLA-A2 peptide complex.Next, to study the presence of PC1.02 antibody against HLA-A2/Pp65 tetramer an ELISA assay was performed. In the bar plot obtained, the y-axis corresponds to the optimal density readings and the x-axis correspond to the HLA-A2 peptides. From the assay, it shows that a monoclonal antibody binds with HLA-A2/Pp65 tetramer in a peptide and major histocompatibility complex dependent manner.Next, surface plasmin residence was used to study the binding affinity of the PC1.02 antibody. Then, a tabular data was obtained to analyze the HLA-A2/Pp65 specific B cells. The impact of the exclusion strategy of unspecific B cells, the yields of immunoglobulin gene amplification, and monoclonal antibody production from HLA-A2/Pp65 specific B cells have been shown.Once mastered, the technique ranging from isolation of antigens specific B cells from human blood to monoclonal antibody production can be done in as little as one month. When performing this procedure, remember go straight from sorting of B cells to RT-PCR without pausing.

Research

JoVE Journal

Immunology and Infection

Isolation of Precursor B-cell Subsets from Umbilical Cord Blood

Umbilical cord blood is highly enriched for hematopoietic progenitor cells at different lineage commitment stages. We have developed a protocol for ...

Killer Artificial Antigen Presenting Cells (KaAPC) for Efficient In Vitro Depletion of Human Antigen-specific T Cells

Killer Artificial Antigen Presenting Cells KaAPC for Efficient In Vitro Depletion of Human Antigen-specific T Cells

Current treatment of T cell mediated autoimmune diseases relies mostly on strategies of global immunosuppression, which, in the long term, is accompanied ...

Generation of Human Alloantigen-specific T Cells from Peripheral Blood

The study of human T lymphocyte biology often involves examination of responses to activating ligands. T cells recognize and respond to processed peptide ...

Generation of Recombinant Human IgG Monoclonal Antibodies from Immortalized Sorted B Cells

Finding new methods for generating human monoclonal antibodies is an active research field that is important for both basic and applied sciences, ...

Generation of Murine Monoclonal Antibodies by Hybridoma Technology

Monoclonal antibodies are universal binding molecules and are widely used in biomedicine and research. Nevertheless, the generation of these binding ...

Generation of Human Monocyte-derived Dendritic Cells from Whole Blood

Dendritic cells (DCs) recognize foreign structures of different pathogens, such as viruses, bacteria, and fungi, via a variety of pattern recognition ...

Dextran Enhances the Lentiviral Transduction Efficiency of Murine and Human Primary NK Cells

The efficient transduction of specific genes into natural killer (NK) cells has been a major challenge. Successful transductions are critical to defining ...

Detection and Enrichment of Rare Antigen-specific B Cells for Analysis of Phenotype and Function

B cells reactive with a specific antigen usually occur at a frequency of &lt;0.05% of lymphocytes. For decades researchers have sought methods to isolate ...

Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies

Influenza viruses exhibit a remarkable ability to adapt and evade the host immune response. One way is through antigenic changes that occur on the surface ...

Generation of Monoclonal Antibodies Against Natural Products

The analysis of the bioactive components present in foods and natural products has become a popular area of study in many fields, including traditional ...