We thank the late Dr Heidi Scrable for her generous gift of the mammalian lacI gene construct (Mayo Clinic, Rochester, MN), Dr Daniel Louvard (Institut Curie, Paris, France) for providing the Villin promoter, and Dr Laurie Jackson-Grusby (Children&#8217;s Hospital, Boston, MA) for her contributions to the early stages of this technology development. We are grateful for Dr Nancy Wu and Dr Robert Maxson for their assistance in generating the transgenic and knockout mice. We thank the members of the Laird laboratory for helpful discussions and support. This work was supported by the National Institutes of Health [R01 CA75090, R01 DA030325, R01 CA157918, and R01 CA212374 to P.W.L. and 1F31CA213897-01A1 to N.A.V.S].

PWL serves on the Scientific Advisory Boards of AnchorDx and Progenity, Inc.

A critical step and potential limitation of the REMOTE-control system is the challenge associated with the insertion of the repressor and/or activator binding sites without affecting target gene expression. Our original repression approach, as applied to the Dnmt1 gene, involved insertion of lac repressor binding sites within transcriptionally critical regions of a promoter. In order to reduce the risk of affecting promoter function and thus to improve the general applicability of the REMOTE-control system, we developed an intron-based repression approach. The potency of our enhanced lac system allowed us to tightly repress the transcription of all the strong promoters we tested at operators located hundreds to several kilobases downstream of the transcription start sites (Figure 3A&#8211;C)10. Importantly, the levels of repression were independent of the transcriptional strengths of the promoters (Figure 3A&#8211;C)10. This suggests that the repression capacity of our intron-based repression system exceeds the transcriptional strength of the tested promoters. In this intron-based approach, it is likely that the repression is mediated through physical interference between two components, the transcription elongation machinery and the lac repressors57. This simple repression mechanism and the demonstrated robustness of the intron-based method may render this approach generally applicable to different genes, tissues, and organisms.
The upregulation by the REMOTE-control system requires the transactivator binding sequences to be in proximity to the target gene promoter, which entails a risk of affecting promoter function. However, we found that the position of binding sequences can be outside of the transcriptionally critical region. Both Dnmt1 and EF1&#945; promoters were robustly upregulated from tet operators located a couple of hundred bases upstream of the transcription start sites10. This relaxed constraint greatly reduces the chance of affecting promoter function of a target gene in the absence of the transactivator. Increasing the&#160;number of binding sequences and/or use of stronger transactivators could help further reduce the risk by enabling upregulation from sites farther away from the transcription start site.
Our REMOTE-control system provides elegant control of the level, timing, and location of endogenous gene expression, allowing for testing the reversibility of a phenotype and the consequences of different expression levels, which are not readily achievable by current in vivo gene expression-control technologies. It is important to note that in most gene expression analyses, including ours, expression values represent the average of a population of cells among which considerable variation can be found. This heterogeneity may influence cellular decision-making processes, such as differentiation or apoptosis58. Though the precision of gene expression control could likely be further improved by additional genetic circuit engineering59, the observed potency of our current system will allow useful investigation of gene function in many biological contexts. In addition, a high degree of target specificity is expected because of the complexity of the operator sequences as well as the large evolutionary distance between mammals and the originating species of the regulatory components60. Furthermore, transgenic mouse lines of repressors and activators can be developed and employed for any endogenous gene. For example, existing tet transactivator mouse models can be adapted to accomplish upregulation of a target gene in the desired mouse tissues. We recently developed a transgenic line that can drive robust tissue-specific expression of our enhanced lac repressor in multiple tissue types when combined with existing Cre lines by introducing the lacIGY gene into the Hipp11 locus48 under the control of a Lox-STOP-Lox element (unpublished). This line would substantially facilitate the tissue-specific application of the REMOTE-control system.
Gene upregulation by the REMOTE-control system provides several advantages in comparison to current inducible transgenic approaches. It does not require generation of multiple transgenic lines to test for position effects of the insertion, as it utilizes the endogenous locus. Additionally, this approach is well-suited for upregulation of genes with strong baseline expression because it enhances expression from an already robust promoter, whereas conventional transgenic models rely on minimal viral promoters. Lastly, the tissue specificity, cell-cycle control, and splicing variants of a target gene may be retained upon upregulation by our approach, as it preserves elements of natural regulation such as innate cis-regulatory elements. The advent of CRISPR/Cas-mediated gene-targeting technology will greatly facilitate the application of this technology in diverse model systems.

Genetic knockout or transgenic approaches have been&#160;effective means to study gene function in animal models. However, expression regulation by these approaches is dichotomous (on/off), non-temporal, and thus is not capable of revealing the complete functional spectrum of a gene. Conditional Cre/LoxP technologies have allowed spatio-temporal inactivation or activation of gene function, but their dichotomous nature continues to pose limitations, such as cell lethality and irreversibility1,2,3. In order to fill this void, conditional knockdown approaches have been developed using tet-regulated shRNA or miRNA4. However, off-target effects remain a concern for RNAi5 and have been challenging to control in vivo. More recently, CRISPR/Cas-mediated transcriptional-control technologies have introduced a more versatile approach to achieving both up- and downregulation of endogenous gene expression and demonstrated their utilities6,7. However, the effectiveness of CRISPR/Cas-mediated transcriptional control is as yet unclear in vivo, and the reversibility of KRAB-based repression remains to be seen, as strong repression by KRAB and its interacting protein KAP1 has been shown to induce permanent gene silencing8,9.
In order to address these limitations, we have developed a novel transcriptional regulatory system capable of conditionally controlling endogenous gene expression in a reversible and tunable manner in mice using engineered prokaryotic binary transcriptional regulatory systems10. Prokaryotic binary transcriptional regulatory systems with regulatory ligands, such as lac and tet, have enabled such reversible and tunable expression control11,12,13,14. However, the inadequate repression potency of the current binary systems has impeded their broad adoption for controlling endogenous gene expression in mammals. We developed an enhanced lac repression system sufficiently potent for the repression of endogenous genes and employed a novel strategy of targeting tet transcriptional activators directly to the cognate promoter of an endogenous gene to achieve robust upregulation (Figure 1)10. With this technology, we have achieved nearly two orders of magnitude expression control of the endogenous Dnmt1 gene in a tunable, inducible, and reversible manner10. Here we provide step-by-step instructions for its in vivo application to other genes and organisms using mice as a model species.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/59235/59235fig1.jpg" /> 
Figure 1: Overview of the REMOTE-control system. The transcription of an endogenous target gene can be regulated using engineered lac repressor and tet activator systems. The target gene promoter or intron is engineered to contain operators for the tight-binding LacIGY repressor and/or the rtTA-M2 activator. R indicates Repron (Repression intron), which contains 12 symmetric lac operators (S) plus a partial rabbit beta-globin intron. T indicates tet operator. The repressor and/or activator is/are expressed from a tissue-specific promoter. The expression of the target gene can then be reversibly tuned to the desired expression level by administration of IPTG (isopropyl &#946;-D-1-thiogalactopyranoside, an antagonist of the LacIGY repressor) or Doxycycline (Dox). This figure has been modified from Lee et al.10 <a href="https://www.jove.com/files/ftp_upload/59235/59235fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
Before beginning this protocol, review Table 1 to identify the relevant steps for the desired control of gene expression. For example, to engineer a mouse that enables reversible downregulation of &#8220;Gene X&#8221;, complete sections 1, 3, and 4 of the below protocol. Table 1 also summarizes the needed components of the REMOTE-control system.
<table fo:keep-together.within-page="1">
	<tbody>
		<tr>
			<td>Desired Expression Change</td>
			<td>Repression only</td>
			<td>Activation only</td>
			<td>Both Repression and Activation</td>
		</tr>
		<tr>
			<td>Relevant Sections of Protocol</td>
			<td>1, 3-4</td>
			<td>2-4</td>
			<td>1-4</td>
		</tr>
		<tr>
			<td>REMOTE-control Sequence Needed in Target Gene</td>
			<td>Repron (&#34;Repression intron&#34;; 12 symmetric lac operators plus a partial rabbit beta-globin intron)</td>
			<td>Tet operator(s)</td>
			<td>Repron and Tet operator(s)</td>
		</tr>
		<tr>
			<td>REMOTE-control Sequence Location</td>
			<td>Intron</td>
			<td>Promoter</td>
			<td>Intron &#38; Promoter</td>
		</tr>
		<tr>
			<td>Activator/Repressor Needed for Desired Control</td>
			<td>LacIGY Repressor</td>
			<td>rtTA-M2 Activator</td>
			<td>LacIGY Repressor and rtTA-M2 Activator</td>
		</tr>
		<tr>
			<td>Regulatory Ligands</td>
			<td>IPTG</td>
			<td>Doxycycline</td>
			<td>IPTG and/or Doxycycline</td>
		</tr>
	</tbody>
</table>
Table 1: Overview of REMOTE-control components.

<table border="0" cellpadding="0" cellspacing="0" style="width:715px;" width="715">
	<tbody>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">B6C3F1/J</td>
			<td style="width:149px;">The Jackson Laboratory</td>
			<td style="width:183px;">100010</td>
			<td style="width:167px;">https://www.jax.org/strain/100010</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">Cas9 Protein</td>
			<td style="width:149px;">PNA Bio</td>
			<td style="width:183px;">CP04</td>
			<td>http://www.pnabio.com/products/CRISPR_Cas9.htm?gclid=EAIaIQobChMIsoG8pLL33QIVBr7ACh0naQ4dEAAYAiAAEgKyHvD_BwE</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">CRISPOR</td>
			<td>Haeussler et al. 2016</td>
			<td style="width:183px;"></td>
			<td>http://crispor.tefor.net/</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">Doxycycline-Containing Mouse Diet</td>
			<td style="width:149px;">Envigo</td>
			<td style="width:183px;">Varies by concentration</td>
			<td>https://www.envigo.com/products-services/teklad/laboratory-animal-diets/custom-research/doxycycline-diets/</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">ENCODE Database</td>
			<td style="width:149px;">Stanford University</td>
			<td style="width:183px;"></td>
			<td>https://www.encodeproject.org/</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">iCre mRNA synthesis plasmid (pBBI)</td>
			<td style="width:149px;">Addgene</td>
			<td>65795</td>
			<td>https://www.addgene.org/65795/</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">IPTG</td>
			<td>GoldBio</td>
			<td style="width:183px;">I2481C</td>
			<td>https://www.goldbio.com/search?isSearch=Y&#38;q=iptg</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:216px;">pGL3-Basic</td>
			<td style="width:149px;">Promega</td>
			<td style="width:183px;">E1751</td>
			<td>https://www.promega.com/products/reporter-assays-and-transfection/reporter-vectors-and-cell-lines/pgl3-luciferase-reporter-vectors/?catNum=E1751</td>
		</tr>
		<tr height="63">
			<td height="63" style="height:63px;width:216px;">SVM-BPfinder</td>
			<td style="width:149px;">Regulatory Genomics, Pompeu Fabra University</td>
			<td style="width:183px;"></td>
			<td>http://regulatorygenomics.upf.edu/Software/SVM_BP/</td>
		</tr>
		<tr height="84">
			<td height="84" style="height:84px;width:216px;">TiProD: Tissue specific promoter Database</td>
			<td style="width:149px;">Department of Bioinformatics, UMG,&#160;University of G&#246;ttingen&#160;</td>
			<td style="width:183px;"></td>
			<td>http://tiprod.bioinf.med.uni-goettingen.de</td>
		</tr>
		<tr height="42">
			<td height="42" style="height:42px;width:216px;">UCSC Genome Browser</td>
			<td style="width:149px;">University of California Santa Cruz</td>
			<td style="width:183px;"></td>
			<td>https://genome.ucsc.edu/</td>
		</tr>
	</tbody>
</table>

in vivo application of the remote-control system for the manipulation of endogenous gene expression

Here we describe a protocol for implementing the REMOTE-control system (Reversible Manipulation of Transcription at Endogenous loci), which allows for reversible and tunable expression control of an endogenous gene of interest in living model systems. The REMOTE-control system employs enhanced lac repression and tet activation systems to achieve down- or upregulation of a target gene within a single biological system. Tight repression can be achieved from repressor binding sites flexibly located far downstream of a transcription start site by inhibiting transcription elongation. Robust upregulation can be attained by enhancing the transcription of an endogenous gene by targeting tet transcriptional activators to the cognate promoter. This reversible and tunable expression control can be applied and withdrawn repeatedly in organisms. The potency and versatility of the system, as demonstrated for endogenous Dnmt1 here, will allow more precise in vivo functional analyses by enabling investigation of gene function at various expression levels and by testing the reversibility of a phenotype.

The repression capability of the REMOTE-control system has been demonstrated in two different approaches thus far. In the first approach, lac repressor binding sites were inserted at the endogenous promoter of the Dnmt1 gene. In the second approach, which is recommended by this protocol, the repressor binding sites were inserted into a downstream intron to avoid the potential risk of affecting promoter function by the insertion and thereby to simplify application of the REMOTE-control system. Both approaches resulted in successful repression (Figure 2A,B and Figure 3A-C)10. Dnmt1 expression was repressed to 15% of the unregulated levels using the promoter-based approach (Figure 2A). This tight repression was reversed in a dose-dependent manner by treating mice with varying amounts of IPTG (Figure 2A). The observed Dnmt1 repression was validated at the protein level by immunostaining (Figure 2B). We did not observe any noticeable difference in Dnmt1 expression between Dnmt1+/+ and Dnmt1LO/LO mice, confirming that our lac&#160;operator insertion had not disrupted normal promoter function10. The intron-based approach achieved more than 90% repression from operators located several kilobases downstream of the transcription start site by attenuating transcription elongation (Figure 3A, B)10. This intron-based approach was further validated on seven additional robust promoters (Figure 3C). Invariably tight repression was achieved from all of the promoters tested. No correlation between the residual expression levels and the strengths of the promoters was observed, suggesting that the repression capacity of our intron-based repression system exceeds the transcriptional potency of all of the robust promoters we tested (Figure 3C).
The in vivo upregulation capability of the REMOTE-control system was also demonstrated on the Dnmt1 gene. We introduced two copies of the tet operator into the Dnmt1 promoter, together with lac operator sequences, to allow for either upregulation or downregulation depending on which effector protein is present. Robust upregulation and downregulation of Dnmt1 expression, close to two orders of magnitude (10% to 650%), were achieved in ESCs containing the modified endogenous Dnmt1 allele (Dnmt1LGT) (Figure 4A)10. Both regulations were fully reversible and inducible by IPTG and Dox treatments, respectively (Figure 4A). We next introduced the Dnmt1LGT modification into the mouse germline to test the in vivo upregulation capability of the REMOTE-control system. Strong upregulation of Dnmt1 was observed from the liver, spleen, and kidney, whereas no detectable upregulation in the heart was observed (Figure 4B)7. The cell cycle-dependent expression pattern of Dnmt1 and the scarcity of proliferative cells in the heart may underlie this observation10,56. It remains to be seen whether this limitation can be overcome by increasing the expression level of the activator or the number of its binding sites.
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/59235/59235fig2.jpg" /> 
Figure 2: In vivo repression of Dnmt1 by the LacIGY repressor. (A) Mice with lac operators (LO) inserted into the Dnmt1 promoter, with or without expression of LacIGY, were treated with various doses of IPTG. qRT-PCR analysis of Dnmt1 expression shows the dose-dependent reversal of Dnmt1 repression in vivo by IPTG treatment. Each bar represents data from a different mouse. Data represent mean &#177; SEM (n = 3). (B) Immunostaining of Dnmt1 protein in colonic crypts of mice provided drinking water with or without 160 mM IPTG for 3 weeks. This figure has been modified from Lee et al.10 <a href="https://www.jove.com/files/ftp_upload/59235/59235fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/59235/59235fig3.jpg" /> 
Figure 3: In vivo and in vitro repression of various promoters by the REMOTE-control system. (A) An early version of the Repron sequence (R*) was inserted into an intron downstream of the Villin promoter in a Villin-mKate2 transgenic mouse (VilmKate2). qRT-PCR analysis of mKate2 expression in the small intestine of mice with or without the LacIGY repressor is shown. Each bar represents data from a different mouse. (B) Confocal mKate2 images of the small intestine with and without LacIGY expression. (C) Six symmetric lac operators (S) were inserted between various promoters and a luciferase reporter. Reporters (50 ng/well in 96-well plate) and repressor plasmids were transiently introduced into NIH/3T3 cells in a 1:1 molar ratio. Luciferase values were assessed 24 h after transfection. These in vitro data represent the percent of luciferase expression in LacIGY-expressing cells relative to those expressing non-functional LacI (NFlacI). T-tests were used to determine statistical significance. Data represent mean &#177; SEM (n = 3). *P &#8804; 0.05, **P &#8804; 0.01. This figure has been modified from Lee et al.10 <a href="https://www.jove.com/files/ftp_upload/59235/59235fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/59235/59235fig4.jpg" /> 
Figure 4: Down- and/or upregulation of Dnmt1 expression in vitro and in vivo. (A) The complete REMOTE-control system was engineered in cultured ESCs by gene targeting and electroporation approaches. Maximal repression of Dnmt1 expression was achieved with no treatment while maximal activation was achieved by both IPTG and Dox treatment. Data represent mean &#177; SEM (n = 3). *P &#8804; 0.05, **P &#8804; 0.01 (Welch&#8217;s t-tests). (B) In vivo activation of Dnmt1 by the REMOTE-control system, as demonstrated by immunostaining of Dnmt1 protein in various tissues from REMOTE-control mice. The LGT allele represents promoter modification of Dnmt1 to contain lac operator and tet activator binding sites. Mice were treated with a normal or Dox-containing diet (5000 mg/kg Doxycycline Hyclate) for one month. This figure has been modified from Lee et al.10 <a href="https://www.jove.com/files/ftp_upload/59235/59235fig4large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Supplementary Figure 1" src="/files/ftp_upload/59235/59235supfig1.jpg" /> 
Supplementary Figure 1: Example of landing pad insertion into murine Dnmt1 intron 1. (A) Schematic of DNA template for landing pad insertion, adapted from Quadros et al. (2015)31. Heterotypic loxP sites, JT15 and Lox2272, are separated by a short spacer sequence (sp) and flanked on each side by 60-bp of DNA that is homologous to the target genomic region. (B) Sample DNA template for landing pad insertion into the Dnmt1 intron using the following sgRNA: CTAGTACCACTCCTGTACCG (which targets the reverse strand). The selected intronic region was bioinformatically informed by step 1.1, and the sgRNA was identified using CRISPOR29. (C) Example of PCR primer design for assessing insertion of the landing pad. PCR primers were designed outside of the homology arms of the template to confirm integration into endogenous Dnmt1. The wildtype PCR amplicon is 213 bp; upon insertion, it becomes 291 bp. <a href="https://www.jove.com/files/ftp_upload/59235/59235supfig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>

Watch this Scientific Journal Video about In vivo Application of the REMOTE-control System for the Manipulation of Endogenous Gene Expression at JoVE.com

In vivo Application of the REMOTE-control System for the Manipulation of Endogenous Gene Expression

This protocol outlines the steps needed to generate a model system in which the transcription of an endogenous gene of interest can be conditionally controlled in live animals or cells using enhanced lac repressor and/or tet activator systems.

Here we describe a protocol for implementing the REMOTE-control system (Reversible Manipulation of Transcription at Endogenous loci), which allows for ...

in-vivo-application-remote-control-system-for-manipulation-endogenous

Research

JoVE Journal

Genetics

6.9K Views.  Van Andel Research Institute. This protocol outlines the steps needed to generate a model system in which the transcription of an endogenous gene of interest can be conditionally controlled in live animals or cells using enhanced lac repressor and/or tet activator systems.

Video: In vivo Application of the REMOTE-control System for the Manipulation of Endogenous Gene Expression

In Vitro Transcription Assays and Their Application in Drug Discovery

In vitro transcription assays have been developed and widely used for many years to study the molecular mechanisms involved in transcription. This process requires multi-subunit DNA-dependent RNA polymerase (RNAP) and a series of transcription factors that act to modulate the activity of RNAP during gene expression. Sequencing gel electrophoresis of radiolabeled transcripts is used to provide detailed mechanistic information on how transcription proceeds and what parameters can affect it. In this paper we describe the protocol to study how the essential elongation factor NusA regulates transcriptional pausing, as well as a method to identify an antibacterial agent targeting transcription initiation through inhibition of RNAP holoenzyme formation. These methods can be used a as platform for the development of additional approaches to explore the mechanism of action of the transcription factors which still remain unclear, as well as new antibacterial agents targeting transcription which is an underutilized drug target in antibiotic research and development.

In Vitro Transcription Assays and Their Application in Drug Discovery

In this manuscript, we describe a protocol to functionally examine transcription and the inhibitory activity of antibacterial agents targeting bacterial transcription.

In vitro transcription assays have been developed and widely used for many years to study the molecular mechanisms involved in transcription. This process ...

Genetic Manipulation of the Plant Pathogen Ustilago maydis to Study Fungal Biology and Plant Microbe Interactions

Gene deletion plays an important role in the analysis of gene function. One of the most efficient methods to disrupt genes in a targeted manner is the replacement of the entire gene with a selectable marker via homologous recombination. During homologous recombination, exchange of DNA takes place between sequences with high similarity. Therefore, linear genomic sequences flanking a target gene can be used to specifically direct a selectable marker to the desired integration site. Blunt ends of the deletion construct activate the cell&#39;s DNA repair systems and thereby promote integration of the construct either via homologous recombination or by non-homologous-end-joining. In organisms with efficient homologous recombination, the rate of successful gene deletion can reach more than 50% making this strategy a valuable gene disruption system. The smut fungus Ustilago maydis is a eukaryotic model microorganism showing such efficient homologous recombination. Out of its about 6,900 genes, many have been functionally characterized with the help of deletion mutants, and repeated failure of gene replacement attempts points at essential function of the gene. Subsequent characterization of the gene function by tagging with fluorescent markers or mutations of predicted domains also relies on DNA exchange via homologous recombination. Here, we present the U. maydis strain generation strategy in detail using the simplest example, the gene deletion.

Genetic Manipulation of the Plant Pathogen Ustilago maydis to Study Fungal Biology and Plant Microbe Interactions

We describe a robust gene replacement strategy to genetically manipulate the smut fungus Ustilago maydis. This protocol explains how to generate deletion mutants to investigate infection phenotypes. It can be extended to modify genes in any desired way, e.g., by adding a sequence encoding a fluorescent protein tag.

Gene deletion plays an important role in the analysis of gene function. One of the most efficient methods to disrupt genes in a targeted manner is the ...

Inducible T7 RNA Polymerase-mediated Multigene Expression System, pMGX

Co-expression of multiple proteins is increasingly essential for synthetic biology, studying protein-protein complexes, and characterizing and harnessing biosynthetic pathways. In this manuscript, the use of a highly effective system for the construction of multigene synthetic operons under the control of an inducible T7 RNA polymerase is described. This system allows many genes to be expressed simultaneously from one plasmid. Here, a set of four related vectors, pMGX-A, pMGX-hisA, pMGX-K, and pMGX-hisK, with either the ampicillin or kanamycin resistance selectable marker (A and K) and either possessing or lacking an N-terminal hexahistidine tag (his) are disclosed. Detailed protocols for the construction of synthetic operons using this vector system are provided along with the corresponding data, showing that a pMGX-based system containing five genes can be readily constructed and used to produce all five encoded proteins in Escherichia coli. This system and protocol enables researchers to routinely express complex multi-component modules and pathways in E. coli.

This study describes methods for the T7-mediated co-expression of multiple genes from a single plasmid in Escherichia coli using the pMGX plasmid system.

Co-expression of multiple proteins is increasingly essential for synthetic biology, studying protein-protein complexes, and characterizing and harnessing ...

Controllable Ion Channel Expression through Inducible Transient Transfection

Transfection, the delivery of foreign nucleic acids into a cell, is a powerful tool in protein research. Through this method, ion channels can be investigated through electrophysiological analysis, biochemical characterization, mutational studies, and their effects on cellular processes. Transient transfections offer a simple protocol in which the protein becomes available for analysis within a few hours to days. Although this method presents a relatively straightforward and time efficient protocol, one of the critical components is calibrating the expression of the gene of interest to physiological relevant levels or levels that are suitable for analysis. To this end, many different approaches that offer the ability to control the expression of the gene of interest have emerged. Several stable cell transfection protocols provide a way to permanently introduce a gene of interest into the cellular genome under the regulation of a tetracycline-controlled transcriptional activation. While this technique produces reliable expression levels, each gene of interest requires a few weeks of skilled work including calibration of a killing curve, selection of cell colonies, and overall more resources. Here we present a protocol that uses transient transfection of the Transient Receptor Potential cation channel subfamily V member 1 (TRPV1) gene in an inducible system as an efficient way to express a protein in a controlled manner which is essential in ion channel analysis. We demonstrate that using this technique, we are able to perform calcium imaging, whole cell, and single channel analysis with controlled channel levels required for each type of data collection with a single transfection. Overall, this provides a replicable technique that can be used to study ion channels structure and function.

Studying ion channels through a heterologously expressing system has become a core technique in biomedical research. In this manuscript, we present a time efficient method to achieve tightly controlled ion channel expression by performing transient transfection under the control of an inducible promoter.

Transfection, the delivery of foreign nucleic acids into a cell, is a powerful tool in protein research. Through this method, ion channels can be ...

Studying Cell Cycle-regulated Gene Expression by Two Complementary Cell Synchronization Protocols

The gene expression program of the cell cycle represents a critical step for understanding cell cycle-dependent processes and their role in diseases such as cancer. Cell cycle-regulated gene expression analysis depends on cell synchronization into specific phases. Here we describe a method utilizing two complementary synchronization protocols that is commonly used for studying periodic variation of gene expression during the cell cycle. Both procedures are based on transiently blocking the cell cycle in one defined point. The synchronization protocol by hydroxyurea (HU) treatment leads to cellular arrest in late G1/early S phase, and release from HU-mediated arrest provides a cellular population uniformly progressing through S and G2/M. The synchronization protocol by thymidine and nocodazole (Thy-Noc) treatment blocks cells in early mitosis, and release from Thy-Noc mediated arrest provides a synchronized cellular population suitable for G1 phase and S phase-entry studies. Application of both procedures requires monitoring of the cell cycle distribution profiles, which is typically performed after propidium iodide (PI) staining of the cells and flow cytometry-mediated analysis of DNA content. We show that the combined use of two synchronization protocols is a robust approach to clearly determine the transcriptional profiles of genes that are differentially regulated in the cell cycle (i.e. E2F1 and E2F7), and consequently to have a better understanding of their role in cell cycle processes. Furthermore, we show that this approach is useful for the study of mechanisms underlying drug-based therapies (i.e. mitomycin C, an anticancer agent), because it allows to discriminate genes that are responsive to the genotoxic agent from those solely affected by cell cycle perturbations imposed by the agent.

We report two cell synchronization protocols that provide a context for studying events related to specific phases of the cell cycle. We show that this approach is useful for analyzing the regulation of specific genes in an unperturbed cell cycle or upon exposure to agents affecting the cell cycle.

The gene expression program of the cell cycle represents a critical step for understanding cell cycle-dependent processes and their role in diseases such ...

Production and Purification of Baculovirus for Gene Therapy Application

Baculovirus has traditionally been used for the production of recombinant protein and vaccine. However, more recently, baculovirus is emerging as a promising vector for gene therapy application. Here, baculovirus is produced by transient transfection of the baculovirus plasmid DNA (bacmid) in an adherent culture of Sf9 cells. Baculovirus is subsequently expanded in Sf9 cells in a serum-free suspension culture until the desired volume is obtained. It is then purified from the culture supernatant using heparin affinity chromatography. Virus supernatant is loaded onto the heparin column which binds baculovirus particles in the supernatant due to the affinity of heparin for baculovirus envelop glycoprotein. The column is washed with a buffer to remove contaminants and baculovirus is eluted from the column with a high-salt buffer. The eluate is diluted to an isotonic salt concentration and baculovirus particles are further concentrated using ultracentrifugation. Using this method, baculovirus can be concentrated up to 500-fold with a 25% recovery of infectious particles. Although the protocol described here demonstrates the production and purification of the baculovirus from cultures up to 1 L, the method can be scaled-up in a closed-system suspension culture to produce a clinical-grade vector for gene therapy application.

In this protocol, baculovirus is produced by transient transfection of baculovirus plasmid into Sf9 cells and amplified in a serum-free suspension culture. The supernatant is purified by heparin affinity chromatography and further concentrated by ultracentrifugation. This protocol is useful for the production and purification of baculovirus for gene therapy application.

Baculovirus has traditionally been used for the production of recombinant protein and vaccine. However, more recently, baculovirus is emerging as a ...

Manipulation of Ploidy in Caenorhabditis elegans

Mechanisms that involve whole genome polyploidy play important roles in development and evolution; also, an abnormal generation of tetraploid cells has been associated with both the progression of cancer and the development of drug resistance. Until now, it has not been feasible to easily manipulate the ploidy of a multicellular animal without generating mostly sterile progeny. Presented here is a simple and rapid protocol for generating tetraploid Caenorhabditis elegans animals from any diploid strain. This method allows the user to create a bias in chromosome segregation during meiosis, ultimately increasing ploidy in C. elegans. This strategy relies on the transient reduction of expression of the rec-8 gene to generate diploid gametes. A rec-8 mutant produces diploid gametes that can potentially produce tetraploids upon fertilization. This tractable scheme has been used to generate tetraploid strains carrying mutations and chromosome rearrangements to gain insight into chromosomal dynamics and interactions during pairing and synapsis in meiosis. This method is efficient for generating stable tetraploid strains without genetic markers, can be applied to any diploid strain, and can be used to derive triploid C. elegans. This straightforward method is useful for investigating other fundamental biological questions relevant to genome instability, gene dosage, biological scaling, extracellular signaling, adaptation to stress, development of resistance to drugs, and mechanisms of speciation.

Manipulation of Ploidy in Caenorhabditis elegans

This method allows for the generation of tetraploid and triploid Caenorhabditis nematodes from any diploid strain. Polyploid strains generated by this method have been used to study chromosome interactions in meiotic prophase, and this method is useful for examining important basic questions in cell, developmental, evolutionary, and cancer biology.

Mechanisms that involve whole genome polyploidy play important roles in development and evolution; also, an abnormal generation of tetraploid cells has ...

Exploring the Root Microbiome: Extracting Bacterial Community Data from the Soil, Rhizosphere, and Root Endosphere

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to abiotic stresses and diseases. As the plant microbiome can be highly complex, low-cost, high-throughput methods such as amplicon-based sequencing of the 16S rRNA gene are often preferred for characterizing its microbial composition and diversity. However, the selection of appropriate methodology when conducting such experiments is critical for reducing biases that can make analysis and comparisons between samples and studies difficult. This protocol describes in detail a standardized methodology for the collection and extraction of DNA from soil, rhizosphere, and root samples. Additionally, we highlight a well-established 16S rRNA amplicon sequencing pipeline that allows for the exploration of the composition of bacterial communities in these samples, and can easily be adapted for other marker genes. This pipeline has been validated for a variety of plant species, including sorghum, maize, wheat, strawberry, and agave, and can help overcome issues associated with the contamination from plant organelles.

Here, we describe a protocol to obtain amplicon sequence data of soil, rhizosphere, and root endosphere microbiomes. This information can be used to investigate the composition and diversity of plant-associated microbial communities, and is suitable for the use with a wide range of plant species.

The intimate interaction between plant host and associated microorganisms is crucial in determining plant fitness, and can foster improved tolerance to ...

Manipulation of Gene Function in Mexican Cavefish

Cave animals provide a compelling system for investigating the evolutionary mechanisms and genetic bases underlying changes in numerous complex traits, including eye degeneration, albinism, sleep loss, hyperphagia, and sensory processing. Species of cavefish from around the world display a convergent evolution of morphological and behavioral traits due to shared environmental pressures between different cave systems. Diverse cave species have been studied in the laboratory setting. The Mexican tetra, Astyanax mexicanus, with sighted and blind forms, has provided unique insights into biological and molecular processes underlying the evolution of complex traits and is well-poised as an emerging model system. While candidate genes regulating the evolution of diverse biological processes have been identified in A. mexicanus, the ability to validate a role for individual genes has been limited. The application of transgenesis and gene-editing technology has the potential to overcome this significant impediment and to investigate the mechanisms underlying the evolution of complex traits. Here, we describe a different methodology for manipulating gene expression in A. mexicanus. Approaches include the use of morpholinos, Tol2 transgenesis, and gene-editing systems, commonly used in zebrafish and other fish models, to manipulate gene function in A. mexicanus. These protocols include detailed descriptions of timed breeding procedures, the collection of fertilized eggs, injections, and the selection of genetically modified animals. These methodological approaches will allow for the investigation of the genetic and neural mechanisms underlying the evolution of diverse traits in A. mexicanus.&#160;

We describe approaches for the manipulation of genes in the evolutionary model system Astyanax mexicanus. Three different techniques are described: Tol2-mediated transgenesis, targeted manipulation of the genome using CRISPR/Cas9, and knockdown of expression using morpholinos. These tools should facilitate the direct investigation of genes underlying the variation between surface- and cave-dwelling forms.

Cave animals provide a compelling system for investigating the evolutionary mechanisms and genetic bases underlying changes in numerous complex traits, ...

Efficient Transcriptionally Controlled Plasmid Expression System for Investigation of the Stability of mRNA Transcripts in Primary Alveolar Epithelial Cells

Studying posttranscriptional regulation is fundamental to understanding the modulation of a given messenger RNA (mRNA) and its impact on cell homeostasis and metabolism. Indeed, fluctuations in transcript expression could modify the translation efficiency and ultimately the cellular activity of a transcript. Several experimental approaches have been developed to investigate the half-life of mRNA although some of these methods have limitations that prevent the proper study of posttranscriptional modulation. A promoter induction system can express a gene of interest under the control of a synthetic tetracycline-regulated promoter. This method allows the half-life estimation of a given mRNA under any experimental condition without disturbing cell homeostasis. One major drawback of this method is the necessity to transfect cells, which limits the use of this technique in isolated primary cells that are highly resistant to conventional transfection techniques. Alveolar epithelial cells in primary culture have been used extensively to study the cellular and molecular biology of the alveolar epithelium. The unique characteristics and phenotype of primary alveolar cells make it essential to study the posttranscriptional modulations of genes of interest in these cells. Therefore, our aim was to develop a novel tool to investigate the posttranscriptional modulations of mRNAs of interest in alveolar epithelial cells in primary culture. We designed a fast and efficient transient transfection protocol to insert a transcriptionally controlled plasmid expression system into primary alveolar epithelial cells. This cloning strategy, using a viral epitope to tag the construct, allows for the easy discrimination of construct expression from that of endogenous mRNAs. Using a modified &#916;&#916; quantification cycle (Cq) method, the expression of the transcript can then be quantified at different time intervals to measure its half-life. Our data demonstrate the efficiency of this novel approach in studying posttranscriptional regulation in various pathophysiological conditions in primary alveolar epithelial cells.

Here, we present a tool that can be used to study the posttranscriptional modulation of a transcript in primary alveolar epithelial cells by using an inducible expression system coupled to a pipette electroporation technique.

Studying posttranscriptional regulation is fundamental to understanding the modulation of a given messenger RNA (mRNA) and its impact on cell homeostasis ...