We thank the late Dr Heidi Scrable for her generous gift of the mammalian lacI gene construct (Mayo Clinic, Rochester, MN), Dr Daniel Louvard (Institut Curie, Paris, France) for providing the Villin promoter, and Dr Laurie Jackson-Grusby (Children&#8217;s Hospital, Boston, MA) for her contributions to the early stages of this technology development. We are grateful for Dr Nancy Wu and Dr Robert Maxson for their assistance in generating the transgenic and knockout mice. We thank the members of the Laird laboratory for helpful discussions and support. This work was supported by the National Institutes of Health [R01 CA75090, R01 DA030325, R01 CA157918, and R01 CA212374 to P.W.L. and 1F31CA213897-01A1 to N.A.V.S].

PWL serves on the Scientific Advisory Boards of AnchorDx and Progenity, Inc.

A critical step and potential limitation of the REMOTE-control system is the challenge associated with the insertion of the repressor and/or activator binding sites without affecting target gene expression. Our original repression approach, as applied to the Dnmt1 gene, involved insertion of lac repressor binding sites within transcriptionally critical regions of a promoter. In order to reduce the risk of affecting promoter function and thus to improve the general applicability of the REMOTE-control system, we developed an intron-based repression approach. The potency of our enhanced lac system allowed us to tightly repress the transcription of all the strong promoters we tested at operators located hundreds to several kilobases downstream of the transcription start sites (Figure 3A&#8211;C)10. Importantly, the levels of repression were independent of the transcriptional strengths of the promoters (Figure 3A&#8211;C)10. This suggests that the repression capacity of our intron-based repression system exceeds the transcriptional strength of the tested promoters. In this intron-based approach, it is likely that the repression is mediated through physical interference between two components, the transcription elongation machinery and the lac repressors57. This simple repression mechanism and the demonstrated robustness of the intron-based method may render this approach generally applicable to different genes, tissues, and organisms.
The upregulation by the REMOTE-control system requires the transactivator binding sequences to be in proximity to the target gene promoter, which entails a risk of affecting promoter function. However, we found that the position of binding sequences can be outside of the transcriptionally critical region. Both Dnmt1 and EF1&#945; promoters were robustly upregulated from tet operators located a couple of hundred bases upstream of the transcription start sites10. This relaxed constraint greatly reduces the chance of affecting promoter function of a target gene in the absence of the transactivator. Increasing the&#160;number of binding sequences and/or use of stronger transactivators could help further reduce the risk by enabling upregulation from sites farther away from the transcription start site.
Our REMOTE-control system provides elegant control of the level, timing, and location of endogenous gene expression, allowing for testing the reversibility of a phenotype and the consequences of different expression levels, which are not readily achievable by current in vivo gene expression-control technologies. It is important to note that in most gene expression analyses, including ours, expression values represent the average of a population of cells among which considerable variation can be found. This heterogeneity may influence cellular decision-making processes, such as differentiation or apoptosis58. Though the precision of gene expression control could likely be further improved by additional genetic circuit engineering59, the observed potency of our current system will allow useful investigation of gene function in many biological contexts. In addition, a high degree of target specificity is expected because of the complexity of the operator sequences as well as the large evolutionary distance between mammals and the originating species of the regulatory components60. Furthermore, transgenic mouse lines of repressors and activators can be developed and employed for any endogenous gene. For example, existing tet transactivator mouse models can be adapted to accomplish upregulation of a target gene in the desired mouse tissues. We recently developed a transgenic line that can drive robust tissue-specific expression of our enhanced lac repressor in multiple tissue types when combined with existing Cre lines by introducing the lacIGY gene into the Hipp11 locus48 under the control of a Lox-STOP-Lox element (unpublished). This line would substantially facilitate the tissue-specific application of the REMOTE-control system.
Gene upregulation by the REMOTE-control system provides several advantages in comparison to current inducible transgenic approaches. It does not require generation of multiple transgenic lines to test for position effects of the insertion, as it utilizes the endogenous locus. Additionally, this approach is well-suited for upregulation of genes with strong baseline expression because it enhances expression from an already robust promoter, whereas conventional transgenic models rely on minimal viral promoters. Lastly, the tissue specificity, cell-cycle control, and splicing variants of a target gene may be retained upon upregulation by our approach, as it preserves elements of natural regulation such as innate cis-regulatory elements. The advent of CRISPR/Cas-mediated gene-targeting technology will greatly facilitate the application of this technology in diverse model systems.

Genetic knockout or transgenic approaches have been&#160;effective means to study gene function in animal models. However, expression regulation by these approaches is dichotomous (on/off), non-temporal, and thus is not capable of revealing the complete functional spectrum of a gene. Conditional Cre/LoxP technologies have allowed spatio-temporal inactivation or activation of gene function, but their dichotomous nature continues to pose limitations, such as cell lethality and irreversibility1,2,3. In order to fill this void, conditional knockdown approaches have been developed using tet-regulated shRNA or miRNA4. However, off-target effects remain a concern for RNAi5 and have been challenging to control in vivo. More recently, CRISPR/Cas-mediated transcriptional-control technologies have introduced a more versatile approach to achieving both up- and downregulation of endogenous gene expression and demonstrated their utilities6,7. However, the effectiveness of CRISPR/Cas-mediated transcriptional control is as yet unclear in vivo, and the reversibility of KRAB-based repression remains to be seen, as strong repression by KRAB and its interacting protein KAP1 has been shown to induce permanent gene silencing8,9.
In order to address these limitations, we have developed a novel transcriptional regulatory system capable of conditionally controlling endogenous gene expression in a reversible and tunable manner in mice using engineered prokaryotic binary transcriptional regulatory systems10. Prokaryotic binary transcriptional regulatory systems with regulatory ligands, such as lac and tet, have enabled such reversible and tunable expression control11,12,13,14. However, the inadequate repression potency of the current binary systems has impeded their broad adoption for controlling endogenous gene expression in mammals. We developed an enhanced lac repression system sufficiently potent for the repression of endogenous genes and employed a novel strategy of targeting tet transcriptional activators directly to the cognate promoter of an endogenous gene to achieve robust upregulation (Figure 1)10. With this technology, we have achieved nearly two orders of magnitude expression control of the endogenous Dnmt1 gene in a tunable, inducible, and reversible manner10. Here we provide step-by-step instructions for its in vivo application to other genes and organisms using mice as a model species.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/59235/59235fig1.jpg" /> 
Figure 1: Overview of the REMOTE-control system. The transcription of an endogenous target gene can be regulated using engineered lac repressor and tet activator systems. The target gene promoter or intron is engineered to contain operators for the tight-binding LacIGY repressor and/or the rtTA-M2 activator. R indicates Repron (Repression intron), which contains 12 symmetric lac operators (S) plus a partial rabbit beta-globin intron. T indicates tet operator. The repressor and/or activator is/are expressed from a tissue-specific promoter. The expression of the target gene can then be reversibly tuned to the desired expression level by administration of IPTG (isopropyl &#946;-D-1-thiogalactopyranoside, an antagonist of the LacIGY repressor) or Doxycycline (Dox). This figure has been modified from Lee et al.10 <a href="https://www.jove.com/files/ftp_upload/59235/59235fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Before beginning this protocol, review Table 1 to identify the relevant steps for the desired control of gene expression. For example, to engineer a mouse that enables reversible downregulation of &#8220;Gene X&#8221;, complete sections 1, 3, and 4 of the below protocol. Table 1 also summarizes the needed components of the REMOTE-control system.
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>Desired Expression Change</td>
			<td>Repression only</td>
			<td>Activation only</td>
			<td>Both Repression and Activation</td>
		</tr>
		<tr>
			<td>Relevant Sections of Protocol</td>
			<td>1, 3-4</td>
			<td>2-4</td>
			<td>1-4</td>
		</tr>
		<tr>
			<td>REMOTE-control Sequence Needed in Target Gene</td>
			<td>Repron (&#34;Repression intron&#34;; 12 symmetric lac operators plus a partial rabbit beta-globin intron)</td>
			<td>Tet operator(s)</td>
			<td>Repron and Tet operator(s)</td>
		</tr>
		<tr>
			<td>REMOTE-control Sequence Location</td>
			<td>Intron</td>
			<td>Promoter</td>
			<td>Intron &#38; Promoter</td>
		</tr>
		<tr>
			<td>Activator/Repressor Needed for Desired Control</td>
			<td>LacIGY Repressor</td>
			<td>rtTA-M2 Activator</td>
			<td>LacIGY Repressor and rtTA-M2 Activator</td>
		</tr>
		<tr>
			<td>Regulatory Ligands</td>
			<td>IPTG</td>
			<td>Doxycycline</td>
			<td>IPTG and/or Doxycycline</td>
		</tr>
	</tbody>
</table>
Table 1: Overview of REMOTE-control components.

<table><tbody><tr><td>B6C3F1/J</td><td>The Jackson Laboratory</td><td>100010</td><td>https://www.jax.org/strain/100010</td></tr><tr><td>Cas9 Protein</td><td>PNA Bio</td><td>CP04</td><td>http://www.pnabio.com/products/CRISPR_Cas9.htm?gclid=EAIaIQobChMIsoG8pLL33QIVBr7ACh0naQ4dEAAYAiAAEgKyHvD_BwE</td></tr><tr><td>CRISPOR</td><td>Haeussler et al. 2016</td><td></td><td>http://crispor.tefor.net/</td></tr><tr><td>Doxycycline-Containing Mouse Diet</td><td>Envigo</td><td>Varies by concentration</td><td>https://www.envigo.com/products-services/teklad/laboratory-animal-diets/custom-research/doxycycline-diets/</td></tr><tr><td>ENCODE Database</td><td>Stanford University</td><td></td><td>https://www.encodeproject.org/</td></tr><tr><td>iCre mRNA synthesis plasmid (pBBI)</td><td>Addgene</td><td>65795</td><td>https://www.addgene.org/65795/</td></tr><tr><td>IPTG</td><td>GoldBio</td><td>I2481C</td><td>https://www.goldbio.com/search?isSearch=Y&amp;amp;q=iptg</td></tr><tr><td>pGL3-Basic</td><td>Promega</td><td>E1751</td><td>https://www.promega.com/products/reporter-assays-and-transfection/reporter-vectors-and-cell-lines/pgl3-luciferase-reporter-vectors/?catNum=E1751</td></tr><tr><td>SVM-BPfinder</td><td>Regulatory Genomics, Pompeu Fabra University</td><td></td><td>http://regulatorygenomics.upf.edu/Software/SVM_BP/</td></tr><tr><td>TiProD: Tissue specific promoter Database</td><td>Department of Bioinformatics, UMG,&amp;nbsp;University of G&amp;ouml;ttingen&amp;nbsp;</td><td></td><td>http://tiprod.bioinf.med.uni-goettingen.de</td></tr><tr><td>UCSC Genome Browser</td><td>University of California Santa Cruz</td><td></td><td>https://genome.ucsc.edu/</td></tr></tbody></table>

in vivo application of the remote-control system for the manipulation of endogenous gene expression

Here we describe a protocol for implementing the REMOTE-control system (Reversible Manipulation of Transcription at Endogenous loci), which allows for reversible and tunable expression control of an endogenous gene of interest in living model systems. The REMOTE-control system employs enhanced lac repression and tet activation systems to achieve down- or upregulation of a target gene within a single biological system. Tight repression can be achieved from repressor binding sites flexibly located far downstream of a transcription start site by inhibiting transcription elongation. Robust upregulation can be attained by enhancing the transcription of an endogenous gene by targeting tet transcriptional activators to the cognate promoter. This reversible and tunable expression control can be applied and withdrawn repeatedly in organisms. The potency and versatility of the system, as demonstrated for endogenous Dnmt1 here, will allow more precise in vivo functional analyses by enabling investigation of gene function at various expression levels and by testing the reversibility of a phenotype.

The repression capability of the REMOTE-control system has been demonstrated in two different approaches thus far. In the first approach, lac repressor binding sites were inserted at the endogenous promoter of the Dnmt1 gene. In the second approach, which is recommended by this protocol, the repressor binding sites were inserted into a downstream intron to avoid the potential risk of affecting promoter function by the insertion and thereby to simplify application of the REMOTE-control system. Both approaches resulted in successful repression (Figure 2A,B and Figure 3A-C)10. Dnmt1 expression was repressed to 15% of the unregulated levels using the promoter-based approach (Figure 2A). This tight repression was reversed in a dose-dependent manner by treating mice with varying amounts of IPTG (Figure 2A). The observed Dnmt1 repression was validated at the protein level by immunostaining (Figure 2B). We did not observe any noticeable difference in Dnmt1 expression between Dnmt1+/+ and Dnmt1LO/LO mice, confirming that our lac&#160;operator insertion had not disrupted normal promoter function10. The intron-based approach achieved more than 90% repression from operators located several kilobases downstream of the transcription start site by attenuating transcription elongation (Figure 3A, B)10. This intron-based approach was further validated on seven additional robust promoters (Figure 3C). Invariably tight repression was achieved from all of the promoters tested. No correlation between the residual expression levels and the strengths of the promoters was observed, suggesting that the repression capacity of our intron-based repression system exceeds the transcriptional potency of all of the robust promoters we tested (Figure 3C).
The in vivo upregulation capability of the REMOTE-control system was also demonstrated on the Dnmt1 gene. We introduced two copies of the tet operator into the Dnmt1 promoter, together with lac operator sequences, to allow for either upregulation or downregulation depending on which effector protein is present. Robust upregulation and downregulation of Dnmt1 expression, close to two orders of magnitude (10% to 650%), were achieved in ESCs containing the modified endogenous Dnmt1 allele (Dnmt1LGT) (Figure 4A)10. Both regulations were fully reversible and inducible by IPTG and Dox treatments, respectively (Figure 4A). We next introduced the Dnmt1LGT modification into the mouse germline to test the in vivo upregulation capability of the REMOTE-control system. Strong upregulation of Dnmt1 was observed from the liver, spleen, and kidney, whereas no detectable upregulation in the heart was observed (Figure 4B)7. The cell cycle-dependent expression pattern of Dnmt1 and the scarcity of proliferative cells in the heart may underlie this observation10,56. It remains to be seen whether this limitation can be overcome by increasing the expression level of the activator or the number of its binding sites.
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/59235/59235fig2.jpg" /> 
Figure 2: In vivo repression of Dnmt1 by the LacIGY repressor. (A) Mice with lac operators (LO) inserted into the Dnmt1 promoter, with or without expression of LacIGY, were treated with various doses of IPTG. qRT-PCR analysis of Dnmt1 expression shows the dose-dependent reversal of Dnmt1 repression in vivo by IPTG treatment. Each bar represents data from a different mouse. Data represent mean &#177; SEM (n = 3). (B) Immunostaining of Dnmt1 protein in colonic crypts of mice provided drinking water with or without 160 mM IPTG for 3 weeks. This figure has been modified from Lee et al.10 <a href="https://www.jove.com/files/ftp_upload/59235/59235fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/59235/59235fig3.jpg" /> 
Figure 3: In vivo and in vitro repression of various promoters by the REMOTE-control system. (A) An early version of the Repron sequence (R*) was inserted into an intron downstream of the Villin promoter in a Villin-mKate2 transgenic mouse (VilmKate2). qRT-PCR analysis of mKate2 expression in the small intestine of mice with or without the LacIGY repressor is shown. Each bar represents data from a different mouse. (B) Confocal mKate2 images of the small intestine with and without LacIGY expression. (C) Six symmetric lac operators (S) were inserted between various promoters and a luciferase reporter. Reporters (50 ng/well in 96-well plate) and repressor plasmids were transiently introduced into NIH/3T3 cells in a 1:1 molar ratio. Luciferase values were assessed 24 h after transfection. These in vitro data represent the percent of luciferase expression in LacIGY-expressing cells relative to those expressing non-functional LacI (NFlacI). T-tests were used to determine statistical significance. Data represent mean &#177; SEM (n = 3). *P &#8804; 0.05, **P &#8804; 0.01. This figure has been modified from Lee et al.10 <a href="https://www.jove.com/files/ftp_upload/59235/59235fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/59235/59235fig4.jpg" /> 
Figure 4: Down- and/or upregulation of Dnmt1 expression in vitro and in vivo. (A) The complete REMOTE-control system was engineered in cultured ESCs by gene targeting and electroporation approaches. Maximal repression of Dnmt1 expression was achieved with no treatment while maximal activation was achieved by both IPTG and Dox treatment. Data represent mean &#177; SEM (n = 3). *P &#8804; 0.05, **P &#8804; 0.01 (Welch&#8217;s t-tests). (B) In vivo activation of Dnmt1 by the REMOTE-control system, as demonstrated by immunostaining of Dnmt1 protein in various tissues from REMOTE-control mice. The LGT allele represents promoter modification of Dnmt1 to contain lac operator and tet activator binding sites. Mice were treated with a normal or Dox-containing diet (5000 mg/kg Doxycycline Hyclate) for one month. This figure has been modified from Lee et al.10 <a href="https://www.jove.com/files/ftp_upload/59235/59235fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Supplementary Figure 1" src="/files/ftp_upload/59235/59235supfig1.jpg" /> 
Supplementary Figure 1: Example of landing pad insertion into murine Dnmt1 intron 1. (A) Schematic of DNA template for landing pad insertion, adapted from Quadros et al. (2015)31. Heterotypic loxP sites, JT15 and Lox2272, are separated by a short spacer sequence (sp) and flanked on each side by 60-bp of DNA that is homologous to the target genomic region. (B) Sample DNA template for landing pad insertion into the Dnmt1 intron using the following sgRNA: CTAGTACCACTCCTGTACCG (which targets the reverse strand). The selected intronic region was bioinformatically informed by step 1.1, and the sgRNA was identified using CRISPOR29. (C) Example of PCR primer design for assessing insertion of the landing pad. PCR primers were designed outside of the homology arms of the template to confirm integration into endogenous Dnmt1. The wildtype PCR amplicon is 213 bp; upon insertion, it becomes 291 bp. <a href="https://www.jove.com/files/ftp_upload/59235/59235supfig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about In vivo Application of the REMOTE-control System for the Manipulation of Endogenous Gene Expression at JoVE.com

In vivo Application of the REMOTE-control System for the Manipulation of Endogenous Gene Expression

This protocol outlines the steps needed to generate a model system in which the transcription of an endogenous gene of interest can be conditionally controlled in live animals or cells using enhanced lac repressor and/or tet activator systems.

Here we describe a protocol for implementing the REMOTE-control system (Reversible Manipulation of Transcription at Endogenous loci), which allows for ...

in-vivo-application-remote-control-system-for-manipulation-endogenous

Research

JoVE Journal

Genetics

7.0K Views.  Van Andel Research Institute. This protocol outlines the steps needed to generate a model system in which the transcription of an endogenous gene of interest can be conditionally controlled in live animals or cells using enhanced lac repressor and/or tet activator systems.

Video: In vivo Application of the REMOTE-control System for the Manipulation of Endogenous Gene Expression

Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts

Controlling the expression or activity of specific genes through the myocardial delivery of genetic materials in murine models permits the investigation of gene functions. Their therapeutic potential in the heart can also be determined. There are limited approaches for in vivo molecular intervention in the mouse heart. Recombinant adeno-associated virus (rAAV)-based genome engineering has been utilized as an essential tool for in vivo cardiac gene manipulation. The specific advantages of this technology include high efficiency, high specificity, low genomic integration rate, minimal immunogenicity, and minimal pathogenicity. Here, a detailed procedure to construct, package, and purify the rAAV9 vectors is described. Subcutaneous injection of rAAV9 into neonatal pups results in robust expression or efficient knockdown of the gene(s) of interest in the mouse heart, but not in the liver and other tissues. Using the cardiac-specific TnnT2 promoter, high expression of GFP gene in the heart was obtained. Additionally, target mRNA was inhibited in the heart when a rAAV9-U6-shRNA was utilized. Working knowledge of rAAV9 technology may be useful for cardiovascular investigations.

In this manuscript, a method to prepare recombinant adeno-associated virus 9 (rAAV9) vectors to manipulate gene expression in the mouse heart is described.

Controlling the expression or activity of specific genes through the myocardial delivery of genetic materials in murine models permits the investigation ...

Controllable Ion Channel Expression through Inducible Transient Transfection

Transfection, the delivery of foreign nucleic acids into a cell, is a powerful tool in protein research. Through this method, ion channels can be investigated through electrophysiological analysis, biochemical characterization, mutational studies, and their effects on cellular processes. Transient transfections offer a simple protocol in which the protein becomes available for analysis within a few hours to days. Although this method presents a relatively straightforward and time efficient protocol, one of the critical components is calibrating the expression of the gene of interest to physiological relevant levels or levels that are suitable for analysis. To this end, many different approaches that offer the ability to control the expression of the gene of interest have emerged. Several stable cell transfection protocols provide a way to permanently introduce a gene of interest into the cellular genome under the regulation of a tetracycline-controlled transcriptional activation. While this technique produces reliable expression levels, each gene of interest requires a few weeks of skilled work including calibration of a killing curve, selection of cell colonies, and overall more resources. Here we present a protocol that uses transient transfection of the Transient Receptor Potential cation channel subfamily V member 1 (TRPV1) gene in an inducible system as an efficient way to express a protein in a controlled manner which is essential in ion channel analysis. We demonstrate that using this technique, we are able to perform calcium imaging, whole cell, and single channel analysis with controlled channel levels required for each type of data collection with a single transfection. Overall, this provides a replicable technique that can be used to study ion channels structure and function.

Studying ion channels through a heterologously expressing system has become a core technique in biomedical research. In this manuscript, we present a time efficient method to achieve tightly controlled ion channel expression by performing transient transfection under the control of an inducible promoter.

Transfection, the delivery of foreign nucleic acids into a cell, is a powerful tool in protein research. Through this method, ion channels can be ...

Constitutive and Inducible Systems for Genetic In Vivo Modification of Mouse Hepatocytes Using Hydrodynamic Tail Vein Injection

In research models of liver cancer, regeneration, inflammation, and fibrosis, flexible systems for in vivo gene expression and silencing are highly useful. Hydrodynamic tail vein injection of transposon-based constructs is an efficient method for genetic manipulation of hepatocytes in adult mice. In addition to constitutive transgene expression, this system can be used for more advanced applications, such as shRNA-mediated gene knock-down, implication of the CRISPR/Cas9 system to induce gene mutations, or inducible systems. Here, the combination of constitutive CreER expression together with inducible expression of a transgene or miR-shRNA of choice is presented as an example of this technique. We cover the multi-step procedure starting from the preparation of sleeping beauty-transposon constructs, to the injection and treatment of mice, and the preparation of liver tissue for analysis by immunostaining. The system presented is a reliable and efficient approach to achieve complex genetic manipulations in hepatocytes. It is specifically useful in combination with Cre/loxP-based mouse strains and can be applied to a variety of models in the research of liver disease.

Constitutive and Inducible Systems for Genetic In Vivo Modification of Mouse Hepatocytes Using Hydrodynamic Tail Vein Injection

Hydrodynamic tail vein injection of transposon-based integration vectors enables stable transfection of murine hepatocytes in vivo. Here, we present a practical protocol for transfection systems that enables the long-term constitutive expression of a single transgene or combined constitutive and doxycycline-inducible expression of a transgene or miR-shRNA in the liver.

In research models of liver cancer, regeneration, inflammation, and fibrosis, flexible systems for in vivo gene expression and silencing are highly ...

In vivo Electroporation of Developing Mouse Retina

The functional characterization of genes expressed during mammalian retinal development remains a significant challenge. Gene targeting to generate constitutive or conditional loss of function knockouts remains cost and labor intensive, as well as time consuming. Adding to these challenges, retina expressed genes may have essential roles outside the retina leading to unintended confounds when using a knockout approach. Furthermore, the ability to ectopically express a gene in a gain of function experiment can be extremely valuable when attempting to identify a role in cell fate specification and/or terminal differentiation.
We present a method for the rapid and efficient incorporation of DNA plasmids into the neonatal mouse retina by electroporation. The application of short electrical impulses above a certain field strength results in a transient increase in plasma membrane permeability, facilitating the transfer of material across the membrane 1,2,3,4. Groundbreaking work demonstrated that electroporation could be utilized as a method of gene transfer into mammalian cells by inducing the formation of hydrophilic plasma membrane pores allowing the passage of highly charged DNA through the lipid bilayer 5. Continuous technical development has resulted in the viability of electroporation as a method for in vivo gene transfer in multiple mouse tissues including the retina, the method for which is described herein 6, 7, 8, 9, 10. 
DNA solution is injected into the subretinal space so that DNA is placed between the retinal pigmented epithelium and retina of the neonatal (P0) mouse and electrical pulses are applied using a tweezer electrode. The lateral placement of the eyes in the mouse allows for the easy orientation of the tweezer electrode to the necessary negative pole-DNA-retina-positive pole alignment. Extensive incorporation and expression of transferred genes can be identified by postnatal day 2 (P2). Due to the lack of significant lateral migration of cells in the retina, electroporated and non-electroporated regions are generated. Non-electroporated regions may serve as internal histological controls where appropriate. 
Retinal electroporation can be used to express a gene under a ubiquitous promoter, such as CAG, or to disrupt gene function using shRNA constructs or Cre-recombinase. More targeted expression can be achieved by designing constructs with cell specific gene promoters. Visualization of electroporated cells is achieved using bicistronic constructs expressing GFP or by co-electroporating a GFP expression construct. Furthermore, multiple constructs may be electroporated for the study of combinatorial gene effects or simultaneous gain and loss of function of different genes. Retinal electroporation may also be utilized for the analysis of genomic cis-regulatory elements by generating appropriate expression constructs and deletion mutants. Such experiments can be used to identify cis-regulatory regions sufficient or required for cell specific gene expression 11. Potential experiments are limited only by construct availability.

In vivo Electroporation of Developing Mouse Retina

A method for the incorporation of plasmid DNA into murine retinal cells for the purpose of performing either gain- or loss of function studies in vivo is presented. This method capitalizes on the transient increase in permeability of cell plasma membranes induced by the application of an external electrical field.

The functional characterization of genes expressed during mammalian retinal development remains a significant challenge.  Gene targeting to generate ...

Neuroscience

In ovo Expression of MicroRNA in Ventral Chick Midbrain

Non-coding RNAs are additional players in regulating gene expression. Targeted in ovo electroporation of specific areas provides a unique tool for spatial and temporal control of ectopic microRNA expression. However, ventral brain structures like ventral midbrain are rather difficult to reach for any manipulations. Here, we demonstrate an efficient way to electroporate miRNA into ventral midbrain using thin platinum electrodes. This method offers a reliable way to transfect specific areas of the midbrain and a useful tool for in vivo studies.

In ovo Expression of MicroRNA in Ventral Chick Midbrain

Ectopic expression is one technique to elucidate the microRNAs role in brain development. However, targeting specific areas using in ovo electroporation is challenging. Here, we show an efficient way to selectively electroporate ventral and dorsal midbrain regions.

Non-coding RNAs are additional players in regulating gene expression. Targeted in ovo electroporation of specific areas provides a unique tool for spatial ...

Stereotaxic Injection of a Viral Vector for Conditional Gene Manipulation in the Mouse Spinal Cord

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central nervous system. We demonstrate a stereotaxic injection technique that allows targeted gene expression or silencing in the dorsal horn of the mouse spinal cord. The surgical procedure is brief. It requires laminectomy of a single vertebra, providing for quick recovery of the animal and unimpaired motility of the spine. Controlled injection of a small vector suspension volume at low speed and use of a microsyringe with beveled glass cannula minimize the tissue lesion. The local immune response to the vector depends on the intrinsic properties of the virus employed; in our experience, it is minor and short-lived when a recombinant adeno-associated virus is used. A reporter gene such as enhanced green fluorescent protein facilitates monitoring spatial distribution of the vector, and the efficacy and cellular specificity of the transfection.

Viral vectors allow for targeted gene manipulation. We demonstrate a method for conditional gene expression or ablation in the mouse spinal cord, using stereotaxic injection of a viral vector into the dorsal horn, a prominent site of synaptic contact between primary somatosensory afferents and neurons of the central nervous system.

Intraparenchymal injection of a viral vector enables conditional gene manipulation in distinct populations of neurons or particular regions of the central ...

Designing, Packaging, and Delivery of High Titer CRISPR Retro and Lentiviruses via Stereotaxic Injection

Replication defective lentiviruses or retroviruses are capable of stably integrating transgenes into the genome of an infected host cell. This technique has been widely used to encode fluorescent proteins, opto- or chemo-genetic controllers of cell activity, or heterologous expression of human genes in model organisms. These viruses have also successfully been used to deliver recombinases to relevant target sites in transgenic animals, or even deliver small hairpin or micro RNAs in order to manipulate gene expression. While these techniques have been fruitful, they rely on transgenic animals (recombinases) or frequently lack high efficacy and specificity (shRNA/miRNA). In contrast, the CRISPR/Cas system uses an exogenous Cas nuclease which targets specific sites in an organism's genome via an exogenous guide RNA in order to induce double stranded breaks in DNA. These breaks are then repaired by non-homologous end joining (NHEJ), producing insertion and deletion (indel) mutations that can result in deleterious missense or nonsense mutations. This manuscript provides detailed methods for the design, production, injection, and validation of single lenti/retro virus particles that can stably transduce neurons to express a fluorescent reporter, Cas9, and sgRNAs to knockout genes in a model organism.

The CRISPR/Cas9 system offers the potential to make targeted genome editing accessible and affordable to the scientific community. This protocol is intended to demonstrate how to create viruses that will knockout a gene of interest using the CRISPR/Cas9 system, and then inject them stereotaxically into the adult mouse brain.

Replication defective lentiviruses or retroviruses are capable of stably integrating transgenes into the genome of an infected host cell. This technique ...

Reliably Engineering and Controlling Stable Optogenetic Gene Circuits in Mammalian Cells

Reliable gene expression control in mammalian cells requires tools with high fold change, low noise, and determined input-to-output transfer functions, regardless of the method used. Toward this goal, optogenetic gene expression systems have gained much attention over the past decade for spatiotemporal control of protein levels in mammalian cells. However, most existing circuits controlling light-induced gene expression vary in architecture, are expressed from plasmids, and utilize variable optogenetic equipment, creating a need to explore characterization and standardization of optogenetic components in stable cell lines. Here, the study provides an experimental pipeline of reliable gene circuit construction, integration, and characterization for controlling light-inducible gene expression in mammalian cells, using a negative feedback optogenetic circuit as a case example. The protocols also illustrate how standardizing optogenetic equipment and light regimes can reliably reveal gene circuit features such as gene expression noise and protein expression magnitude. Lastly, this paper may be of use for laboratories unfamiliar with optogenetics who wish to adopt such technology. The pipeline described here should apply for other optogenetic circuits in mammalian cells, allowing for more reliable, detailed characterization and control of gene expression at the transcriptional, proteomic, and ultimately phenotypic level in mammalian cells.

Reliably controlling light-responsive mammalian cells requires the standardization of optogenetic methods. Toward this goal, this study outlines a pipeline of gene circuit construction, cell engineering, optogenetic equipment operation, and verification assays to standardize the study of light-induced gene expression using a negative-feedback optogenetic gene circuit as a case study.

Reliable gene expression control in mammalian cells requires tools with high fold change, low noise, and determined input-to-output transfer functions, ...

Bioengineering

AAV Deployment of Enhancer-Based Expression Constructs In Vivo in Mouse Brain

Enhancers are binding platforms for a diverse array of transcription factors that drive specific expression patterns of tissue- and cell-type-specific genes. Multiple means of assessing non-coding DNA and various chromatin states have proven useful in predicting the presence of enhancer sequences in the genome, but validating the activity of these sequences and finding the organs and developmental stages they are active in is a labor-intensive process. Recent advances in adeno-associated virus (AAV) vectors have enabled the widespread delivery of transgenes to mouse tissues, enabling in vivo enhancer testing without necessitating a transgenic animal. This protocol shows how a reporter construct that expresses EGFP under the control of a minimal promoter, which does not drive significant expression on its own, can be used to study the activity patterns of candidate enhancer sequences in the mouse brain. An AAV-packaged reporter construct is delivered to the mouse brain and incubated for 1-4 weeks, after which the animal is sacrificed, and brain sections are observed under a microscope. EGFP appears in cells in which the tested enhancer is sufficient to initiate gene expression, pinpointing the location and developmental stage in which the enhancer is active in the brain. Standard cloning methods, low-cost AAV packaging, and expanding AAV serotypes and methods for in vivo delivery and standard imaging readout make this an accessible approach for the study of how gene expression is regulated in the brain.

AAV Deployment of Enhancer-Based Expression Constructs In Vivo in Mouse Brain

This protocol describes a novel rAAV-based transient enhancer-reporter assay. This assay can be used to induce enhancer-driven expression in vivo in the mouse brain.

Enhancers are binding platforms for a diverse array of transcription factors that drive specific expression patterns of tissue- and cell-type-specific ...

A Simple and Efficient Method for In Vivo Cardiac-specific Gene Manipulation by Intramyocardial Injection in Mice

Gene manipulation specifically in the heart significantly potentiate the investigation of cardiac disease pathomechanisms and their therapeutic potential. In vivo cardiac-specific gene delivery is commonly achieved by either systemic or local delivery. Systemic injection via tail vein is easy and efficient in manipulating cardiac gene expression by using recombinant adeno-associated virus 9 (AAV9). However, this method requires a relatively high amount of vector for efficient transduction, and may result in nontarget organ gene transduction. Here, we describe a simple, efficient, and time-saving method of intramyocardial injection for in vivo cardiac-specific gene manipulation in mice. Under anesthesia (without ventilation), the pectoral major and minor muscles were bluntly dissected, and the mouse heart was quickly exposed by manual externalization through a small incision at the fourth intercostal space. Subsequently, adenovirus encoding luciferase (Luc) and vitamin D receptor (VDR), or short hairpin RNA (shRNA) targeting VDR, was injected with a Hamilton syringe into the myocardium. Subsequent in vivo imaging demonstrated that luciferase was successfully overexpressed specifically in the heart. Moreover, Western blot analysis confirmed the successful overexpression or silencing of VDR in the mouse heart. Once mastered, this technique can be used for gene manipulation, as well as injection of cells or other materials such as nanogels in the mouse heart.

A Simple and Efficient Method for In Vivo Cardiac-specific Gene Manipulation by Intramyocardial Injection in Mice

Here we present a protocol for cardiac-specific gene manipulation in mice. Under anesthesia, the mouse hearts were externalized through the fourth intercostal space. Subsequently, adenoviruses encoding specific genes were injected with a syringe into the myocardium, followed by protein expression measurement via in vivo imaging and Western blot analysis.

Gene manipulation specifically in the heart significantly potentiate the investigation of cardiac disease pathomechanisms and their therapeutic potential. ...

In vivo Application of the REMOTE-control System for the Manipulation of Endogenous Gene Expression

Summary

Explore More Videos

Chapters in this video

Preparation of rAAV9 to Overexpress or Knockdown Genes in Mouse Hearts

Controllable Ion Channel Expression through Inducible Transient Transfection

Constitutive and Inducible Systems for Genetic In Vivo Modification of Mouse Hepatocytes Using Hydrodynamic Tail Vein Injection

In vivo Electroporation of Developing Mouse Retina

In ovo Expression of MicroRNA in Ventral Chick Midbrain

Stereotaxic Injection of a Viral Vector for Conditional Gene Manipulation in the Mouse Spinal Cord

Designing, Packaging, and Delivery of High Titer CRISPR Retro and Lentiviruses via Stereotaxic Injection

Reliably Engineering and Controlling Stable Optogenetic Gene Circuits in Mammalian Cells

AAV Deployment of Enhancer-Based Expression Constructs In Vivo in Mouse Brain

A Simple and Efficient Method for In Vivo Cardiac-specific Gene Manipulation by Intramyocardial Injection in Mice