Name: injections of lipopolysaccharide into mice to mimic entrance of microbial-derived products after intestinal barrier breach
Uploaded: 2018-05-02T15:00:00.000+00:00
Duration: 8 min 24 s
Description: Watch this Scientific Journal Video about Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach at JoVE.com

JHN is supported by the Swiss National Foundation (SNSF 310030_146290).

Mice were bred and kept under specific pathogen-free (SPF) conditions in the animal facility of Department of Biomedicine, University of Basel (Basel, Switzerland). All mouse experiments were performed in accordance with the Swiss Federal and Cantonal regulations (animal protocol number 2816 [Canton of Basel-Stadt]).
1. Preparation of LPS Solution
<ol>
	<li>Open the stock of LPS purified from Escherichia coli 0111:B4 under sterile conditions and reconstitute it in water to the concentration of 5 mg/mL.</li>
	<li>Dilute the LPS stock with the sterile phosphate buffered saline (PBS) to the working concentration of 0.2 &#181;g/&#181;L.</li>
</ol>
2. Intraperitoneal Injection of LPS to Mice
<ol>
	<li>Aspirate the LPS working solution in a 0.5 mL syringe with a 30 G needle in a laminar air flow.</li>
	<li>Weigh female C57Bl/6 mice (six to 10 weeks of age) and calculate the amount of LPS that will be injected: 10 &#181;L (2 &#181;g)/g body weight. 
	NOTE: For example, if a mouse weighs 20 g, then 20 g x 10 &#181;L = 200 &#181;L LPS working solution needs to be injected.</li>
	<li>Handle the mouse gently but firmly and restrain the animal in one hand. Ensure that the animal is able to breathe normally but not to twist and turn during the restraint.</li>
	<li>Tilt the mouse nose slightly towards the floor to expose the abdomen for injection. Locate the midline of the abdomen and the injection place in the low abdomen left or right from the midline. Inject i.p. PBS instead of LPS into control mice.</li>
	<li>With the free hand, inject the appropriate volume (the volume calculated in step 2.2) of the LPS working solution. Make sure that the needle has entered the peritoneal cavity as otherwise, mis-injections into the abdominal muscle layer may occur. Still, do not go too deep with the needle into the peritoneal cavity to avoid injuring inner organs located in that area.</li>
	<li>Return the animal carefully to the cage with up to 5 mice per cage.</li>
</ol>
3. Monitor the Mice
<ol>
	<li>Monitor the animals at the time of injection and every 2 h after the injection for 8 h for the occurrence and severity of endotoxemia. Therefore, use a score sheet (Table 1) that has been adapted from a previously published manuscript 24.</li>
	<li>Score the LPS injected mice for the following parameters listed in Table 1
	<ol>
		<li>Check for the appearance of the fur which is normally smooth. If the fur appears ruffled, spiky or puffy fur which indicates discomfort and/or pain, score them as 1, 2, or 3.</li>
		<li>Check for the activity of the mouse. 
		NOTE: Mice normally move freely around the whole cage eating, drinking, climbing, but suppressed or restricted activity could be a sign of pain.</li>
		<li>Check for the level of consciousness. 
		NOTE: Mice are very curious, and they normally move around the cage investigating the surrounding. Lack of or reduced movement can suggest pain and discomfort.</li>
		<li>Check the eyes. 
		NOTE: Fully open eyes are expected in healthy mice, but partially or fully closed eyes, possibly with secretion, can be an indication of pain.</li>
		<li>Check for the respiration rate. 
		NOTE: Healthy mice usually have a normal and rapid respiration rate, a reduced respiration rate could be an indication of discomfort).</li>
		<li>Check for the respiration quality. 
		NOTE: Labored breathing with or without gasping is a sign of pain.</li>
	</ol>
	</li>
</ol>
4. Tissue Sampling for Ribonucleic Acid (RNA) Extraction and Homogenization
<ol>
	<li>Prepare the collection/homogenization tubes: Add 1 mL single-step RNA isolation reagent to 2 mL tubes prefilled with 1.4 mm ceramic spheres.</li>
	<li>At the appropriate time points (before (0 h) and 2 h, 4 h and 8 h after LPS injection) euthanize the mouse with anesthetic overdose (isoflurane) followed by exsanguination and proceed with the dissection.</li>
	<li>Cut the skin and the muscle layer exposing the abdominal cavity with the inner organs with a pair of scissors.</li>
	<li>Carefully dissect the spleen, liver, and colon, clean the organs from fat and keep them in PBS on ice.</li>
	<li>Cut out a small piece (about 0.5 cm long) from each organ using scissors or scalpel. 
	NOTE: It is important to always take the piece from approximately the same part of the organ in each mouse (same lobe of liver, proximal or distal part of the colon).</li>
	<li>Shortly dry the tissue on a piece of paper tissue and place it in the collection/homogenization tube making sure that it is completely immersed in RNA isolation reagent.</li>
	<li>Homogenize the tissue in a high-speed benchtop homogenizer. For soft tissues like spleen, liver, and colon use 1 cycle of homogenization at speed 6.00 for 30 s.</li>
	<li>Incubate the samples for 5 min at room temperature.</li>
	<li>Carefully place the tube in the liquid nitrogen to snap freeze the tissue lysate. Store the snap frozen lysate at -80 &#176;C until the RNA isolation.</li>
</ol>
5. RNA Extraction from Tissue
NOTE: RNA isolation reagents, chloroform, and alcohols are considered as hazardous material. Perform RNA extraction under a chemical hood. Use certified RNase-free reagents and equipment to maintain an RNase-free environment.
<ol>
	<li>Phase separation
	<ol>
		<li>Thaw the frozen tissue lysate on ice.</li>
		<li>Centrifuge the sample on 1,000 x g for 5 min at 4 &#176;C to pellet the remaining tissue particles that might be left.</li>
		<li>Transfer the supernatant to a new nuclease-free 1.5 mL tube.</li>
		<li>Add 200 &#181;L ice-cold chloroform per 1 mL RNA isolation Reagent and shake vigorously by hand for 10-15 s.</li>
		<li>Incubate for 2-3 min at room temperature.</li>
		<li>Centrifuge at 12, 000 x g for 15 min at 4 &#176;C. 
		NOTE: The sample will now contain 3 phases: lower red phenol-chloroform phase, the interphase and the upper colorless aqueous phase. The RNA is present in the upper aqueous phase.</li>
		<li>Collect the upper aqueous phase ( 50% of total volume) and transfer into a new nuclease-free 1.5 mL tube.</li>
	</ol>
	</li>
	<li>RNA precipitation
	<ol>
		<li>Add 0.5 mL ice-cold isopropanol per 1 mL RNA isolation reagent and mix gently by inverting the tube 5-6 times.</li>
		<li>Incubate for 10-15 min at room temperature.</li>
		<li>Centrifuge at 12,000 x g for 10 min at 4 &#176;C. 
		NOTE: RNA pellet should be visible at this stage.</li>
	</ol>
	</li>
	<li>Washing of RNA pellet
	<ol>
		<li>Completely remove the supernatant containing the isopropanol without disturbing the pellet.</li>
		<li>Wash the pellet with 1 mL ice-cold 75% ethanol per 1 mL RNA isolation reagent used for the initial lysis.</li>
		<li>Vortex the sample briefly.</li>
		<li>Centrifuge the sample at 7,500 (or 12,000) x g for 5 min at 4 &#176;C.</li>
	</ol>
	</li>
	<li>Dissolving RNA
	<ol>
		<li>Completely remove the ethanol in the supernatant without disturbing the pellet.</li>
		<li>Leave the opened tube under the chemical hood for 3-5 min to air-dry the RNA pellet at room temperature (do not over-dry as in that case it will be difficult to dissolve RNA).</li>
		<li>Dissolve the RNA pellet in 20-50 &#181;L nuclease-free water by pipetting carefully up and down.</li>
		<li>Incubate the sample at 55 &#176;C for 10-15 min to further improve the solution of the RNA. 
		NOTE: At this stage, RNA can be stored at -80 &#176;C till further analysis.</li>
	</ol>
	</li>
</ol>
6. Digestion of Remaining DNA
<ol>
	<li>Measure the RNA concentration with a spectrophotometer by pipetting an aliquot (2 &#181;l) into the spectrophotometer and adjust to the recommended concentration.</li>
	<li>Start the digestion of contaminating DNA with max. 10 &#181;g RNA in 50 &#181;L nuclease-free water.</li>
	<li>Add 0.1 volume of 10x DNase I Buffer and 1 &#181;L rDNase I per sample and mix gently by pipetting up and down.</li>
	<li>Incubate at 37 &#176;C for 20-30 min.</li>
	<li>Vortex DNase Inactivation Reagent and add 0.1 volume to the sample mixing well with the pipette.</li>
	<li>Incubate for 5 min at room temperature mixing occasionally by hand.</li>
	<li>Centrifuge at 10,000 x g for 1.5 min.</li>
	<li>Transfer the supernatant containing DNA-free RNA into the new nuclease-free tube.</li>
	<li>Measure the RNA concentration and quality by spectrophotometer.</li>
</ol>
7. Reverse Transcription
<ol>
	<li>Use a commercially available Deoxyribonucleic acid cDNA reverse transcription (RT) kit for reverse transcription. 
	NOTE: Here, up to 2 &#181;g of RNA can be reversed transcribed.</li>
	<li>Calculate the volume, which contains 2 &#181;g RNA. Pipette 2 &#181;g RNA in a new PCR tube.</li>
	<li>Add nuclease-free water to the sample in the PCR tube to the final volume of 10 &#181;L.</li>
	<li>Prepare 2x Master Mix by mixing the following components listed in Table 2</li>
	<li>Add 10 &#181;L 2x Master Mix to 10 &#181;l RNA to obtain 1x Master Mix in the total volume of 20 &#181;L.</li>
	<li>Close the polymerase chain reaction (PCR) tube and spin down the sample briefly.</li>
	<li>Place the samples in a PCR Thermocycler and set the settings listed in Table 3.</li>
	<li>Store the generated cDNA at -20 &#176;C for further analysis.</li>
</ol>
8. Quantitative PCR (qPCR)
<ol>
	<li>Perform the qPCR reaction with a commercially available kit.</li>
	<li>Self-design and test the intron-spanning primers, before usage, with different concentrations of template cDNA. Analyze the efficacy of the primer by creating a standard curve and use the primers with high efficacy and correct melting curves. 
	NOTE: The sequences of primers used in this experiment are listed in Table 2.</li>
	<li>Prepare the quantitative polymerase chain reaction (qPCR) reaction in the 384-well plate with the reaction setup described in Table 4.</li>
	<li>Keep all solutions and the plate on ice using aluminum foil to prevent the plate getting wet when the reaction mixture is prepared.</li>
	<li>Perform all the reactions in triplicates.</li>
	<li>Carry out the PCR reaction on a thermocycler using the setting listed in Table 5.</li>
	<li>Calculate the average Ct value for all reactions from the triplicates. Normalize all target genes to the expression level of glycerinealdehyde-3-phosphate-dehydrogenase (Gapdh) housekeeping gene by calculating 2^(-&#916;Ct). 
	NOTE: All the target genes with the average Ct &#62;35 were considered to be under the detection limit.</li>
</ol>

<ol>
	<li>Backhed, F., Ley, R. E., Sonnenburg, J. L., Peterson, D. A., Gordon, J. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Host-bacterial+mutualism+in+the+human+intestine.">Host-bacterial mutualism in the human intestine.</a> Science. 307, 1915-1920 (2005).</li><li>Abreu, M. T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Mutations+in+NOD2+are+associated+with+fibrostenosing+disease+in+patients+with+Crohn's+disease.">Mutations in NOD2 are associated with fibrostenosing disease in patients with Crohn's disease.</a> Gastroenterology. 123, 679-688 (2002).</li><li>Liu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immunocytochemical+evidence+of+Listeria,+Escherichia+coli,+and+Streptococcus+antigens+in+Crohn's+disease.">Immunocytochemical evidence of Listeria, Escherichia coli, and Streptococcus antigens in Crohn's disease.</a> Gastroenterology. 108, 1396-1404 (1995).</li><li>Schaffer, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Anti-Saccharomyces+cerevisiae+mannan+antibodies+(ASCA)+of+Crohn's+patients+crossreact+with+mannan+from+other+yeast+strains,+and+murine+ASCA+IgM+can+be+experimentally+induced+with+Candida+albicans.">Anti-Saccharomyces cerevisiae mannan antibodies (ASCA) of Crohn's patients crossreact with mannan from other yeast strains, and murine ASCA IgM can be experimentally induced with Candida albicans.</a> Inflamm Bowel Dis. 13, 1339-1346 (2007).</li><li>Sellon, R. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Resident+enteric+bacteria+are+necessary+for+development+of+spontaneous+colitis+and+immune+system+activation+in+interleukin-10-deficient+mice.">Resident enteric bacteria are necessary for development of spontaneous colitis and immune system activation in interleukin-10-deficient mice.</a> Infect Immun. 66, 5224-5231 (1998).</li><li>Gkouskou, K. K., Deligianni, C., Tsatsanis, C., Eliopoulos, A. G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+gut+microbiota+in+mouse+models+of+inflammatory+bowel+disease.">The gut microbiota in mouse models of inflammatory bowel disease.</a> Front Cell Infect Microbiol. 4, 28 (2014).</li><li>Schaubeck, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Dysbiotic+gut+microbiota+causes+transmissible+Crohn's+disease-like+ileitis+independent+of+failure+in+antimicrobial+defence.">Dysbiotic gut microbiota causes transmissible Crohn's disease-like ileitis independent of failure in antimicrobial defence.</a> Gut. 65, 225-237 (2016).</li><li>Steinert, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Stimulation+of+Macrophages+with+TLR+Ligands+Supports+Increased+IL-19+Expression+in+Inflammatory+Bowel+Disease+Patients+and+in+Colitis+Models.">The Stimulation of Macrophages with TLR Ligands Supports Increased IL-19 Expression in Inflammatory Bowel Disease Patients and in Colitis Models.</a> J Immunol. 199, 2570-2584 (2017).</li><li>Gabele, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DSS+induced+colitis+increases+portal+LPS+levels+and+enhances+hepatic+inflammation+and+fibrogenesis+in+experimental+NASH.">DSS induced colitis increases portal LPS levels and enhances hepatic inflammation and fibrogenesis in experimental NASH.</a> J Hepatol. 55, 1391-1399 (2011).</li><li>Saunders, S. P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=C-type+lectin+SIGN-R1+has+a+role+in+experimental+colitis+and+responsiveness+to+lipopolysaccharide.">C-type lectin SIGN-R1 has a role in experimental colitis and responsiveness to lipopolysaccharide.</a> J Immunol. 184, 2627-2637 (2010).</li><li>Spadoni, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+gut-vascular+barrier+controls+the+systemic+dissemination+of+bacteria.">A gut-vascular barrier controls the systemic dissemination of bacteria.</a> Science. 350, 830-834 (2015).</li><li>Balmer, M. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+liver+may+act+as+a+firewall+mediating+mutualism+between+the+host+and+its+gut+commensal+microbiota.">The liver may act as a firewall mediating mutualism between the host and its gut commensal microbiota.</a> Sci Transl Med. 6, 237ra266 (2014).</li><li>Maier, R. V., Mathison, J. C., Ulevitch, R. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interactions+of+bacterial+lipopolysaccharides+with+tissue+macrophages+and+plasma+lipoproteins.">Interactions of bacterial lipopolysaccharides with tissue macrophages and plasma lipoproteins.</a> Prog Clin Biol Res. 62, 133-155 (1981).</li><li>Lu, Y. C., Yeh, W. C., Ohashi, P. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LPS/TLR4+signal+transduction+pathway.">LPS/TLR4 signal transduction pathway.</a> Cytokine. 42, 145-151 (2008).</li><li>Deng, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Lipopolysaccharide+clearance,+bacterial+clearance,+and+systemic+inflammatory+responses+are+regulated+by+cell+type-specific+functions+of+TLR4+during+sepsis.">Lipopolysaccharide clearance, bacterial clearance, and systemic inflammatory responses are regulated by cell type-specific functions of TLR4 during sepsis.</a> J Immunol. 190, 5152-5160 (2013).</li><li>Kagan, J. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=TRAM+couples+endocytosis+of+Toll-like+receptor+4+to+the+induction+of+interferon-beta.">TRAM couples endocytosis of Toll-like receptor 4 to the induction of interferon-beta.</a> Nat Immunol. 9, 361-368 (2008).</li><li>Akira, S., Uematsu, S., Takeuchi, O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathogen+recognition+and+innate+immunity.">Pathogen recognition and innate immunity.</a> Cell. 124, 783-801 (2006).</li><li>Cohen, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+immunopathogenesis+of+sepsis.">The immunopathogenesis of sepsis.</a> Nature. 420, 885-891 (2002).</li><li>Suffredini, A. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Effects+of+recombinant+dimeric+TNF+receptor+on+human+inflammatory+responses+following+intravenous+endotoxin+administration.">Effects of recombinant dimeric TNF receptor on human inflammatory responses following intravenous endotoxin administration.</a> J Immunol. 155, 5038-5045 (1995).</li><li>Fink, M. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Animal+models+of+sepsis.">Animal models of sepsis.</a> Virulence. 5, 143-153 (2014).</li><li>Poltorak, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Defective+LPS+signaling+in+C3H/HeJ+and+C57BL/10ScCr+mice:+mutations+in+Tlr4+gene.">Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene.</a> Science. 282, 2085-2088 (1998).</li><li>Hoshino, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cutting+edge:+Toll-like+receptor+4+(TLR4)-deficient+mice+are+hyporesponsive+to+lipopolysaccharide:+evidence+for+TLR4+as+the+Lps+gene+product.">Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product.</a> J Immunol. 162, 3749-3752 (1999).</li><li>Corral, J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Role+of+lipopolysaccharide+and+cecal+ligation+and+puncture+on+blood+coagulation+and+inflammation+in+sensitive+and+resistant+mice+models.">Role of lipopolysaccharide and cecal ligation and puncture on blood coagulation and inflammation in sensitive and resistant mice models.</a> Am J Pathol. 166, 1089-1098 (2005).</li><li>Shrum, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+robust+scoring+system+to+evaluate+sepsis+severity+in+an+animal+model.">A robust scoring system to evaluate sepsis severity in an animal model.</a> BMC Res Notes. 7, 233 (2014).</li><li>Brandwein, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneously+colitic+C3H/HeJBir+mice+demonstrate+selective+antibody+reactivity+to+antigens+of+the+enteric+bacterial+flora.">Spontaneously colitic C3H/HeJBir mice demonstrate selective antibody reactivity to antigens of the enteric bacterial flora.</a> J Immunol. 159, 44-52 (1997).</li><li>Macpherson, A. J., McCoy, K. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Standardised+animal+models+of+host+microbial+mutualism.">Standardised animal models of host microbial mutualism.</a> Mucosal Immunol. 8, 476-486 (2015).</li><li>Masopust, D., Sivula, C. P., Jameson, S. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Of+Mice,+Dirty+Mice,+and+Men:+Using+Mice+To+Understand+Human+Immunology.">Of Mice, Dirty Mice, and Men: Using Mice To Understand Human Immunology.</a> J Immunol. 199, 383-388 (2017).</li><li>Wirtz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Protection+from+lethal+septic+peritonitis+by+neutralizing+the+biological+function+of+interleukin+27.">Protection from lethal septic peritonitis by neutralizing the biological function of interleukin 27.</a> J Exp Med. 203, 1875-1881 (2006).</li></ol>

The authors have nothing to disclose.

This protocol mimics immunological processes that occur after the invasion by microbial-derived products. Critical steps within the protocol are the selection of the mouse line, the hygiene status of the mice, the dose of LPS, the monitoring of the animals for the occurrence of endotoxemia, and the time point of experiment termination. Most importantly, the genetic background of the mouse strain has to be considered. Different mouse strains have different susceptibility to LPS. For example, the C3H/HeJ and C57BL/10ScCr mice are resistant to LPS induced endotoxemia21,25. Furthermore, the hygiene status of the animals may influence the course of endotoxemia in LPS. Specific-pathogen-free (SPF) animals are most commonly used. These mice are free from a defined list of pathogens, but the complete microbiota composition of these animals is not known26,27. Sterile germ-free or axenic animals (that do not harbor a microbiota) are distinct from SPF mice26. Likely, the colonization of axenic animals with one microorganism or with a consortium of microorganisms (gnotobiotic animals) may influence the expression of genes, such as IL-19, after LPS injection compared to SPF animals8. Moreover, a score sheet has been suggested that was used as a score sheet for a sepsis model induced by injecting the fecal solution into the peritoneal cavity24. This sheetcan be discussed with the local animal welfare committee and may be adapted to the local needs. In particular, the criteria for termination needs to be discussed with the local animal welfare committee. This experiment had to be stopped when a score &#62; 12 is achieved or when the maximum score for one individual parameter is reached. In this experiment, no animal out of eight animals exceeded a disease score of 12 after injection of LPS (2 &#181;g/g body weight). In this study, results showing the expression of the cytokines Il6, Il1b, TNFa and Il10 in the liver, spleen and colon after injection of LPS are presented. The expression of Il1b, TNFa and Il10 peaked 4 h after LPS injection in spleen, liver, and colon, whereas, Il6 expression peaked 2 h after LPS injection in spleen and colon and 4 h after LPS injection in the liver. Within 8 h the expression Il6, Il1b, TNFa and Il10 returned to baseline levels in spleen, liver and colon. Disease severity peaked between 6 h and 10 h after LPS injection when the expression of Il6, Il1b, TNFa and Il10 have returned already to the baseline levels indicating that increased expression of Il6, Il1b, TNFa and Il10 occurs rapidly after LPS injection, but that the kinetics of other genes may show a different pattern after LPS injection. The expression of these cytokines could also be analyzed on the protein level in the blood of the animals by ELISA, which can be considered in addition to qPCR.
Modifications and troubleshooting of the technique are necessary in cases when a disease score &#62; 12 is reached. Therefore, the dose of LPS has to be reduced and better adjusted to the used mouse line and the local conditions to avoid premature termination of the experiment. The manipulation of genes by deleting a given genomic region or overexpressing a gene may influence the susceptibility of mice to LPS. In preliminary experiments, the dose of LPS may be titrated to the appropriate dose to avoid unnecessary harm and death to the animals in this experiment. Of note, contamination of LPS with other bacterial-derived products and mis-injections have to be avoided. Furthermore, the kinetics of the expression of genes of interest after LPS injection needs to be determined.
Limitations are that this technique provides information on the consequences of the dissemination of microbial products into the host after an intestinal barrier breach but will not give information on events that lead to intestinal barrier breach and to causes that trigger IBD. Of course, this model is not a colitis model as the DSS colitis model, but it can be useful in addition to colitis models to study the consequence of the entrance of microbial products into the host. Furthermore, the i.p. injection of LPS will disrupt the peritoneal cavity, in which the small and the large intestines are located. This may facilitate the translocation of intestinal-derived bacterial products from the peritoneal cavity into the host.
The significance of this model is the fact it uses a defined PAMP. In other models including the i.p. injection of entire bacteria, the i.p. injection of fecal solutions24 or the septic peritonitis models, in which peritonitis is induced by cecal ligation and puncture28, a vast array of microbes or their products induces disease. Furthermore, injection of LPS into mice is an uncomplicated approach and does not require surgery as in septic peritonitis induced by cecal ligation and puncture.
Further application of this model are studies that aim to investigate endotoxemia or LPS induced septicemia in any contexts characterized by the translocation of bacteria-derived products into the host, such as breach of the skin barrier or breached of the urogenital tract. In conclusion, this is a straightforward model that can be used in every laboratory setting. Depending on the local conditions, there might be adaptations to the local needs necessary. In particular, the score sheet has to be discussed with the local authorities before the experiment is performed. This approach was used to mimic consequences for the host when bacteria or bacterial-derived products enter the host after a barrier breach has occurred. This may be in particular relevant in studies examining the basis of IBD where the occurrence of an intestinal barrier breach is a common event in the pathology of the disease.

An erratum was issued for: <a href="https://www.jove.com/video/57610/injections-lipopolysaccharide-into-mice-to-mimic-entrance-microbial">Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach</a>
One of the authors&#39; names was corrected from:
Katarina Raduolovic
to:
Katarina Radulovic

An erratum was issued for: <a href="https://www.jove.com/video/57610/injections-lipopolysaccharide-into-mice-to-mimic-entrance-microbial">Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach</a>.&#160;An author name was updated.

Erratum: Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach

The human intestine is colonized with a large consortium of microorganisms that forms the microbiota, who has developed a mutually beneficial relationship with the host during the evolution. In this relationship, the host provides a secure niche for the microbiota, whereas the microbiota provides vitamins, nutrient digestion and protection from pathogens to the host, where the microbiota resides1. When this beneficial relationship between the host and the microbiota is disturbed, diseases can develop, such as inflammatory bowel disease (IBD). IBD is a multifactorial chronic inflammatory disease of the intestine caused by genetic and environmental factors that occur in two major forms, Crohn&#39;s disease (CD) and ulcerative colitis (UC). Despite similarities between the two IBD forms, they are characterized by certain differences in the location and nature of inflammatory modifications. CD is a relapsing transmural inflammatory disorder that can potentially extend to any part of the gastrointestinal tract, while UC is non-transmural and is restricted to the colon. Furthermore, mutations in Nucleotide-binding oligomerization domain-containing protein 2 (NOD2), a pattern recognition receptor (PRR) that recognizes muramyl dipeptide (MDP), a component of the cell wall of most Gram-positive and - negative bacteria, is associated with CD2. Furthermore, Escherichia coli (E. coli), Listeria and Streptococci and their products were all found within macrophages in CD patients that have entered the host after a barrier breach3. When bacteria or their products enter the host during the development of CD, the immune system develops a response leading to the production of circulating anti-bacterial antibodies4. Maybe, the most convincing evidence for the role of the microbiota in the pathogenesis of IBD stems from mouse models. When animals are treated with antibiotics, or when mice are kept in germ-free (GF) conditions, the severity of the disease is reduced in most colitis models, such as in IL-10-/- mice that do not develop colitis in GF facilities5,6. Furthermore, colitis also disturbs the composition of the microbiota, which is characterized by an imbalanced composition and reduced richness called dysbiosis7. The consequence of IBD can be an increased intestinal permeability that can lead to the entrance of microbes and microbial-derived products into the host.
In animals, the application of Dextran Sodium Sulfate (DSS) induces an intestinal epithelial breach leading to an increased permeability of the epithelial barrier8. Portal LPS concentrations are elevated in animals with DSS colitis9. Interestingly, animals lacking the C type lectin receptor specific intracellular adhesion molecule-3 grabbing nonintegrin homolog-related 1 (SIGN-R1) are protected from DSS colitis and LPS-induced endotoxemia10. To further disseminate into the host, bacteria or bacteria derived products have to pass the vascular barrier11, the peritoneal cavity, in which the small and large intestine is located, the mesenteric lymph nodes and/or the liver12. To reduce the complexity of this system, a defined bacterial-derived compound was used. LPS, which causes endotoxemia after intraperitoneal (i.p.) or intravenous (i.v.) injection13 was injected into mice, to study the expression of the interleukins Il6 and Ilb and the cytokine Tnfa in response to LPS.
LPS is a pathogen-associated molecular pattern (PAMP) expressed as a cell-wall component of Gram-negative bacteria, that consists of lipid A (the main PAMP in the structure of LPS), a core oligosaccharide and an O side chain14. Toll-like receptor 4 (TLR4) expressed by dendritic cells, macrophages, and epithelial cells recognizes LPS15, that requires co-receptors for appropriate binding. The acute phase protein LPS-binding protein (LBP) binds LPS to form a complex that transfers LPS to the cluster of differentiation 14 (CD14), a glycosylphosphatidylinositol-anchored membrane protein. CD14 further shuttles LPS to Lymphocyte antigen 96 or also known as MD-2, which is associated with the extracellular domain of TLR4. The binding of LPS to MD-2 facilitates the dimerization of TLR4/MD-2 to induce conformational changes to recruit intracellular adaptor molecules to activate the downstream signaling pathway14, which includes the myeloid differentiation primary response gene 88 (MyD88)-dependent pathway and the TIR domain-containing adaptor-inducing interferon-&#946; (TRIF)-dependent pathway16. The recognition of LPS by TLR4 then activates the NF-&#954;B pathway and induces the expression of proinflammatory cytokines, such as TNF&#945;, IL-6, and IL-1&#946;17.
In particular, when LPS is injected into animals, the concentration of LPS given to the animals, the genetic background of the animal and the diet has to be considered. High concentrations of LPS leads to a septic shock, characterized by hypotension and multiple organ failures, and finally to death18. Mice are less sensitive to LPS compared to humans, where LPS concentrations between 2-4 ng/kg body weight (BW) are able to induce a cytokine storm19. For mice, the lethal dose (LD50), which induces death in half of the mice ranges from 10-25 mg/kg BW20 depending on the mouse strain used. For the commonly used mouse strains, C57Bl/6 and BALB/c, the lethal dose 50% (LD50) is 10 mg/kg BW. In contrast, the strains C3H/HeJ and C57BL/10ScCr are protected from LPS induced endotoxemia, which is due to mutations in Tlr421. Consequently, Tlr4-deficient mice are hyporesponsive to injections with LPS22. Other genetically modified mouse lines, such as PARP1-/- mice23 are resistant to LPS-induced toxic shock.
The mouse model described here uses a sublethal dose of LPS administered systemically to mimic the consequences of LPS dissemination after a barrier breach of the body`s surfaces. The chosen LPS concentration (2 mg/kg BW) did not induce mortality in C56Bl/6 mice, but the induced release of pro-inflammatory cytokines.

<table><tbody><tr><td>DreamTaq Green PCR Master Mix (2x)</td><td>Thermo Fisher Scientific, Waltham, MA, USA</td><td>K1081</td><td></td></tr><tr><td>High Capacity cDNA Reverse Transcription Kit,</td><td>Applied Biosystems, Foster City, CA, USA</td><td>4368813</td><td></td></tr><tr><td>RNase-Free DNase Set,</td><td>Qiagen, Hilden, Germany</td><td>79254</td><td></td></tr><tr><td>LPS Escherichia coli O111:B4</td><td>Invivogen, San Diego, CA, USA.</td><td>tlrl-eblps</td><td></td></tr><tr><td>Omnican 50 Single-use insulin syringe</td><td>B. Braun Melsungen, Melsungen, Germany</td><td>9151125</td><td></td></tr><tr><td>Bioanalyzer 2100</td><td>Agilent Technologie, Santa Clara, USA</td><td>not applicable</td><td></td></tr><tr><td>Centrifuge 5430</td><td>Eppendorf, Hamburg, Germany</td><td>not applicable</td><td></td></tr><tr><td>Centrifuge Mikro 220R</td><td>Hettich, Kirchlengern, Germany</td><td>not applicable</td><td></td></tr><tr><td>Dissection tools</td><td>Aesculap, Tuttlingen, Germany</td><td>not applicable</td><td></td></tr><tr><td>Fast-Prep-24 5G Sample Preparation System</td><td>M.P. Biomedicals, Santa Ana, CA, USA</td><td>not applicable</td><td></td></tr><tr><td>NanoDrop ND-1000</td><td>NanoDrop Products, Wilmington, DE, USA</td><td>not applicable</td><td></td></tr><tr><td>TRI Reagent</td><td>Zymo Research, Irvine, CA, USA</td><td>R2050-1</td><td></td></tr></tbody></table>

injections of lipopolysaccharide into mice to mimic entrance of microbial-derived products after intestinal barrier breach

The intestinal epithelial barrier separates the host from the microbiota that is normally tolerated or ignored. The breach of this barrier results in the entrance of bacteria or bacteria-derived products into the host, accessing the host circulation and inner organs leading to the uncontrolled inflammation as observed in patients with inflammatory bowel disease (IBD), that are characterized by an increased intestinal epithelial permeability.
To mimic the entrance of bacterial-derived compounds into the host, an endotoxemia model has been adopted in which lipopolysaccharide (LPS), a component of the outer cell wall of Gram-negative bacteria, were injected into mice. In this study, a sublethal dose of LPS was intraperitoneally injected and the mice were subsequently monitored for 8 h using a disease score. Furthermore, the expression levels of the inflammatory cytokines Il6, Il1b, and Tnfa were analyzed in the spleen, liver and colon by qPCR at different time points post LPS injection. This model could be useful for the studies involving investigation of immune responses after the invasion of microorganisms or bacterial-derived products caused by a barrier breach of body surfaces.

To mimic the consequences for the host after the entrance of bacteria or bacterial-derived products that occurs after intestinal barrier breach, LPS was injected into C57Bl/6 mice in a sublethal dose (2 &#181;g/g body weight). Every single mouse was monitored and scored for the occurrence of endotoxemia with parameters listed in score sheet that includes, the appearance of the mice, the activity of the animals, the condition of eyes, and the respiration rate and quality (Table 1). The animals showed clinical signs of disease that peaked 6 to 10 h after the injection of LPS and recovered within 24 h (Figure 1). Individual mice were sacrificed 2 h, 4 h, and 8 h after the injection of LPS. Tissue pieces were collected from spleen, liver, and colon. RNA was isolated from these organs and reverse transcribed to cDNA. The cDNA was used as a template for qPCR to determine the expression levels of Il6 (Figure 2A) Il1b (Figure 2B), TNFa (Figure 2C) and Il10 (Figure 2D) with primers used for the qPCR listed in Table 6. The expression of Il6 peaked 2h after injection in spleen and colon, and 4 h after injection in the liver. The expression of Il1b, TNFa, and Il10 peaked 4 h after injection in spleen, liver, and colon. Within 8 h after injection, the expression of Il6, Il1b, TNFa, and Il10 returned to the baseline levels.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/57610/57610fig1.jpg" /> 
Figure 1: LPS injection (2 &#181;g/g body weight) induced clinical signs of endotoxemia in C57Bl/6mice. After injection of 2 &#181;g/g body weight of LPS, individual mice were monitored with the disease score presented in Table 1 that includes the appearance and the activity of the animals, opening of their eyes and their respiration rate and quality every 2 h for 12 h and 24 h after LPS injection. The disease score (y-axis) was blotted to the respective time (x-axis). Mean &#177; SD for 4-5 mice per each time point is presented. <a href="/files/ftp_upload/57610/57610fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/57610/57610fig2.jpg" /> 
Figure 2: LPS injection (2 &#181;g/g body weight) induces the expression of pro-inflammatory cytokines in C57Bl/6 mice. Mice were injected with 2 &#181;g/g body weight of LPS and the expression levels of Il6 (A), Il1b (B), Tnfa (C) and Il10 (D) were analyzed by qPCR in spleen, liver, and colon at indicated time points after injection. Cytokine expression levels were all normalized to the expression of Gapdh. Mean &#177; SD for 4-5 mice per each time point is shown. <a href="/files/ftp_upload/57610/57610fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Table 1: Disease score sheet to monitor C57Bl/6 mice after LPS injection. Parameters that are monitored after LPS injection. Animals were monitored every 2 h after injection for a period of 12 h, and scores were given for every individual parameter listed in the table. The final score for each animal represents the sum of all individual scores. This is adapted from reference24. <a href="/files/ftp_upload/57610/table1_LPSscore.xlsx">Please click here to download this file.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Amount</td>
			<td>Reagent</td>
		</tr>
		<tr>
			<td>2 &#181;L/sample</td>
			<td>10x RT Buffer</td>
		</tr>
		<tr>
			<td>0.8 &#181;L/sample</td>
			<td>25x deoxynucleotide (dNTP) Mix (100 mM)</td>
		</tr>
		<tr>
			<td>1 &#181;L/sample</td>
			<td>RT Random Primers</td>
		</tr>
		<tr>
			<td>4.2 &#181;L/sample</td>
			<td>nuclease-free water</td>
		</tr>
	</tbody>
</table>
Table 2: Reagents used to prepare the master mix for reverse transcription.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Temperature</td>
			<td>Time</td>
		</tr>
		<tr>
			<td>25 &#176;C</td>
			<td>10 min</td>
		</tr>
		<tr>
			<td>37 &#176;C</td>
			<td>120 min</td>
		</tr>
		<tr>
			<td>37 &#176;C</td>
			<td>5 min</td>
		</tr>
		<tr>
			<td>4 &#176;C</td>
			<td>hold</td>
		</tr>
	</tbody>
</table>
Table 3: Thermocycler settings used for reverse transcription.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Amount</td>
			<td>Reagent</td>
		</tr>
		<tr>
			<td>5 &#181;L/well</td>
			<td>2x Master Mix</td>
		</tr>
		<tr>
			<td>0.05 &#181;L/well</td>
			<td>Reference Dye</td>
		</tr>
		<tr>
			<td>500 nM final/well</td>
			<td>forward primer</td>
		</tr>
		<tr>
			<td>500 nM final/well</td>
			<td>reverse primer</td>
		</tr>
		<tr>
			<td>between 10 and 100 ng/well, we used 40 ng/well</td>
			<td>template cDNA diluted in a Template Dilution Buffer (1/100 dilution of this buffer was made in nuclease-free water and used to dilute the template cDNA). Diluting the template in this Buffer allows the visualization of the wells where template is added as the reaction color changes from blue to green</td>
		</tr>
		<tr>
			<td>nuclease-free water to final volume of 10 &#181;L/well</td>
			<td>nuclease-free water</td>
		</tr>
	</tbody>
</table>
Table 4: Description of the PCR reaction.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Temperature</td>
			<td>Time</td>
			<td></td>
		</tr>
		<tr>
			<td>95 &#176;C</td>
			<td>2 min</td>
			<td></td>
		</tr>
		<tr>
			<td>95 &#176;C</td>
			<td>5 s</td>
			<td rowspan="2">40 cycles</td>
		</tr>
		<tr>
			<td>60 &#176;C</td>
			<td>20 s</td>
		</tr>
		<tr>
			<td>95 &#176;C</td>
			<td>15 s</td>
			<td rowspan="3">melting curve analaysis</td>
		</tr>
		<tr>
			<td>60 &#176;C</td>
			<td>1 min</td>
		</tr>
		<tr>
			<td>95 &#176;C</td>
			<td>15 s</td>
		</tr>
	</tbody>
</table>
Table 5: Thermocycler settings used for PCR.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primer</td>
			<td>Sequence</td>
			<td>Melting temperature</td>
			<td>Product length</td>
		</tr>
		<tr>
			<td>Il6-F</td>
			<td>TCG GAG GCT TAA TTA CAC ATG TTC T</td>
			<td>60.3</td>
			<td>94 bp</td>
		</tr>
		<tr>
			<td>Il6-R</td>
			<td>GCATCATCGTTGTTCATACAATCA</td>
			<td>58.2</td>
			<td></td>
		</tr>
		<tr>
			<td>Il1b-F</td>
			<td>TGTGAAATGCCACCTTTTGA</td>
			<td>56.1</td>
			<td>94 bp</td>
		</tr>
		<tr>
			<td>Il1b-R</td>
			<td>GTCAAAGGTTTGGAAGCAG</td>
			<td>57.2</td>
			<td></td>
		</tr>
		<tr>
			<td>Il10-F</td>
			<td>ATCGATTTCTCCCCTGTGAA</td>
			<td>56.2</td>
			<td>108 bp</td>
		</tr>
		<tr>
			<td>Il10-R</td>
			<td>TGTCAAATTCATTCATGGCCT</td>
			<td>56.1</td>
			<td></td>
		</tr>
		<tr>
			<td>Tnfa-F</td>
			<td>CCACCACGCTCTTCTGTCTAC</td>
			<td>60.4</td>
			<td>103 bp</td>
		</tr>
		<tr>
			<td>Tnfa-R</td>
			<td>AGGGTCTGGGCCATAGAACT</td>
			<td>60</td>
			<td></td>
		</tr>
		<tr>
			<td>Gapdh-F</td>
			<td>CATCAAGAAGGTGGTGAAGC</td>
			<td>56.7</td>
			<td>199 bp</td>
		</tr>
		<tr>
			<td>Gapdh-R</td>
			<td>CCTGTTGCTGTAGCCGTATT</td>
			<td>58</td>
			<td></td>
		</tr>
	</tbody>
</table>
Table 6: Primers used in the qPCR reaction. The sequence of primers used for qPCR to detect mouse cytokines and housekeeping gene Gapdh.

Watch this Scientific Journal Video about Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach at JoVE.com

Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach | Immunology and Infection | Video

Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach

Here a protocol to mimic the entrance of bacterial-derived compounds after intestinal barrier breach is presented. A low sublethal dose of lipopolysaccharide was injected systemically into mice, which were monitored for 24 h post-injection. The expression of pro-inflammatory cytokines was determined at several time points in spleen, liver, and colon.

The intestinal epithelial barrier separates the host from the microbiota that is normally tolerated or ignored. The breach of this barrier results in the ...

injections-lipopolysaccharide-into-mice-to-mimic-entrance-microbial

Nanyang Technological University

Research

Education

JoVE Journal

JoVE Core

Biology

Immunology and Infection

Human Biology

Immune System

SCIENTISTS IN ACTION

19.3K Views.  University of Basel. Here a protocol to mimic the entrance of bacterial-derived compounds after intestinal barrier breach is presented. A low sublethal dose of lipopolysaccharide was injected systemically into mice, which were monitored for 24 h post-injection. The expression of pro-inflammatory cytokines was determined at several time points in spleen, liver, and colon.

Video: Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach

Intraductal Injection of LPS as a Mouse Model of Mastitis: Signaling Visualized via an NF-&kappa;B Reporter Transgenic

Animal models of human disease are necessary in order to rigorously study stages of disease progression and associated mechanisms, and ultimately, as pre-clinical models to test interventions. In these methods, we describe a technique in which lipopolysaccharide (LPS) is injected into the lactating mouse mammary gland via the nipple, effectively modeling mastitis, or inflammation, of the gland. This simulated infection results in increased nuclear factor kappa B (NF-&kappa;B) signaling, as visualized through bioluminescent imaging of an NF-&kappa;B luciferase reporter mouse1.
Our ultimate goal in developing these methods was to study the inflammation associated with mastitis in the lactating gland, which often includes redness, swelling, and immune cell infiltration2,3. Therefore, we were keenly aware that incision or any type of wounding of the skin, the nipple, or the gland in order to introduce the LPS could not be utilized in our methods since the approach would likely confound the read-out of inflammation. We also desired a straight-forward method that did not require specially made hand-drawn pipettes or the use of micromanipulators to hold these specialized tools in place. Thus, we determined to use a commercially available insulin syringe and to inject the agent into the mammary duct of an intact nipple. This method was successful and allowed us to study the inflammation associated with LPS injection without any additional effects overlaid by the process of injection. In addition, this method also utilized an NF-&kappa;B luciferase reporter transgenic mouse and bioluminescent imaging technology to visually and quantitatively show increased NF-&kappa;B signaling within the LPS-injected gland4.
These methods are of interest to researchers of many disciplines who wish to model disease within the lactating mammary gland, as ultimately, the technique described here could be utilized for injection of a number of substances, and is not limited to only LPS.

Described here is a technique in which lipopolysaccharide is injected into the lactating mouse mammary gland via the nipple to simulate mastitis, a condition commonly caused by bacterial infection. Lipopolysaccharide injection results in increased nuclear factor kappa B (NF-&kappa;B) signaling, visualized through bioluminescent imaging of an NF-&kappa;B luciferase reporter mouse.

Animal models of human disease are necessary in order to rigorously study stages of disease progression and associated mechanisms, and ultimately, as ...

Medicine

Two-photon Intravital Imaging of Leukocytes During the Immune Response in Lipopolysaccharide-treated Mouse Liver

Sepsis is a type of severe infection that can cause organ failure and tissue damage. Although the mortality and morbidity rates associated with sepsis are extremely high, no direct treatment or organ-related mechanism has been examined in detail in real time. The liver is the key organ that manages toxins and infections in the human body. Herein, we aimed to perform intravital imaging of mouse liver after induction of endotoxemia in order to track the motility of immune cells, such as neutrophils and liver capsular macrophages (LCMs). Accordingly, we designed a novel surgical method for exposure of the liver with minimally invasive surgery. Mice were intraperitoneally injected with lipopolysaccharide (LPS), a common endotoxin. Using our novel surgical approach for exposure and intravital imaging of the mouse liver, we found that neutrophil recruitment in LPS-treated LysM-green fluorescent protein (GFP) mouse liver was increased compared with that in phosphate-buffered saline-treated liver. After LPS treatment, the number of neutrophils increased significantly with time. Additionally, using CX3Cr1-GFP mice, we successfully visualized liver resident macrophages called LCMs. Therefore, to investigate the efficacy of new reagents to control immune mobility in vivo, determining the motility and morphology of neutrophils and LCMs in the liver may allow us to identify therapeutic effect in organ failure and tissue damage caused by leukocytes activation in sepsis.

We established a novel surgical protocol for two-photon imaging of live mice liver with minimal invasion. With this technique, we identified the detailed structure of the liver during lipopolysaccharide-induced endotoxemia. We anticipate that this method may be utilized to determine the effectiveness of various reagents treatment to hepatic leukocyte migration.

Sepsis is a type of severe infection that can cause organ failure and tissue damage. Although the mortality and morbidity rates associated with sepsis are ...

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence rates of S. aureus infection climbing annually, there is a demand for additional research in its&#160;pathogenicity. Animal models of infectious disease advance our understanding of the host-pathogen response and lead to the development of effective therapeutics. Neutrophils play a primary role in the innate immune response that controls S. aureus infections by forming an abscess to wall off the infection and facilitate bacterial clearance; the number of neutrophils that infiltrate an S. aureus skin infection often correlates with disease outcome. LysM-EGFP mice, which possess the enhanced green fluorescent protein (EGFP) inserted in the Lysozyme M (LysM) promoter region (expressed primarily by neutrophils), when used in conjunction with in vivo whole animal fluorescence imaging (FLI) provide&#160;a means of quantifying neutrophil emigration noninvasively and longitudinally into wounded skin. When combined with a bioluminescent S. aureus strain and sequential in vivo whole animal bioluminescent imaging (BLI), it is possible to longitudinally monitor both the neutrophil recruitment dynamics and in vivo bacterial burden at the site of infection in anesthetized mice from onset of infection to resolution or death. Mice are more resistant to a number of virulence factors produced by S. aureus that facilitate effective colonization and infection in humans. Immunodeficient mice provide a more sensitive animal model to examine persistent S. aureus infections and the ability of therapeutics to boost innate immune responses. Herein, we characterize responses in LysM-EGFP mice that have been bred to MyD88-deficient mice (LysM-EGFP&#215;MyD88-/- mice) along with wild-type LysM-EGFP mice to investigate S. aureus skin wound infection. Multispectral simultaneous detection enabled study of neutrophil recruitment dynamics by using in vivo FLI, bacterial burden by using in vivo BLI, and wound healing longitudinally and noninvasively over time.

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

An approach is described for real-time detection of the innate immune response to cutaneous wounding and Staphylococcus aureus infection of mice. By comparing LysM-EGFP mice (which possess fluorescent neutrophils) with a LysM-EGFP crossbred immunodeficient mouse strain, we advance our understanding of infection and the development of approaches to combat infection.

Staphylococcus aureus (S. aureus)&#160;infections, including methicillin resistant stains, are an enormous burden on the healthcare system. With incidence ...

Chronic Salmonella Infection Induced Intestinal Fibrosis

Tissue fibrosis characterized by the pathological accumulation of extracellular matrix such as collagen is the outcome of persistent inflammation and dysregulated repair. In inflammatory bowel disease (IBD), fibrosis leads to recurrent stricture formations for which there is no effective therapy other than surgical resection. Due to its late onset, the processes that drive fibrosis is less studied and largely unknown. Therefore, fibrotic complications represent a major challenge in IBD. In this protocol, a robust in vivo model of intestinal fibrosis is described where streptomycin pre-treatment of C57Bl/6 mice followed by oral gavage with vaccine grade Salmonella Typhimurium &#916;AroA mutant leads to persistent pathogen colonization and fibrosis of the cecum. Methodologies for preparing S. Typhimurium &#916;AroA for inoculation, quantifying pathogen loads in the cecum and spleen, and evaluating collagen deposition in intestinal tissues are explained. This experimental disease model is useful for examining host factors that either enhance or exacerbate CD-like intestinal fibrosis.

This protocol describes a mouse model of Salmonella driven intestinal fibrosis that resembles key pathological hallmarks of Crohn&#8217;s disease including transmural inflammation and fibrosis. This method can be used to evaluate host factors that alter fibrotic outcomes using mutant mice maintained on a C57Bl/6 genetic background.

Tissue fibrosis characterized by the pathological accumulation of extracellular matrix such as collagen is the outcome of persistent inflammation and ...

Sub-acute Cerebral Microhemorrhages Induced by Lipopolysaccharide Injection in Rats

Cerebral microhemorrhages (CMHs) are common in aged patients and are correlated to various neuropsychiatric disorders. The etiology of CMHs is complex, and neuroinflammation is often observed as a co-occurrence. Here, we describe a sub-acute CMHs rat model induced by lipopolysaccharide (LPS) injection, as well as a method for detecting CMHs. Systemic LPS injection is relatively simple, economical, and cost-effective. One major advantage of LPS injection is its stability to induce inflammation. CMHs caused by LPS injection could be detected by gross observation, hematoxylin and eosin (HE) staining, Perl&#39;s Prussian staining, Evans blue (EB) double-labeling, and magnetic resonance imaging-susceptibility weighted imaging (MRI-SWI) technology. Finally, other methods of developing CMHs animal models, including their advantages and/or disadvantages, are also discussed in this report.

We present a protocol to induce and detect CMHs caused by LPS injection in Sprague-Dawley rats, which may be utilized in future research investigations on the pathogenesis of CMHs.

Cerebral microhemorrhages (CMHs) are common in aged patients and are correlated to various neuropsychiatric disorders. The etiology of CMHs is complex, ...

Neuroscience

Functional Assessment of Intestinal Permeability and Neutrophil Transepithelial Migration in Mice using a Standardized Intestinal Loop Model

The intestinal mucosa is lined by a single layer of epithelial cells that forms a dynamic barrier allowing paracellular transport of nutrients and water while preventing passage of luminal bacteria and exogenous substances. A breach of this layer results in increased permeability to luminal contents and recruitment of immune cells, both of which are hallmarks of pathologic states in the gut including inflammatory bowel disease (IBD). 
Mechanisms regulating epithelial barrier function and transepithelial migration (TEpM) of polymorphonuclear neutrophils (PMN) are incompletely understood due to the lack of experimental in vivo methods allowing quantitative analyses. Here, we describe a robust murine experimental model that employs an exteriorized intestinal segment of either ileum or proximal colon. The exteriorized intestinal loop (iLoop) is fully vascularized and offers physiological advantages over ex vivo chamber-based approaches commonly used to study permeability and PMN migration across epithelial cell monolayers.
We demonstrate two applications of this model in detail: (1) quantitative measurement of intestinal permeability through detection of fluorescence-labeled dextrans in serum after intraluminal injection, (2) quantitative assessment of migrated PMN across the intestinal epithelium into the gut lumen after intraluminal introduction of chemoattractants. We demonstrate feasibility of this model and provide results utilizing the iLoop in mice lacking the epithelial tight junction-associated protein JAM-A compared to controls. JAM-A has been shown to regulate epithelial barrier function as well as PMN TEpM during inflammatory responses. Our results using the iLoop confirm previous studies and highlight the importance of JAM-A in regulation of intestinal permeability and PMN TEpM in vivo during homeostasis and disease. 
The iLoop model provides a highly standardized method for reproducible in vivo studies of intestinal homeostasis and inflammation and will significantly enhance understanding of intestinal barrier function and mucosal inflammation in diseases such as IBD.

Dysregulated intestinal epithelial barrier function and immune responses are hallmarks of inflammatory bowel disease that remain poorly investigated due to a lack of physiological models. Here, we describe a mouse intestinal loop model that employs a well-vascularized and exteriorized bowel segment to study mucosal permeability and leukocyte recruitment in vivo.

The intestinal mucosa is lined by a single layer of epithelial cells that forms a dynamic barrier allowing paracellular transport of nutrients and water ...

Inducing Acute Lung Injury in Mice by Direct Intratracheal Lipopolysaccharide Instillation

Airway administration of lipopolysaccharide (LPS) is a common way to study pulmonary inflammation and acute lung injury (ALI) in small animal models. Various approaches have been described, such as the inhalation of aerosolized LPS as well as nasal or intratracheal instillation. The presented protocol describes a detailed step-by-step procedure to induce ALI in mice by direct intratracheal LPS instillation and perform FACS analysis of blood samples, bronchoalveolar lavage (BAL) fluid, and lung tissue. After intraperitoneal sedation, the trachea is exposed and LPS is administered via a 22 G venous catheter. A robust and reproducible inflammatory reaction with leukocyte invasion, upregulation of proinflammatory cytokines, and disruption of the alveolo-capillary barrier is induced within hours to days, depending on the LPS dosage used. Collection of blood samples, BAL fluid, and lung harvesting, as well as the processing for FACS analysis, are described in detail in the protocol. Although the use of the sterile LPS is not suitable to study pharmacologic interventions in infectious diseases, the described approach offers minimal invasiveness, simple handling, and good reproducibility to answer mechanistic immunological questions. Furthermore, dose titration as well as the use of alternative LPS preparations or mouse strains allow modulation of the clinical effects, which can exhibit different degrees of ALI severity or early vs. late onset of disease symptoms.

Presented here is a step-by-step procedure to induce acute lung injury in mice by direct intratracheal lipopolysaccharide instillation and to perform FACS analysis of blood samples, bronchoalveolar lavage fluid, and lung tissue. Minimal invasiveness, simple handling, good reproducibility, and titration of disease severity are advantages of this approach.

Airway administration of lipopolysaccharide (LPS) is a common way to study pulmonary inflammation and acute lung injury (ALI) in small animal models. ...

A Murine Model of Fetal Exposure to Maternal Inflammation to Study the Effects of Acute Chorioamnionitis on Newborn Intestinal Development

Chorioamnionitis is a common precipitant of preterm birth and is associated with many of the morbidities of prematurity, including necrotizing enterocolitis (NEC). However, a mechanistic link between these two conditions remains yet to be discovered. We have adopted a murine model of chorioamnionitis involving lipopolysaccharide (LPS)-induced fetal exposure to maternal inflammation (FEMI). This model of FEMI induces a sterile maternal, placental, and fetal inflammatory cascade, which is also present in many cases of clinical chorioamnionitis. Although models exist that utilize live bacteria and more accurately mimic the pathophysiology of an ascending infection resulting in chorioamnionitis, these methods may cause indirect effects on development of the immature intestinal tract and the associated developing microbiome. Using this protocol, we have demonstrated that LPS-induced FEMI results in a dose-dependent increase in pregnancy loss and preterm birth, as well as disruption of normal intestinal development in offspring. Further, we have demonstrated that FEMI significantly increases intestinal injury and serum cytokines in offspring, while simultaneously decreasing goblet and Paneth cells, both of which provide a first line of innate immunity against intestinal inflammation. Although a similar model of LPS-induced FEMI has been used to model the association between chorioamnionitis and subsequent abnormalities of the central nervous system, to our knowledge, this protocol is the first to attempt to elucidate a mechanistic link between chorioamnionitis and later perturbations in intestinal development as a potential link between chorioamnionitis and NEC.

We developed a model of chorioamnionitis to simulate fetal exposure to maternal inflammation (FEMI) without complications of live organisms to examine the effects of FEMI on development of the offspring&#8217;s intestinal tract. This allows for study of mechanistic causes for development of intestinal injury following chorioamnionitis.

Chorioamnionitis is a common precipitant of preterm birth and is associated with many of the morbidities of prematurity, including necrotizing ...

Noninvasive Intratracheal Lipopolysaccharide Instillation in Mice

The acute lung injury (ALI) mouse model induced by lipopolysaccharide (LPS) or endotoxin is still among the most commonly used models in animal studies of acute lung injury or acute inflammation. The current most commonly used methods in acute lung injury mouse models are an intraperitoneal injection of LPS and tracheostomy for the tracheal infusion of LPS. However, the former method lacks lung targeting and damages other organs, and the latter method induces operative trauma, infection risk, and a low survival rate. Here, we recommend a noninvasive oropharyngeal endotracheal intubation method for LPS instillation in mice. In this method, LPS is noninvasively introduced into the trachea through the oropharyngeal cavity to be instilled into the lung with the help of an apparatus for endotracheal intubation. This method not only assures lung targeting but also avoids damage and the risk of death in the animals. We expect that this approach will become widely used in the field of acute lung injury.

Here, we propose a protocol for intratracheal lipopolysaccharide (LPS) delivery via noninvasive oropharyngeal endotracheal intubation. This method minimizes the trauma of the surgical procedure for the animal and accurately delivers LPS to the trachea and then to the lungs.

The acute lung injury (ALI) mouse model induced by lipopolysaccharide (LPS) or endotoxin is still among the most commonly used models in animal studies of ...

Subcutaneous Injection of Bacterial Antigen to Induce Systemic Inflammation in a Murine Model

Source: John, S. et al., <a href="https://app.jove.com/v/62925">Primed Mycobacterial Uveitis (PMU) as a Model for Post-Infectious Uveitis.</a>&#160;J. Vis. Exp. (2021)
This video demonstrates the induction of systemic inflammation in an anesthetized mouse. The injection of mycobacterial antigen-adjuvant depots triggers cytokine release and localized inflammation. Lymphatic vessels open, enabling immune cell entry into lymph nodes and activation of T cells, which release pro-inflammatory cytokines, leading to widespread inflammation.

Source: John, S. et al., Primed Mycobacterial Uveitis (PMU) as a Model for Post-Infectious Uveitis.&#160;J. Vis. Exp. (2021)
This video demonstrates the ...

Injections of Lipopolysaccharide into Mice to Mimic Entrance of Microbial-derived Products After Intestinal Barrier Breach

Summary

Explore More Videos

Chapters in this video

Intraductal Injection of LPS as a Mouse Model of Mastitis: Signaling Visualized via an NF-κB Reporter Transgenic

Two-photon Intravital Imaging of Leukocytes During the Immune Response in Lipopolysaccharide-treated Mouse Liver

A Mouse Model to Assess Innate Immune Response to Staphylococcus aureus Infection

Chronic Salmonella Infection Induced Intestinal Fibrosis

Sub-acute Cerebral Microhemorrhages Induced by Lipopolysaccharide Injection in Rats

Functional Assessment of Intestinal Permeability and Neutrophil Transepithelial Migration in Mice using a Standardized Intestinal Loop Model

Inducing Acute Lung Injury in Mice by Direct Intratracheal Lipopolysaccharide Instillation

A Murine Model of Fetal Exposure to Maternal Inflammation to Study the Effects of Acute Chorioamnionitis on Newborn Intestinal Development

Noninvasive Intratracheal Lipopolysaccharide Instillation in Mice

Subcutaneous Injection of Bacterial Antigen to Induce Systemic Inflammation in a Murine Model