Name: rna-based reprogramming of human primary fibroblasts into induced pluripotent stem cells
Uploaded: 2018-11-26T14:45:00
Duration: 11 min 38 s
Description: Watch this Scientific Journal Video about RNA-based Reprogramming of Human Primary Fibroblasts into Induced Pluripotent Stem Cells at JoVE.com

We are grateful for funding support from the National Institutes of Health (T32AR007411-33) and the University of Colorado Skin Diseases Research Core Center (P30AR057212). We also thank the Epidermolysis Bullosa (EB) Research Partnership, EB Medical Research Foundation, Cure EB Charity, Dystrophic Epidermolysis Bullosa Research Association (DEBRA) International, King Baudouin Foundation&#39;s Vlinderkindje Fund, and Gates Frontiers Fund.

<ol>
	<li>Takahashi, K., Yamanaka, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+Pluripotent+Stem+Cells+from+Mouse+Embryonic+and+Adult+Fibroblast+Cultures+by+Defined+Factors.">Induction of Pluripotent Stem Cells from Mouse Embryonic and Adult Fibroblast Cultures by Defined Factors.</a> Cell. 126 (4), 663-676 (2006).</li><li>Takahashi, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Induction+of+Pluripotent+Stem+Cells+from+Adult+Human+Fibroblasts+by+Defined+Factors.">Induction of Pluripotent Stem Cells from Adult Human Fibroblasts by Defined Factors.</a> Cell. 131 (5), 861-872 (2007).</li><li>Schlaeger, T. M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+comparison+of+non-integrating+reprogramming+methods.">A comparison of non-integrating reprogramming methods.</a> Nature Biotechnology. 33 (1), 58-63 (2015).</li><li>Hacein-Bey-Abina, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=LMO2-Associated+Clonal+T+Cell+Proliferation+in+Two+Patients+after+Gene+Therapy+for+SCID-X1.">LMO2-Associated Clonal T Cell Proliferation in Two Patients after Gene Therapy for SCID-X1.</a> Science. 302 (5644), 415-419 (2003).</li><li>Warren, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+reprogramming+to+pluripotency+and+directed+differentiation+of+human+cells+with+synthetic+modified+mRNA.">Highly efficient reprogramming to pluripotency and directed differentiation of human cells with synthetic modified mRNA.</a> Cell Stem Cell. 7 (5), 618-630 (2010).</li><li>Judson, R. L., Babiarz, J. E., Venere, M., Blelloch, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Embryonic+stem+cell-specific+microRNAs+promote+induced+pluripotency.">Embryonic stem cell-specific microRNAs promote induced pluripotency.</a> Nature Biotechnology. 27 (5), 459-461 (2009).</li><li>Anokye-Danso, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+miRNA-mediated+reprogramming+of+mouse+and+human+somatic+cells+to+pluripotency.">Highly efficient miRNA-mediated reprogramming of mouse and human somatic cells to pluripotency.</a> Cell Stem Cell. 8 (4), 376-388 (2011).</li><li>Kogut, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=High-efficiency+RNA-based+reprogramming+of+human+primary+fibroblasts.">High-efficiency RNA-based reprogramming of human primary fibroblasts.</a> Nature Communications. 9 (1), (2018).</li><li>Hirai, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Radical+acceleration+of+nuclear+reprogramming+by+chromatin+remodeling+with+the+transactivation+domain+of+MyoD.">Radical acceleration of nuclear reprogramming by chromatin remodeling with the transactivation domain of MyoD.</a> Stem Cells. 29 (9), 1349-1361 (2011).</li><li>Mandal, P. K., Rossi, D. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reprogramming+human+fibroblasts+to+pluripotency+using+modified+mRNA.">Reprogramming human fibroblasts to pluripotency using modified mRNA.</a> Nature Protocols. 8 (3), 568-582 (2013).</li><li>Avci-Adali, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vitro+synthesis+of+modified+mRNA+for+induction+of+protein+expression+in+human+cells.">In vitro synthesis of modified mRNA for induction of protein expression in human cells.</a> Journal of Visualized Experiments. , e51943 (2014).</li></ol>

I.K. and G.B. are co-inventors on a patent application entitled &#34;Methods and Compositions for Reprogramming Cells&#34;, PCT Application No. PCT/US2016/063258.

This protocol describes a clinically-relevant, non-integrating, RNA-based method that allows for the reprogramming of normal and disease-associated human fibroblast lines into iPSCs at an ultra-high efficiency. To date, every human fibroblast line we have attempted to reprogram with the described protocol has yielded a satisfactory number of high-quality iPSCs for downstream applications. Resulting iPSCs can immediately be transferred and expanded in feeder-free culture conditions.
Quality of fibroblasts for reprogramming:
Reprogramming success is heavily dependent on the quality of starting fibroblasts. Ideally, reprogramming should be initiated with the lowest passage fibroblasts available to achieve the highest efficiency. Reprogramming efficiency is best with fibroblasts of passage 2&#8211;4. Reprogramming can still work with high-passage (passage 5&#8211;8), even senescent fibroblasts, albeit with a reduced efficiency. Sometimes low-passage fibroblasts are unavailable or patient samples have a genetic mutation that prevents healthy growth. In this case, optimization of initial plating density may be required. The reprogramming of compromised fibroblast lines is usually associated with increased cell death during RNA transfections. As a result, the cells in the reprogramming well will appear to be sparse by days 10&#8211;14 of reprogramming. Large acellular areas will also be visible in the well. If this is the case, the reprogramming protocol will need to be re-initiated with a higher initial starting number of fibroblasts. Plating 3,000 input cells per well of a 6-well format dish works consistently for most adult fibroblast lines. However, increasing the plating number to 5,000&#8211;10,000 (50,000 for senescent lines) may help to improve reprogramming of disease-associated samples, as has been reported in our previous publication8. Conversely, cells reaching confluency too early can also be resistant to reprogramming. If cells undergoing transfections with reprogramming RNAs proliferate too rapidly (as is sometimes the case with primary neonatal fibroblasts), initiate reprogramming with 500 fibroblasts per well of a 6-well format dish8.
Handling of the transfection buffer:
The pH of the transfection buffer (reduced-serum medium adjusted to the pH of 8.2) is paramount to achieving the optimal transfection efficiencies required for this reprogramming protocol. For this reason, several precautions regarding the handling of the transfection buffer are recommended. We have found that even short exposure of the transfection buffer to atmospheric air affects the pH of the buffer. Therefore, the transfection buffer should be aliquoted into a screw cap container with minimal air space (we use either 5 or 15 mL screw cap conical tubes). To further minimize air exposure, use each transfection buffer aliquot for a maximum of two transfections. Lastly, since temperature impacts pH, it is critical that the transfection buffer is equilibrated to RT for assembly of the transfection complexes. It is advised to not warm the transfection buffer to 37 &#176;C.
Passaging of iPSCs:
While many previously published protocols recommend picking individual iPSC colonies at the end of reprogramming, this may be difficult to achieve when the efficiency of reprogramming is very high or if the colonies cluster together, as is often the case in our protocol. Therefore, if iPSC colonies are in close proximity to each other, we recommend first passaging the cells to spread out reprogrammed iPSCs before manually picking colonies. There are several advantages to performing this early passage step. Spreading out the colonies gives them more room to grow, yielding much larger colonies for picking than could otherwise be achieved in the original well. This greatly improves the success rate in establishing an iPSC line from a picked clone. We also find that the additional culture time with fibroblasts, albeit at a diluted ratio, appears to improve the average quality of picked iPSC colonies. The incompletely reprogrammed fibroblasts may provide supporting paracrine factors, which continue to help establish the iPSCs and ease the direct transition into feeder-free cell culture conditions. Fibroblasts fortuitously have a selective growth disadvantage compared to iPSCs when cultured in mTeSR1. Therefore, the contaminating fibroblast cell population is quickly diluted to negligible quantities within 3&#8211;4 passages.
ROCK inhibitors such as Y-27632 are frequently used for routine culture of human iPSCs. We have found that frequent and/or extended culture of some iPSC lines with Y-27632 can have deleterious effects on overall quality. When using a clump passaging method, such as with EDTA, Y-27632 is not necessary to maintain iPSC viability after splitting. We have completely eliminated supplementing media with Y-27632 for all iPSC isolation, expansion, or routine culture.
Protocol limitations:
One limitation to the described RNA-based reprogramming approach is the initial cost and complexity associated with the preparation of the reprogramming reagents. Although preparatory procedures to generate mRNA reagents are all routine and have been previously described (PCR, in vitro transcription, DNase treatment, capping, dephosphorylation, purification), cumulatively the production of mRNA reagents is a relatively lengthy and non-trivial process. The other major challenge to this protocol is the need to transfect cells every 48 h, increasing the labor intensity of the reprogramming protocol. These considerations may be prohibitive if reprogramming of only a few patient samples is desired. However, if the primary consideration is the generation of clinically relevant iPSCs or achieving very high reprogramming efficiency, the described RNA-based reprogramming approach is ideal.
In summary, the described high-efficiency RNA-based reprogramming method hinges on optimized transfection efficiency of the somatic cell type to be reprogrammed as described in our previous publication8. The RNA transfection protocol presented in this study is highly tuned for human primary fibroblasts but can potentially be tailored to other cell types to improve reprogramming efficiency of various somatic cells.

Reprogramming somatic cells into induced pluripotent stem cells (iPSCs) requires extended expression of a core set of transcription factors that are important in maintaining pluripotency1,2. When producing iPSCs for clinical applications, it is essential that the mutational burden in input cells is minimized during processing and the efficiency of iPSC generation is maintained at a relatively high level across patient samples. However, the majority of reprogramming methods, including integration-free protocols, suffers from very low reprogramming efficiencies, which limit clinical usefulness of these approaches3. The low reprogramming efficiency may also promote selective reprogramming of cells carrying preexisting mutations, increasing mutational burden in resulting iPSCs. In addition, all DNA-based reprogramming methods, such as lentivirus- and episomal-based approaches, suffer from the safety concern that DNA may randomly integrate into the genome and create the opportunity for harmful insertional mutagenesis and unwanted (potentially oncogenic) expression of pluripotency genes in downstream tissue derivatives4.
A promising approach to achieve efficient induction of pluripotency in somatic cells and reduce mutational burden in resulting iPSCs is to use synthetic capped messenger RNAs containing modified nucleobases (modified mRNAs) for reprogramming5. The efficiency of modified mRNA-based reprogramming approaches can be further enhanced by adding embryonic stem cell (ESC)-specific microRNAs (miRNAs)-367/302s3, which have been shown to reprogram somatic cells with increased efficiency6,7. However, even with the addition of miRNAs-367/302s, the modified mRNA-based reprogramming approach often fails during application to freshly isolated patient cells3. To address inconsistencies of this modified mRNA-based approach, we have recently reported an optimized, integration-free strategy that induces pluripotency in human primary fibroblasts with a high success rate and utilizes both modified mRNAs encoding reprogramming factors and mature miRNA-367/302 mimics8. In our method, the reprogramming modified mRNA cocktail includes a modified version of OCT4 fused with the MyoD transactivation domain (called M3O)9 and five other reprogramming factors (SOX2, KLF4, cMYC, LIN28A, and NANOG). Combining the modified mRNA encoding the pluripotency factors with the miRNA mimics appeared to have a synergistic effect on reprogramming efficiencies in this protocol. Additional optimizations of the RNA transfection regimen, cell seeding, and culturing conditions were also necessary to increase reprogramming efficiency of the approach to an ultra-high level8.
Unlike many other protocols, our reprogramming approach typically requires only a few thousand input fibroblasts. In addition, many common non-integrating strategies using episomal plasmids, Sendai virus, or self-replicating RNA involve extensive passaging to dilute the reprogramming vector in generated iPSCs. Conversely, modified mRNA and mature miRNA mimics have a short half-life and are rapidly eliminated from cells. Taken together, the amount of cumulative cell culture time between collecting patient samples and the generation of usable iPSCs is minimal in this approach, effectively limiting mutation accumulation in resulting iPSCs and improving cost-effectiveness.
Here, we present the detailed step-by-step protocol to achieve high-efficiency reprogramming of adult human fibroblasts into iPSCs using our combinatorial modified mRNA/miRNA-based approach8. This RNA-based reprogramming protocol provides a straightforward, cost-effective, and robust method for generating integration-free iPSCs for research and potential clinical applications. Furthermore, it is applicable to the reprogramming of a variety of fibroblast lines including difficult-to-reprogram, disease-associated, aged, and senescent fibroblasts. A schematic of the protocol for reprogramming human fibroblasts is shown in Figure 1. The protocol specifically describes a method for reprogramming three wells of human adult primary fibroblasts in a 6-well format plate. Two wells typically yield a sufficient number of high-quality iPSC colonies. In many cases, only one well is necessary, and the third well can be used for analysis of reprogramming efficiency. If required, the number of wells can be scaled up.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="4">Plasmid templates for PCR</td>
		</tr>
		<tr>
			<td>pcDNA3.3_KLF4</td>
			<td>Addgene</td>
			<td>26815</td>
			<td></td>
		</tr>
		<tr>
			<td>pcDNA3.3_SOX2</td>
			<td>Addgene</td>
			<td>26817</td>
			<td></td>
		</tr>
		<tr>
			<td>pcDNA3.3_c-MYC</td>
			<td>Addgene</td>
			<td>26818</td>
			<td></td>
		</tr>
		<tr>
			<td>pcDNA3.3_LIN28A</td>
			<td>Addgene</td>
			<td>26819</td>
			<td></td>
		</tr>
		<tr>
			<td>pCR-Blunt_hM3O</td>
			<td>Addgene</td>
			<td>112638</td>
			<td></td>
		</tr>
		<tr>
			<td>pCR-Blunt_hNANOG</td>
			<td>Addgene</td>
			<td>112639</td>
			<td></td>
		</tr>
		<tr>
			<td>pCR-Blunt_mWasabi</td>
			<td>Addgene</td>
			<td>112640</td>
			<td></td>
		</tr>
		<tr>
			<td colspan="4">Modified mRNA in vitro transcription and miRNA mimics</td>
		</tr>
		<tr>
			<td>Forward Primer</td>
			<td>Integrated DNA Technologies</td>
			<td>TTGGACCCTCGTACAGAAGC 
			TAATACG</td>
			<td></td>
		</tr>
		<tr>
			<td>Reverse Primer (Ordered as ultramer, 4nmol scale)</td>
			<td>Integrated DNA Technologies</td>
			<td>TTTTTTTTTTTTTTTTTTTTTTTT 
			TTTTTTTTTTTTTTTTTTTTTTTT 
			TTTTTTTTTTTTTTTTTTTTTTTT 
			TTTTTTTTTTTTTTTTTTTTTTTT 
			TTTTTTTTTTTTTTTTTTTTTTTT 
			CTTCCTACTCAGGCTTTATTCA 
			AAGACCA</td>
			<td></td>
		</tr>
		<tr>
			<td>(ARCA Cap) 3&#180;-0-Me-m7G(5&#39;)ppp(5&#39;)G&#160;</td>
			<td>New England Biolabs</td>
			<td>S1411S</td>
			<td></td>
		</tr>
		<tr>
			<td>Pfu Ultra II Hotstart 2x Master Mix</td>
			<td>Agilent</td>
			<td>600850-51</td>
			<td></td>
		</tr>
		<tr>
			<td>5-Methylcytidine-5&#39;-Triphosphate</td>
			<td>Trilink Biotechnologies</td>
			<td>N-1014</td>
			<td></td>
		</tr>
		<tr>
			<td>Antarctic Phosphatase</td>
			<td>New England Biolabs</td>
			<td>M0289L</td>
			<td></td>
		</tr>
		<tr>
			<td>DNase I</td>
			<td>NEB</td>
			<td>M0303S</td>
			<td></td>
		</tr>
		<tr>
			<td>MEGAscript T7 Transcription Kit</td>
			<td>ThermoFisher Scientific</td>
			<td>AM1334</td>
			<td></td>
		</tr>
		<tr>
			<td>Pseudouridine-5&#39;-Triphosphate</td>
			<td>Trilink Biotechnologies</td>
			<td>N-1019</td>
			<td></td>
		</tr>
		<tr>
			<td>Riboguard RNase Inhibitor</td>
			<td>Lucigen</td>
			<td>RG90910K</td>
			<td></td>
		</tr>
		<tr>
			<td>RNA Clean &#38; Concentrator</td>
			<td>ZymoResearch</td>
			<td>R1019</td>
			<td></td>
		</tr>
		<tr>
			<td>Syn-hsa-miR-302a-3p miScript miRNA Mimic</td>
			<td>Qiagen</td>
			<td>MSY0000684</td>
			<td></td>
		</tr>
		<tr>
			<td>Syn-hsa-miR-302b-3p miScript miRNA Mimic</td>
			<td>Qiagen</td>
			<td>MSY0000715</td>
			<td></td>
		</tr>
		<tr>
			<td>Syn-hsa-miR-302c-3p miScript miRNA Mimic</td>
			<td>Qiagen</td>
			<td>MSY0000717</td>
			<td></td>
		</tr>
		<tr>
			<td>Syn-hsa-miR-302d-3p miScript miRNA Mimic</td>
			<td>Qiagen</td>
			<td>MSY0000718</td>
			<td></td>
		</tr>
		<tr>
			<td>Syn-hsa-miR-367-3p miScript miRNA Mimic</td>
			<td>Qiagen</td>
			<td>MSY0000719</td>
			<td></td>
		</tr>
		<tr>
			<td>Water (Nuclease free, Not DEPC-treated)</td>
			<td>Fisher</td>
			<td>AM9937</td>
			<td>Use to dilute modified mRNAs and miRNA mimics</td>
		</tr>
		<tr>
			<td colspan="4">Fibroblast culture and reprogramming</td>
		</tr>
		<tr>
			<td>0.1% Gelatin in H2O</td>
			<td>stemcell technologies</td>
			<td>#07903</td>
			<td></td>
		</tr>
		<tr>
			<td>Stericup-GV Sterile Vacuum Filtration System</td>
			<td>EMD Millipore</td>
			<td>SCGVU05RE</td>
			<td>Use to sterilize the transfection buffer and 0.5 mM EDTA in DPBS</td>
		</tr>
		<tr>
			<td>2-Mercaptoethanol</td>
			<td>ThermoFisher Scientific</td>
			<td>21985023</td>
			<td></td>
		</tr>
		<tr>
			<td>6-well plates (tissue culture treated)</td>
			<td>Corning</td>
			<td>3516</td>
			<td></td>
		</tr>
		<tr>
			<td>DMEM/F12</td>
			<td>ThermoFisher Scientific</td>
			<td>11320033</td>
			<td></td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>Fisher</td>
			<td>26-140-079</td>
			<td></td>
		</tr>
		<tr>
			<td>FGF Basic</td>
			<td>ThermoFisher Scientific</td>
			<td>phg0263</td>
			<td></td>
		</tr>
		<tr>
			<td>GlutaMax Supplement</td>
			<td>ThermoFisher Scientific</td>
			<td>35050061</td>
			<td>Glutamine supplement used for the prepration of media</td>
		</tr>
		<tr>
			<td>Heat Inactivated FBS</td>
			<td>Gibco Technologies</td>
			<td>10438026</td>
			<td></td>
		</tr>
		<tr>
			<td>KnockOut Serum Replacement</td>
			<td>ThermoFisher Scientific</td>
			<td>10828010</td>
			<td></td>
		</tr>
		<tr>
			<td>Lipofectamine RNAiMAX Transfection Reagent</td>
			<td>ThermoFisher Scientific</td>
			<td>13778500</td>
			<td>The protocol is optimized for the Lipofectamine RNAiMax transfection reagent</td>
		</tr>
		<tr>
			<td>MEM</td>
			<td>ThermoFisher Scientific</td>
			<td>11095080</td>
			<td></td>
		</tr>
		<tr>
			<td>MEM Non-essential amino acids</td>
			<td>ThermoFisher Scientific</td>
			<td>11140050</td>
			<td></td>
		</tr>
		<tr>
			<td>Opti-MEM I Reduced Serum Medium</td>
			<td>ThermoFisher Scientific</td>
			<td>31985070</td>
			<td>Reduced-serum medium, use to make the transfection buffer by adjusting the pH to 8.2, 500 mL</td>
		</tr>
		<tr>
			<td>Opti-MEM I Reduced Serum Medium</td>
			<td>ThermoFisher Scientific</td>
			<td>31985062</td>
			<td>Reduced-serum medium, use to make the transfection buffer by adjusting the pH to 8.2, 100 mL</td>
		</tr>
		<tr>
			<td>10 M NaOH</td>
			<td>Sigma-Aldrich</td>
			<td>72068</td>
			<td>Make a 1 M solution by diluting in nuclease free water and use for pH adjustment</td>
		</tr>
		<tr>
			<td>Water (Nuclease free, Not DEPC-treated)</td>
			<td>Fisher</td>
			<td>AM9932&#160;</td>
			<td>Use to dilute NaOH and wash a pH meter</td>
		</tr>
		<tr>
			<td>Pen/Strep/Fungizone</td>
			<td>GE Healthcare</td>
			<td>SV30079.01</td>
			<td></td>
		</tr>
		<tr>
			<td>rhLaminin-521</td>
			<td>ThermoFisher Scientific</td>
			<td>A29248</td>
			<td>Supplied at a concentration of 100 &#181;g/mL, use as a matrix for the reprogramming procedure</td>
		</tr>
		<tr>
			<td>Dulbecco&#39;s phosphate-buffered saline (DPBS)</td>
			<td>Life Technologies</td>
			<td>14190144</td>
			<td></td>
		</tr>
		<tr>
			<td>Trypsin-EDTA 0.25% Phenol Red</td>
			<td>Life Technologies</td>
			<td>2520056</td>
			<td></td>
		</tr>
		<tr>
			<td>Vaccinia Virus B18R (CF)</td>
			<td>ThermoFisher Scientific</td>
			<td>34-8185-86</td>
			<td></td>
		</tr>
		<tr>
			<td colspan="4">iPSC culture</td>
		</tr>
		<tr>
			<td>Corning Matrigel hESC-Qualified Matrix</td>
			<td>Corning</td>
			<td>354277</td>
			<td>Extracellular matrix (ECM) for culturing iPSCs</td>
		</tr>
		<tr>
			<td>EDTA, 0.5 M stock solution</td>
			<td>K&#38;D Medical&#160;</td>
			<td>RGF-3130</td>
			<td>Dilute to 0.5 mM in DPBS, filter sterilize and use for iPSC passaging</td>
		</tr>
		<tr>
			<td>mTeSR1</td>
			<td>StemCell Technologies</td>
			<td>85850</td>
			<td>Pluripotent stem cell (PSC) medium, provides growth advantage to iPSCs over fibroblasts</td>
		</tr>
		<tr>
			<td colspan="4">Antibodies and Detection</td>
		</tr>
		<tr>
			<td>Rabbit anti Mouse (HRP conjugated)</td>
			<td>Abcam</td>
			<td>ab97046</td>
			<td></td>
		</tr>
		<tr>
			<td>Tra-1-60 (mouse anti human)</td>
			<td>Stemgent</td>
			<td>09-0010</td>
			<td></td>
		</tr>
		<tr>
			<td>Hydrogen Peroxide (30%)</td>
			<td>LabChem</td>
			<td>LC154301</td>
			<td>Dilute to 3% with PBS</td>
		</tr>
		<tr>
			<td>Bovine Serum Albumin (BSA)</td>
			<td>Fisher</td>
			<td>BP9703100</td>
			<td></td>
		</tr>
		<tr>
			<td>Phosphate-buffered salin (PBS)&#160;</td>
			<td>Hyclone</td>
			<td>SH30258.02</td>
			<td>Supplied as 10x, dilute to 1x</td>
		</tr>
		<tr>
			<td>VECTOR NovaRED Peroxidase Substrate Kit</td>
			<td>Vector Laboratories</td>
			<td>SK-4800</td>
			<td></td>
		</tr>
		<tr>
			<td colspan="4">Special Equipment</td>
		</tr>
		<tr>
			<td>Description</td>
			<td></td>
			<td></td>
			<td>Notes</td>
		</tr>
		<tr>
			<td>Biological safety cabinet</td>
			<td></td>
			<td></td>
			<td></td>
		</tr>
		<tr>
			<td>Regular humidified tissue culture incubator</td>
			<td></td>
			<td></td>
			<td>Calibrate CO2 using digital meter, fyrite, or equivalent. Equilibrate incubator to 5% CO2, 37&#176;C.</td>
		</tr>
		<tr>
			<td>Tri-gas humidified tissue culture incubator</td>
			<td></td>
			<td></td>
			<td>Calibrate CO2 using digital meter, fyrite, or equivalent. Equilibrate incubator to 5% CO2, 5% O2, 37&#176;C. Use for the reprogramming procedure.</td>
		</tr>
		<tr>
			<td>pH Meter</td>
			<td></td>
			<td></td>
			<td>Must have resolution to two decimal places. Designate to RNA work if possible.</td>
		</tr>
		<tr>
			<td>Inverted microscope</td>
			<td></td>
			<td></td>
			<td>Microscope configured to visualize EGFP for monitoring transfection efficiency.</td>
		</tr>
	</tbody>
</table>

rna-based reprogramming of human primary fibroblasts into induced pluripotent stem cells

Induced pluripotent stem cells (iPSCs) have proven to be a valuable tool to study human development and disease. Further advancing iPSCs as a regenerative therapeutic requires a safe, robust, and expedient reprogramming protocol. Here, we present a clinically relevant, step-by-step protocol for the extremely high-efficiency reprogramming of human dermal fibroblasts into iPSCs using a non-integrating approach. The core of the protocol consists of expressing pluripotency factors (SOX2, KLF4, cMYC, LIN28A, NANOG, OCT4-MyoD fusion) from in vitro transcribed messenger RNAs synthesized with modified nucleotides (modified mRNAs). The reprogramming modified mRNAs are transfected into primary fibroblasts every 48 h together with mature embryonic stem cell-specific microRNA-367/302 mimics for two weeks. The resulting iPSC colonies can then be isolated and directly expanded in feeder-free conditions. To maximize efficiency and consistency of our reprogramming protocol across fibroblast samples, we have optimized various parameters including the RNA transfection regimen, timing of transfections, culture conditions, and seeding densities. Importantly, our method generates high-quality iPSCs from most fibroblast sources, including difficult-to-reprogram diseased, aged, and/or senescent samples.

It typically takes approximately 5&#8211;6 weeks from the initiation of fibroblast reprogramming to freezing of the first vials of iPSCs (Figure 1). The reprogramming protocol can be generally categorized into two phases. Phase 1 includes the fibroblast culture and seven transfections, with the reprogramming RNA cocktail performed every 48 h. Phase 2 includes isolation, expansion, and characterization of the iPSC colonies.
Before initiating the protocol, it should be ensured that the fibroblasts to be reprogrammed are of good quality. Healthy fibroblasts should appear spindle-shaped, bipolar, and refractile with a doubling time of approximately 24 h. By day 0, 250,000 cells plated into a 10 cm dish on day -2 should grow to 40&#8211;60% confluency (Figure 1, day 0) and yield approximately 6&#8211;10 x 105 cells. Cells proliferating at a slower rate can be compensated for by plating at a higher density on day -2 and on day 0 for reprogramming.
Fibroblasts should appear very sparse following plating into a well of a 6-well format dish for reprogramming (Figure 2, day 1). Twenty-four hours following the first transfection, fibroblasts will lose their spindle shape and adopt a more rounded morphology (Figure 2, day 2), which is maintained through the remainder of reprogramming. Green fluorescence from mWasabi mRNA should be minimally observable on day 2 and steadily increase in brightness to be clearly visible by day 4. The ability to detect mWasabi fluorescence can depend on scope sensitivity and setup. Cell density will gradually and consistently increase throughout the first three transfections (days 1-6), with an apparent burst in proliferation occurring between days 7 and 8. The cells should appear largely confluent by day 10 (Figure 2, day 10). The first iPSC colonies can appear as early as day 11 (Figure 2, day 11); however, colonies may not be observable until as late as day 18. Generally, by days 15&#8211;18, there will be large and obvious iPSC colonies that are clearly distinct from surrounding, incompletely reprogrammed fibroblasts (Figure 2, day 15 and Figure 3, day 17). Immunostaining for the pluripotency marker TRA-1-60 can be performed to assess reprogramming efficiency (Figure 3, day 17, TRA-1-60). In our experience, most fibroblast lines yield hundreds of colonies per reprogrammed well (Figure 3, inset B).
Suboptimal plating density is the most common reason for reduced efficiency of reprogramming in our protocol and is frequently associated with fibroblasts that are diseased, senescent, and/or high-passage. If plating density is too low, there will be large acellular barren patches at the end of reprogramming (Figure 4C), and iPSC colonies may not form (Figure 4D). Reprogrammed cells should be very confluent by day 14 (compare Figure&#160;4A and 4B to Figure 2, day 14). Similarly, if cells are plated too densely or proliferate too quickly, reprogramming efficiency is dramatically reduced.
To maintain homogeneity of patient-derived iPSCs, it is important to expand cell lines from a single colony. Since reprogramming efficiency is very high in our protocol, neighboring iPSC colonies may form in close proximity to and grow into each another (Figure 3, days 15&#8211;17). This sometimes makes it difficult to mechanically separate a single colony for clonal expansion. We have found that it is helpful to first passage a reprogrammed well and dilute it across a larger culture area. A good passage ratio consists of evenly splitting a reprogrammed 6-well-format plate well across an entire 6-well plate.
Following the dilution passage, iPSCs grow as colonies and are easily distinguishable from fibroblasts (Figure 5, day 18). Initially, iPSC colonies may be loosely packed, and individual cells have a relatively large cytoplasmic area. Over the course of 4&#8211;7 days, the iPSCs proliferate and form a characteristic tightly-packed colony with defined edges. Individual cells within the colony have a large nuclear fraction with prominent nucleoli (Figure 5, day 22). There should be many colonies that form in each well, and only those with classic iPSC morphology should be picked for expansion.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/58687/58687fig1.jpg" /> 
Figure 1: Reprogramming of human fibroblasts into induced pluripotent stem cells (iPSCs). A schematic protocol for the reprogramming of human fibroblasts is presented. Fibroblasts are first passaged at a low density into a well of a 6-well format dish, followed by seven transfections performed at 48 h intervals. Medium is replaced 16&#8211;20 h after each transfection. Reprogrammed iPSCs are first passaged at approximately day 18, and clonal colonies are picked by day 26. Typically, fibroblast-derived iPSC lines can be frozen for long-term storage by day 38. <a href="https://www.jove.com/files/ftp_upload/58687/58687fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/58687/58687fig2.jpg" /> 
Figure 2: Representative daily images during each day of reprogramming. Fibroblasts should be approximately&#160;40&#8211;60% confluent at the time of passage to initiate reprogramming (day 0, cells are plated in a 10 cm dish). The first transfection (T1) occurs on day 1, and the cells should appear very sparse at this point. The following day (day 2), a more rounded morphology should become apparent. Cells will continue to increase in density throughout the protocol with iPSC clusters beginning to appear as early as day 11 (circled in red). By day 15, iPSC colonies will be large with discreet boundaries. Scale bar = 200 &#181;m. <a href="https://www.jove.com/files/ftp_upload/58687/58687fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/58687/58687fig3.jpg" /> 
Figure 3: Colony formation following transfections with reprogramming modified mRNAs and miRNA mimics. Low-magnification images were taken of a representative reprogramming on days 15&#8211;17. Following the final transfection, reprogrammed iPSCs will form clear colonies with defined boundaries that expand in size and condense to become clearly distinct from incompletely reprogrammed surrounding fibroblasts. Immunostaining for the pluripotency marker TRA-1-60 indicates the presence of iPSCs (inset A) and can be used for calculation of reprogramming efficiency by counting all colonies within a single well (inset B, examples of countable colonies circled in green). Scale bar = 1 mm. <a href="https://www.jove.com/files/ftp_upload/58687/58687fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/58687/58687fig4.jpg" /> 
Figure 4: Representative images of sub-optimal plating density for reprogramming. (A, B) Examples of fibroblasts that are too sparse by day 14 of reprogramming (compare to Figure 2, day 14). (C) Low magnification image on day 17 of reprogramming with a large, barren patch circled in red. (D) The same well was fixed and stained for TRA-1-60 to confirm overall poor reprogramming efficiency due to low cell density. Scale bars = 200 &#181;m (A, B),&#160;and 1 mm (C, D). <a href="https://www.jove.com/files/ftp_upload/58687/58687fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 5" class="xfigimg" src="/files/ftp_upload/58687/58687fig5.jpg" /> 
Figure 5: Representative images of iPSCs after initial passage. After completing transfections with reprogramming modified mRNAs and miRNA mimics, reprogrammed cells are passaged by days 17&#8211;20. iPSCs have a growth advantage in PSC medium and rapidly overtake any fibroblasts that were incompletely reprogrammed. Initially, iPSCs will form colonies that may appear loose with poorly defined borders. Within several days, the cells rapidly proliferate and take on the characteristic morphology of tightly packed cells with a high nucleus-to-cytoplasm ratio, tightly clustering into colonies with distinct borders. Scale bar = 200 &#181;m.&#160;<a href="https://www.jove.com/files/ftp_upload/58687/58687fig5large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about RNA-based Reprogramming of Human Primary Fibroblasts into Induced Pluripotent Stem Cells at JoVE.com

RNA-based Reprogramming of Human Primary Fibroblasts into Induced Pluripotent Stem Cells

Here we describe a clinically relevant, high-efficiency, feeder-free method to reprogram human primary fibroblasts into induced pluripotent stem cells using modified mRNAs encoding reprogramming factors and mature microRNA-367/302 mimics. Also included are methods to assess reprogramming efficiency, expand clonal iPSC colonies, and confirm expression of the pluripotency marker TRA-1-60.

Induced pluripotent stem cells (iPSCs) have proven to be a valuable tool to study human development and disease. Further advancing iPSCs as a regenerative ...

Research

JoVE Journal

Developmental Biology

Isolation and Quantitative Immunocytochemical Characterization of Primary Myogenic Cells and Fibroblasts from Human Skeletal Muscle

The repair and regeneration of skeletal muscle requires the action of satellite cells, which are the resident muscle stem cells. These can be isolated ...

Three-dimensional Quantification of Dendritic Spines from Pyramidal Neurons Derived from Human Induced Pluripotent Stem Cells

Dendritic spines are small protrusions that correspond to the post-synaptic compartments of excitatory synapses in the central nervous system. They are ...

Cultivate Primary Nasal Epithelial Cells from Children and Reprogram into Induced Pluripotent Stem Cells

Nasal epithelial cells (NECs) are the part of the airways that respond to air pollutants and are the first cells infected with respiratory viruses. They ...

In Vitro Differentiation of Human Pluripotent Stem Cells into Trophoblastic Cells

In Vitro Differentiation of Human Pluripotent Stem Cells into Trophoblastic Cells

The placenta is the first organ to develop during embryogenesis and is required for the survival of the developing embryo. The placenta is comprised of ...

Differentiating Chondrocytes from Peripheral Blood-derived Human Induced Pluripotent Stem Cells

In this study, we used peripheral blood cells (PBCs) as seed cells to produce chondrocytes via induced pluripotent stem cells (iPSCs) in an ...

Rapid, Directed Differentiation of Retinal Pigment Epithelial Cells from Human Embryonic or Induced Pluripotent Stem Cells

We describe a robust method to direct the differentiation of pluripotent stem cells into retinal pigment epithelial cells (RPE). The purpose of providing ...

Suppression of Pro-fibrotic Signaling Potentiates Factor-mediated Reprogramming of Mouse Embryonic Fibroblasts into Induced Cardiomyocytes

Trans-differentiation of one somatic cell type into another has enormous potential to model and treat human diseases. Previous studies have shown that ...

Efficient Differentiation of Human Pluripotent Stem Cells into Liver Cells

The liver detoxifies harmful substances, secretes vital proteins, and executes key metabolic activities, thus sustaining life. Consequently, liver ...

Generation of 3D Skin Organoid from Cord Blood-derived Induced Pluripotent Stem Cells

The skin is the body&#8217;s largest organ and has many functions. The skin acts as a physical barrier and protector of the body and regulates bodily ...

In Vitro Generation of Somite Derivatives from Human Induced Pluripotent Stem Cells

In response to signals such as WNTs, bone morphogenetic proteins (BMPs), and sonic hedgehog (SHH) secreted from surrounding tissues, somites (SMs) give ...