The authors thank la Ligue Genevoise Contre le Cancer (Geneva, Switzerland), ISREC Foundation (Lausanne, Switzerland), and the Clayton Foundation for Research (Houston, TX, USA) for financial support. Moreover, the authors thank HES-HO and the Wyss Center for financial support. We thank the Krause&#39;s lab for helpful discussions and support and Dr. Halah Kutaish for proofreading.

This protocol follows the guidelines of University of Geneva&#39;s human research ethics committee.
1. Maintenance and culture of undifferentiated human embryonic stem cells (hESCs)
<ol>
	<li>Perform maintenance and expansion of hSECs on feeder-free conditions by pre-coating dishes with a specific extracellular matrix.
	<ol>
		<li>Thaw 300 &#181;L of extracellular matrix at 4 &#176;C (typical range concentration 18-22 mg/mL, keep on ice) and gently mix with 15 mL of cold DMEM medium to avoid a premature gelation of the extracellular matrix. Add 7.5 mL of the extracellular matric to both T150 flasks.</li>
		<li>Incubate the dishes coated with extracellular matrix at 37 &#176;C for at least 1 h (maximum overnight).</li>
		<li>Remove the medium and seed hESCs to a density of 6.5 x 104 cell/cm2.</li>
	</ol>
	</li>
	<li>Maintain H1 (hESC cell line) in hESC medium and 1% penicillin/streptomycin.</li>
	<li>Pass the cells with enzymatic procedure: add 7.5 mL of enzymatic solution to a T75 cm2 flask over a period of 1-2 min at 37 &#176;C. Once cells are completely detached, add 7.5 mL of DMEM-F12 then centrifuge for 5 min at 300 x g. To allow for better survival, re-plate cells at the desired density onto extracellular matrix-coated dishes, in the same medium containing Rho-associated protein kinase (ROCK) inhibitor (10 &#181;M) for 24 h.</li>
</ol>
2. hESC-derived neural organoids for GBM studies
<ol>
	<li>24 h before starting the 3D culture, replace the hESC medium with a serum-free medium supplemented with 10 &#181;M ROCK inhibitor (both components are necessary to support cell survival and spontaneous neurosphere formation during the aggregation phase in a microwell plate). The cells should be at 60% confluency. The next day (day 0), detach hESC colonies as single cells: remove the medium, then rinse with PBS without Ca2+/Mg2+, add 5 mL of enzymatic dissolution solution, and incubate at 37 &#176;C for 1-2 min.</li>
	<li>Collect the cells in serum-free medium with 10 &#181;M of ROCK inhibitor and centrifuge the cells at 300 x g for 5 min. Remove the supernatant and count the cells in 10 mL of serum-free medium supplemented with 10 &#181;M of ROCK inhibitor.</li>
	<li>In parallel, rinse the microwell plate with 2 mL of serum-free medium per well and centrifuge the plate at 1200 x g for 5 min to remove all bubbles, which can prevent neurosphere formation.</li>
	<li>Prepare 28.2 x 106 of cells in 12.5 mL of serum-free medium supplemented with 10 &#181;M ROCK inhibitor. Dispense 1000 cells/microwell. Centrifuge the cells at 300 x g for 5 min and place the plate in the incubator at 37 &#176;C overnight (maximum 36 h). For example: to obtain 30 human neural organoids, use one T150 flask at 70%-80% of confluence (about 30 million cells).</li>
	<li>The next day (day 1), collect the spheres (with a P1000) and place them in a 6 well plate. In each well, add 2 mL of B27 medium and DMEM-F12 GlutaMAX and Neurobasal medium (mix at 1:1), supplemented with 1% B27 supplements and 1% non-essential amino acids (NEAA). To promote fast neural induction, supplement the medium with dual-SMAD inhibition cocktail, composed of 10 &#181;M TGF&#946;/Activin/Nodal inhibitor and 0.5 &#181;M bone morphogenic protein (BMP) inhibitor. From this step forward, the spheres are cultured in rotation (60 rpm, orbital shaker). The rotation is critical to prevent the spheres from sticking together or to the plate.</li>
	<li>Change the medium every 2-3 days: bend the plate and let the spheres fall down for 5 min, remove half of the medium (2 mL), and add 2 mL of fresh B27 medium supplemented with growth factors and inhibitors. Do not centrifuge the spheres.</li>
	<li>Perform neural induction according to the following time course:
	<ol>
		<li>From days 1-4, culture the spheres in B27 medium supplemented with dual-SMAD. The dual-SMAD inhibition cocktail (10 &#181;M TGF&#946;/Activin/Nodal inhibitor and 0.5 &#181;M BMP inhibitor) promote the neural induction.</li>
		<li>From days 4-11, promote proliferation of hESC-derived neural rosettes (into the spheres), by adding 10 ng/mL epidermal growth factor (EGF) and 10 ng/mL basic fibroblast factor (bFGF) to the B27 medium supplemented with dual-SMAD cocktail. 
		NOTE: On day 11, most of the cells should be positive for Nestin.</li>
		<li>From days 11-13, culture the spheres in B27 medium supplemented with 0.5 &#181;M BMP inhibitor.</li>
		<li>From days 13-21, culture the spheres in B27 medium supplemented with 10 ng/mL glial derived neurotrophic factor (GDNF), 10 ng/mL brain derived neurotrophic factor (BDNF) and 1 &#181;M of &#947;-secretase inhibitor. GDNF and BDNF promote neuronal and glial differentiation. The &#947;-secretase inhibitor allows for greater neural maturation.</li>
		<li>On day 21, plate the spheres (about 1,000 spheres) on a hydrophilic polytetrafluoroethylene (PTFE) membrane (6 mm diameter, 0.4 &#181;m) deposited on a culture plate insert designed for 6 well plate. Stop any rotation from this step. The presence of rosettes, observed with a bright-field microscope, indicate the initiation of neural differentiation. The neural rosettes can be observed 2-3 days after plating spheres on the PTFE membrane.</li>
		<li>Add 1 mL of B27 medium supplemented with growth factors and inhibitors (as followed) to each well underneath the membrane insert, every 2-3 days (usually on Monday, Wednesday and Friday), for a following 3 weeks of differentiation.</li>
		<li>From days 21-25, cultivate human neural organoids in the same neural maturation medium (Cf. step 2.7.4).</li>
		<li>From days 25-28, only complement B27 medium with 1 &#181;M &#947;-secretase inhibitor.</li>
		<li>From days 28-39, stop adding the &#947;-secretase inhibitor and continue human neural organoid culture in B27 medium only. 
		NOTE: After 3 weeks, neural organoids are ready to use for GIC implantation. Along the neural maturation, a decrease of neural immature marker Nestin and increase of mature neural markers &#946;3-tubulin and GFAP were observed.</li>
	</ol>
	</li>
</ol>
3. Isolation and cultivation of glioblastoma-initiating cells (GICs)
<ol>
	<li>Isolate GICs by fragmenting a high grade human GBM biopsy. Transfer the piece of tumor in a beaker containing 0.25% trypsin in 0.1 mM EDTA (4:1) and slowly stir at 37 &#176;C for 30-60 min (depending on tumor size).</li>
	<li>Plate the dissociated cells in 75 cm2 tissue culture flasks plated at 2,500-5,000 cells per cm2 in GIC medium: DMEM/F-12 medium (1:1) containing 1% N2, 1% B27, and 1% G5 supplements (to favor GIC survival), supplemented with bFGF and EGF (both at 10 ng/Ml, to promote stemness) and 1% of penicillin/streptomycin.</li>
	<li>Once the GIC is well-established and growing, remove the N2 and G5 supplements from the GIC medium.</li>
	<li>One day before adding the cells onto the organoid, dissociate the GICs and count them.</li>
	<li>Rinse the microwell plate with 2 mL of GIC medium and centrifuge the plate at the maximum speed to remove bubbles (1000 x g). Place the GICs at 1,000 cells to obtain one gliomasphere per microwell. Incubate overnight at 37 &#176;C (Figure 1C). This step is key and allows for well-calibrated GICs (an example of necrotic and over-sized GICs is shown in Figure 2A,C).</li>
	<li>To initiate GBM invasion, add one gliomasphere on top of the neural tissue with a large bore pipet tip (Figure 1F). Carefully place the 6 well plate back in the incubator.</li>
</ol>
4. hESC-derived dopaminergic organoids for PD studies
<ol>
	<li>Day 0: Amplify hESCs in 2D culture up to 60% confluency (day 0), then replace stem cell media used to maintain pluripotency features of hESCs with a serum-free medium. Start neural induction by supplementing culture medium with 0.5 &#181;M BMP inhibitor and 10 &#181;M TGF&#946;/Activin/Nodal inhibitor (dual-SMAD inhibition cocktail), then add 10 &#181;M ROCK inhibitor for 24 h to increase the survival rate of cells during passage.</li>
	<li>Day 1: Prepare the microwell plate with 2.5 mL per well of serum-free medium supplemented with 0.5 &#181;M BMP inhibitor, 10 &#181;M TGF&#946;/Activin/Nodal inhibitor, and 10 &#181;M ROCK inhibitor. To specify cells towards the ventral pattern of the neural tube, add 100 ng/mL Sonic Hedgehog (SHH), 100 ng/mL fibroblast growth factor 8 (FGF8), and 2 &#181;M smoothened agonist. Centrifuge the plate (only with medium and without cells) at 1200 x g for 5 min to remove air bubbles from the microwells.
	<ol>
		<li>After 1 day of neural induction in 2D, remove the medium and quickly wash with PBS without Ca2+/MgCl2+. Dissociate the colonies in single cells suspension by adding 7.5 mL of recombinant enzymatic solution in a T75 cm2 flask. Incubate for 2 min at 37 &#176;C then complete with 7.5 mL of DMEM-F12.</li>
		<li>Collect the cell suspension and centrifuge at 300 x g for 5 min. Remove the supernatant and count the cells in the same medium used to prepare the microwell plate.</li>
		<li>Adjust the medium volume to obtain a cell suspension allowing to form neurospheres containing 1000 cells per microwell (for example, the microwell plate used here contains 4,700 microwells per well). So, prepare 4.7 million cells in 2.5 mL of medium and add it to the previous 2.5 mL of medium already placed in the plate.</li>
		<li>In order to correctly distribute the cells in each microwell, gently shake the plate, and centrifuge the microwell plate 300 x g for 5 min. Incubate the plate at 37 &#176;C for 24 h to generate spheres.</li>
	</ol>
	</li>
	<li>Day 2: Gently flush the microwells with the medium and collect then transfer the spheres in tissue-treated six-well plate. Replace medium with Neurobasal medium supplemented with 1% B27, 1x NEAA, 2 mM L-glutamine, and 1% of penicillin/ streptomycin. Additionally, add regionalization factors SHH, FGF8, smoothened agonist, and dual-SMAD inhibition small molecules.
	<ol>
		<li>Place spheres in rotation at 37 &#176;C (60 rpm, orbital shaker) and change half-medium freshly supplemented every 2-3 days.</li>
	</ol>
	</li>
	<li>Day 3: To enhance neural induction and convert to neural progenitors with a midbrain identity, supplement the medium with 3 &#181;M GSK-3&#946; inhibitor, which activates the Wnt/&#946;-catenin pathway. Maintain GSK-3&#946; inhibitor in the medium up to day 13. Split into two new tissue-treated 6 well plates to reduce both sphere density per well and avoid sphere aggregation. 
	NOTE: At Day 8, most of the cells should be positive for Nestin.</li>
	<li>Day 8: Start the neural maturation: replace regionalization factors SHH, FGF8, smoothened agonist, and dual-SMAD inhibition cocktail with 0.5 mM dibutyryl cAMP (to favor maturation), 20 nM inhibitor of histone deacetylase (for cell cycle exit), 1 &#181;M &#947;-secretase inhibitor and growth factors, 10 ng/mL GDNF, 10 ng/mL BDNF, 1 ng/mL transforming growth factor &#946;3 (TGF&#946;3), and 5 ng/mL FGF20 (both favor DA progenitor survival). Change the medium every 2-3 days.</li>
	<li>Day 21: Generate the neural organoid: seed around 100 neurospheres under air-liquid interface conditions on PTFE membrane (6 mm diameter). Transfer the membrane to a culture plate insert (0.4 mm) and add 1.2 mL of neural maturation medium used for neurosphere differentiation as previously described.
	<ol>
		<li>Stop any rotation from this step. Change the medium every 2-3 days until the required differentiation time point is achieved. 
		NOTE: Regarding neural maturation, a decrease of the neural immature marker Nestin and increase of mature neural markers &#946;3-tubulin and GFAP were observed. High TH and NURR1 expressions were observed (Figure 3C) and confirm neural organoid maturity11.</li>
	</ol>
	</li>
</ol>
5. Quantification of TH and Nurr1 gene expression for validation of dopaminergic differentiation
<ol>
	<li>RNA extraction: On the indicated day of differentiation, lyse 40 neurospheres with 350 &#181;L of RLT buffer (provided in RNA extraction kit) supplemented with 3.5 &#181;L of 2-mercaptoethanol. Extract the RNA from the lysed neurospheres using an RNA extraction kit following the manufacturer&#39;s instructions.</li>
	<li>Quantify total RNA concentrations.</li>
	<li>Perform reverse transcription of 300 ng of the total RNA extraction using reverse transcription kit for quantitative real-time polymerase chain reaction (qPCR) and follow the manufacturer&#39;s instructions .</li>
	<li>Perform qPCR analysis on real-time PCR detection systems, based on asymmetrical cyanine dye detection. Normalize the data with housekeeping genes: glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and elongation factor 1-alpha (EF1). Sequences of primers are described in Table 1.</li>
</ol>
6. High pressure liquid chromatography (HPLC) detection
<ol>
	<li>Use high pressure liquid chromatography (HPLC) with electrochemical detection to detect the presence of dopamine. Dopamine was extracted by lysing neural organoids in 100 mL of 0.1 N perchloric acid (HClO4) for 15 min at 4 &#176;C with a vigorous vortexing every 5 min. After centrifugation, collect and store the supernatant at -20 &#176;C for dopamine dosage.</li>
	<li>Use a C-18 column (5 &#181;m, 4.6 mm x 150 mm) to separate the analytes by reversed-phase HPLC in isocratic mode at a flow rate of 1 mL/minute. Detection of dopamine should be carried out using a coulometric detector with the conditioning cell set at a potential of +200 mV.</li>
</ol>
7. Raw data recording with microelectode array (MEA) platform
<ol>
	<li>Use a dissection microscope to transfer neurospheres to the center of a porous MEA device.</li>
	<li>Use an amplifier and data acquisition system for electrophysiological recordings. Measure the signal-to-noise ratio (SNR) as the standard deviation of the voltage during a 5 min recording, using the signal as the average peak-to-peak voltage of the spikes recorded in the same 5 min periods.</li>
</ol>

<ol>
	<li>Louis, D. N., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+2016+World+Health+Organization+Classification+of+Tumors+of+the+Central+Nervous+System:+a+summary.">The 2016 World Health Organization Classification of Tumors of the Central Nervous System: a summary.</a> Acta Neuropathologica. 131 (6), 803-820 (2016).</li><li>Stupp, R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Radiotherapy+plus+concomitant+and+adjuvant+temozolomide+for+glioblastoma.">Radiotherapy plus concomitant and adjuvant temozolomide for glioblastoma.</a> New England Journal of Medicine. 352 (10), 987-996 (2005).</li><li>Daphu, I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+animal+models+for+studying+brain+metastasis:+value+and+limitations.">In vivo animal models for studying brain metastasis: value and limitations.</a> Clinical and Experimental Metastasis. 30 (5), 695-710 (2013).</li><li>Huszthy, P. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+models+of+primary+brain+tumors:+pitfalls+and+perspectives.">In vivo models of primary brain tumors: pitfalls and perspectives.</a> Neuro Oncology. 14 (8), 979-993 (2012).</li><li>Nayernia, Z., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+relationship+between+brain+tumor+cell+invasion+of+engineered+neural+tissues+and+in+vivo+features+of+glioblastoma.">The relationship between brain tumor cell invasion of engineered neural tissues and in vivo features of glioblastoma.</a> Biomaterials. 34 (33), 8279-8290 (2013).</li><li>Cosset, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Human+tissue+engineering+allows+the+identification+of+active+miRNA+regulators+of+glioblastoma+aggressiveness.">Human tissue engineering allows the identification of active miRNA regulators of glioblastoma aggressiveness.</a> Biomaterials. 107, 74-87 (2016).</li><li>Pringsheim, T., Jette, N., Frolkis, A., Steeves, T. D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+prevalence+of+Parkinson's's+disease:+a+systematic+review+and+meta-analysis.">The prevalence of Parkinson's's disease: a systematic review and meta-analysis.</a> Movement Disorders. 29 (13), 1583-1590 (2014).</li><li>Rajput, A. H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Globus+pallidus+dopamine+and+Parkinson's+motor+subtypes:+clinical+and+brain+biochemical+correlation.">Globus pallidus dopamine and Parkinson's motor subtypes: clinical and brain biochemical correlation.</a> Neurology. 70 (16 Pt 2), 1403-1410 (2008).</li><li>Jellinger, K. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Pathology+of+Parkinson's's+disease.+Changes+other+than+the+nigrostriatal+pathway.">Pathology of Parkinson's's disease. Changes other than the nigrostriatal pathway.</a> Molecular and Chemical Neuropathology. 14 (3), 153-197 (1991).</li><li>Bernheimer, H., Birkmayer, W., Hornykiewicz, O., Jellinger, K., Seitelberger, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Brain+dopamine+and+the+syndromes+of+Parkinson’s+and+Huntington.+Clinical,+morphological+and+neurochemical+correlations.">Brain dopamine and the syndromes of Parkinson’s and Huntington. Clinical, morphological and neurochemical correlations.</a> Journal of Neurological Science. 20 (4), 415-455 (1973).</li><li>Tieng, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Engineering+of+midbrain+organoids+containing+long-lived+dopaminergic+neurons.">Engineering of midbrain organoids containing long-lived dopaminergic neurons.</a> Stem Cells and Development. 23 (13), 1535-1547 (2014).</li><li>Chen, C. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=3D+Biomimetic+Cultures:+The+Next+Platform+for+Cell+Biology.">3D Biomimetic Cultures: The Next Platform for Cell Biology.</a> Trends in Cell Biology. 26 (11), 798-800 (2016).</li><li>Friedl, P., Sahai, E., Weiss, S., Yamada, K. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=New+dimensions+in+cell+migration.">New dimensions in cell migration.</a> Nature Reviews Molecular Cell Biology. 13 (11), 743-747 (2012).</li><li>Byers, B., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=SNCA+triplication+Parkinson's's+patient's+iPSC-derived+DA+neurons+accumulate+alpha-synuclein+and+are+susceptible+to+oxidative+stress.">SNCA triplication Parkinson's's patient's iPSC-derived DA neurons accumulate alpha-synuclein and are susceptible to oxidative stress.</a> PLoS ONE. 6 (11), e26159 (2011).</li><li>Flierl, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Higher+vulnerability+and+stress+sensitivity+of+neuronal+precursor+cells+carrying+an+alpha-synuclein+gene+triplication.">Higher vulnerability and stress sensitivity of neuronal precursor cells carrying an alpha-synuclein gene triplication.</a> PLoS ONE. 9 (11), e112413 (2014).</li></ol>

The authors declare no competing financial interests.

One of the most critical aspects of this protocol includes the maintenance of hESC pluripotency during cell culturing and close monitoring of the spheres and neural organoid morphology. hESCs are very sensitive, and every manipulation can lead to early uncontrolled differentiation as well as cell death. In order to increase experimental reproducibility and avoid the occurrence of abnormal karyotype events, it is advised to cryopreserve several batches of hESCs at the lowest passage after validation of their chromosome stability. Moreover, it is recommended to thaw a new vial for each experiment and check the behavior of the cells every day. If the spheres are less refractive with abnormal higher size, they will likely start to aggregate and die.
One improvement upon this system is either perfusion or implementing a vascularized system (by adding endothelial cells or within a 3D fluidic microchip)12,13. However, controlling the thickness of the neural organoid (&#8804;300 &#181;m) allows efficient passive perfusion of oxygen and nutriments and prevents necrosis. Another improvement is the introduction of immune cells (microglia). With these limitations in mind, neural organoids plus a GIC system may be a relevant tool for several reasons. First, this system allows drug screening to monitor how a therapeutic compound may affect an organoid or tumor cell. Second, cell-to-cell interactions can be studied, and micro-environmental determinants underlying individual and collective invasions can be visualized and explored5,6,13.
In the context of Parkinson&#39;s disease, a neural organoid enriched in DA neurons can represent a relevant and accurate 3D model to study disease development. In previous studies, Parkinson&#39;s patient-derived induced pluripotent stem cells differentiated towards DA neurons have been used to study the affected neuronal subtypes. Of note, some disease-related phenotypes such as the accumulation of &#945;-synuclein and sensitivity to oxidative stress have been observed14,15. Moreover, the neural organoid may be used as a tool to screen therapeutic molecules. However, specific and relevant readouts should be set up to evaluate DA neuron survival and functionality, such as dopamine production and electrophysiological activity. Altogether, this protocol provides two standardized and accurate stem cell-based approaches to generate neural organoids.

The World Health Organization (WHO) classifies astrocytomas as low grade (grade I to II) or high grade (grade III and IV). Glioblastoma multiforme (GBM) is an astrocytoma grade IV, the most lethal of primary brain tumors, that is resistant to all current forms of treatments1. Despite standard-of-care therapy including neurosurgery, chemotherapy, and radiotherapy, GBM remains fatal and the 15-month overall survival rate has not dramatically changed over the past 15 years2. To make significant progress in understanding GBM pathogenesis, the use of relevant models is key. So far, the study of GBM has relied on cell lines, rodent organotypic slices, and xenotransplantation of patient-derived cells into mice or transgenic mice developing spontaneous tumors3,4. Although these models have been useful to study brain metastasis and tumor aggressiveness, they are restricted by differences among species, and resulting conclusions may be incorrectly translated to human tissues. Moreover, existing models with human cells are also limited by the absence of host tissue/tumor interactions3,4. Experimental models are critical for the translation from basic science to therapeutic targets. Therefore, describing a protocol to produce in vitro human neural organoids co-cultured with GBM-initiating cells (GICs) can provide a relevant system that mimics morphological and functional features of GBM development. This system reproduces some in vivo&#160;features of GBM developmentsuch as diffuse migration of invading cells and necrosis areas, and it highlights gene expression relevant to tumor biology. As previously revealed, some critical microRNAs are induced during GIC development within 3D nervous tissue5,6.
PD is a major neurodegenerative disorder and associated with the degeneration of multiple neuronal subtypes7. Even if a progressive onset of symptoms (e.g., bradykinesia, asymmetric rest tremor, rigidity and posture instability) characterizes the disease, its exact etiology is not clearly established. Indeed, many studies have highlighted evidence that major risk factors can result from a combination of genetic and environmental factors. Parkinsonian symptoms are associated with the bilateral degeneration of dopaminergic neurons in the substancia nigra (SN), leading to the disappearance of dopaminergic (DA) axons projecting to the striatum8,9. Therefore, the reduction of striatal dopamine levels is correlated with progression of motor dysfunction in PD patients. Dopaminergic neurons contain tyrosine hydroxylase (TH), a key enzyme in the synthesis of catecholaminergic neurotransmitters that converts the amino acid L-tyrosine to L-3,4-dihydroxyphenylalanine (L-DOPA, a dopamine precursor) to dopamine10. Early loss of TH activity followed by a decline in TH protein expression is a hallmark of PD.
This study describes two protocols using human neural organoids, with one specifically oriented towards a midbrain-like phenotype enriched with TH-positive cells.

<table border="0" cellpadding="0" cellspacing="0" style="width:1569px;" width="1569">
	<tbody>
		<tr height="19">
			<td height="19" style="height:20px;width:455px;">6-well plate (6-well plate)</td>
			<td style="width:203px;">Falcon / Corning</td>
			<td style="width:167px;">07-201-588</td>
			<td style="width:745px;"></td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">ABI Prism 7900 HT detection system&#160; (Real-Time PCR detection systems)</td>
			<td>Applied Biosystems</td>
			<td>Discontinued</td>
			<td></td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Aggrewell 400 (Microwell culture plates )</td>
			<td>StemCell Technologies</td>
			<td align="right">34421</td>
			<td></td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Amplifier (W2100-HS32)&#160; (Amplifier)</td>
			<td>Multi Channel Systems</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Anti-EGFR (phospho Y1101) antibody</td>
			<td>Abcam</td>
			<td>ab76195</td>
			<td>1/100 dilution</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Anti-GFAP Antibody</td>
			<td>Dako&#160;</td>
			<td>Z334&#160;</td>
			<td>1/1000 dilution</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Anti-Nestin, Human Antibody</td>
			<td>Millipore&#160;</td>
			<td>ABD69&#160;</td>
			<td>1/400 dilution</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Anti-Synapsin I Antibody</td>
			<td>Chemicon&#160;</td>
			<td>AB1543P&#160;</td>
			<td>1/500 dilution</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">B27 supplements (B27)</td>
			<td>Life Technologies / Invitrogen</td>
			<td align="right">1238</td>
			<td>For both protocol, stock solution 100x, final solution 1x</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Brain-derived neurotrophic factor&#160; (BDNF)</td>
			<td>Cell Guidance</td>
			<td>GFH1-2</td>
			<td>For both protocol,&#160; stock solution 100 &#181;g/mL in pure H2O, final solution 20 ng/mL</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">CHIR-99021 (GSK-3&#946; inhibitor )</td>
			<td>Axon Medchem</td>
			<td>ct99021</td>
			<td>For Dopaminergic protocol,&#160; stock solution 7.5 mM in DMSO, final solution 3 &#181;M</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Compound E a &#947;&#8211;secretase inhibitor (&#947;&#8211;secretase inhibitor)</td>
			<td>Calbiochem</td>
			<td>CAS 209986-17-4</td>
			<td>For both protocol (gamma-secretase inhibitor XXI),&#160; stock solution 5 mM in DMSO, final solution 1 &#181;M</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Coulochem III&#160; (Coulometric detector parameters)</td>
			<td>Thermo scientific</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Dibutyryl cyclic-AMP (Dibutyryl cAMP)</td>
			<td>Sigma</td>
			<td>D0627</td>
			<td>For Dopaminergic protocol,&#160; stock solution 0.5 M in DMSO, final solution 0.5 mM</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Dimethyl Sulfoxide Pure (DMSO)</td>
			<td>Sigma-Aldrich</td>
			<td>C6164</td>
			<td>Compounds solvent, ready to use</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Dulbecco&#39;s Modified Eagle Medium (DMEM)</td>
			<td>Life Technologies</td>
			<td>12491-015</td>
			<td>For cell culture, ready to use</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Dulbecco&#39;s Modified Eagle Medium Mixture F-12 (DMEM-F12)</td>
			<td>Gibco</td>
			<td align="right">11320033</td>
			<td>For cell culture, ready to use</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">EDTA 0.1 mM (EDTA)</td>
			<td>Life Technologies</td>
			<td>AM9912</td>
			<td>For cell culture, ready to use</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Epidermal Growth Factor (EGF)</td>
			<td>Gibco</td>
			<td>PHG0313</td>
			<td>For GIC culture,&#160; stock solution 100 &#181;g/mL in pure H2O, final solution 10 ng/mL</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Fibroblast Growth Factor 20 (FGF20)</td>
			<td>Peprotech</td>
			<td>100-41</td>
			<td>For Dopaminergic protocol,&#160; stock solution 100 &#181;g/mL in pure H2O, final solution 5 ng/mL</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">fibroblast growth factor 8&#160; (FGF8)</td>
			<td>Peprotech</td>
			<td>GFH176-5</td>
			<td>For Dopaminergic protocol,&#160; stock solution 100 &#181;g/mL in pure H2O, final solution 100 ng/mL</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Fibroblast growth factor-basic (bFGF)</td>
			<td>Gibco</td>
			<td>PHG0024</td>
			<td>For GIC culture,&#160; stock solution 100 &#181;g/mL in pure H2O, final solution 10 ng/mL</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">G5 supplements (G5)</td>
			<td>Invitrogen</td>
			<td align="right">17503012</td>
			<td>For GIC culture, stock solution 100x, final solution 1x</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Glial cell-derived neurotrophic factor (GDNF)</td>
			<td>Cell Guidance</td>
			<td>GFH2-2</td>
			<td>For both protocol,&#160; stock solution 100 &#181;g/mL in pure H2O, final solution 20 ng/mL</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Hydrophilic polytetrafluoroethylene&#160; membrane (PTFE membrane)</td>
			<td>BioCell-Interface</td>
			<td>Discontinued</td>
			<td></td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">LDN-193189 (BMP inhibitor)</td>
			<td>Axon Medchem /Stemgen</td>
			<td>04-0072-02 /1509</td>
			<td>Dual/Smad,&#160; stock solution 5 mM in DMSO, final solution 0.5 &#181;M</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">L-glutamine (L-glutamine)</td>
			<td>Gibco</td>
			<td align="right">25030081</td>
			<td>L-Glutamine (200 mM), stock solution 200 mM, final solution 2 mM</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Matrigel (extracellular matrix)</td>
			<td>BD Biosciences</td>
			<td align="right">354277</td>
			<td>hESC-qualified Matrix, stock solution 18-22 mg/mL, final solution 180-220 &#181;g/mL</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Millicell-CM Culture plate insert&#160; (0.4 &#181;m) (Culture plate insert)</td>
			<td>Millipore</td>
			<td>PICM03050</td>
			<td></td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Monoclonal Anti-&#946;-Tubulin III antibody</td>
			<td>Sigma&#160;</td>
			<td>T8660&#160;</td>
			<td>1/1000 dilution</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">MS Orbital Shaker, MS-NOR-30 (Orbital shaker)</td>
			<td>Major Science</td>
			<td>MS-NRC-30</td>
			<td></td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">N2 supplements (N2)</td>
			<td>Invitrogen</td>
			<td>17502-048</td>
			<td>For GIC culture, stock solution 100x, final solution 1x</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Nanodrop (Nanodrop)</td>
			<td>Thermo Fisher Scientific</td>
			<td>Discontinued</td>
			<td></td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Neurobasal (Neurobasal)</td>
			<td>Life Technologies / Gibco</td>
			<td align="right">21103049</td>
			<td>Maintenance and maturation embryonic neuronal cell populations&#160;, ready to use</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Non-Essential Amino Acids&#160; (NEAA)</td>
			<td>Gibco</td>
			<td align="right">11140</td>
			<td>Non-essential Amino Acids 100X, stock solution 100x, final solution 1x</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Nurr1 Antibody (M-196)</td>
			<td>Santa Cruz</td>
			<td>Sc-5568</td>
			<td>1/100 dilution</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Nutristem&#160; (hESC medium )</td>
			<td>Biological Industries</td>
			<td>05-100-1A</td>
			<td>Stem cell media, ready to use</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Penicilin / Streptomycin&#160; (Penicilin / Streptomycin )</td>
			<td>Life Technologies / Gibco</td>
			<td align="right">15140122</td>
			<td>For cell culture, stock solution 5 mg/mL, final solution 50 &#181;g/mL&#160;</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Perchloric acid 0.1N (HCLO4)</td>
			<td>Merck</td>
			<td align="right">100519</td>
			<td>For HPLC, ready to use</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Phosphate Buffered Saline without Ca2+/Mg2+&#160; (PBS without Ca2+/Mg2+ )</td>
			<td>Life Technologies</td>
			<td align="right">14190250</td>
			<td>For cell culture, ready to use</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">PrimeScript RT-PCR Kit (Reverse transcription kit)</td>
			<td>Takara</td>
			<td>RR014A</td>
			<td></td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Purmorphamin (smoothened agonist)</td>
			<td>Calbiochem</td>
			<td>SML0868</td>
			<td>For Dopaminergic protocol,&#160; stock solution 10 mM in DMSO, final solution 2 &#181;M</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Rho-associated Kinase Y-27632 (ROCK)</td>
			<td>Abcam Biochemicals</td>
			<td>ab120129-1</td>
			<td>Rock Inhibitor,&#160; stock solution 50 mM in DMSO, final solution 10 &#181;M</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">RNeasy mini kit (RNA extraction kit )</td>
			<td>Qiagen</td>
			<td align="right">74104</td>
			<td></td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">SB-431542 (TGF&#946;/Activin/Nodal inhibitor )</td>
			<td>Ascent</td>
			<td>Asc- 163</td>
			<td>Dual-Smad,&#160; stock solution 50 mM in DMSO, final solution 10 &#181;M</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Sonic Hedgehog (SHH)</td>
			<td>Cell Guidance</td>
			<td>GFH168-5</td>
			<td>For Dopaminergic protocol,&#160; stock solution 100 &#181;g/mL in pure H2O, final solution 100 ng/mL</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">StemPro Accutase (hESC enzymatic solution)</td>
			<td>Gibco</td>
			<td>A11105-01</td>
			<td>hESC enzymatic solution, ready to use</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Symmetry C-18,5 mm (4.6 150mm2)&#160; (Reversed-phase column)</td>
			<td>Waters Corporation</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">T150 flask (T150 flask)</td>
			<td>Falcon</td>
			<td>08-772-1F</td>
			<td></td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">TH Antibody (F-11)</td>
			<td>Santa Cruz</td>
			<td>Sc-25269</td>
			<td>1/200 dilution</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Transforming Growth Factors beta 3 (TGF&#946;3)</td>
			<td>Cell Guidance</td>
			<td>GFH109-2</td>
			<td>For Dopaminergic protocol,&#160; stock solution 100 &#181;g/mL in pure ethanol , final solution 1 ng/mL</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Trichostatine A (inhibitor of histone deacetylase )</td>
			<td>Sigma</td>
			<td>T8552</td>
			<td>For Dopaminergic protocol,&#160; stock solution 100 &#181;M in DMSO, final solution 20 nM</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">TrypLE (recombinant enzymatic solution)</td>
			<td>Invitrogen</td>
			<td align="right">12604021</td>
			<td>recombinant enzymatic solution, ready to use</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">Trypsin 0.25% (enzymatic solution)</td>
			<td>Life Technologies</td>
			<td align="right">15050065</td>
			<td>enzymatic solution, ready to use</td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">W2100, Multi Channel Systems (Data acquisition system )</td>
			<td></td>
			<td>WAT045905</td>
			<td></td>
		</tr>
		<tr height="19">
			<td height="19" style="height:20px;">X-vivo (serum free medium)</td>
			<td>Lonza</td>
			<td>BE04-743Q</td>
			<td>serum free medium, ready to use</td>
		</tr>
	</tbody>
</table>

human neural organoids for studying brain cancer and neurodegenerative diseases

The lack of relevant in vitro neural models is an important obstacle on medical progress for neuropathologies. Establishment of relevant cellular models is crucial both to better understand the pathological mechanisms of these diseases and identify new therapeutic targets and strategies. To be pertinent, an in vitro model must reproduce the pathological features of a human disease. However, in the context of neurodegenerative disease, a relevant in vitro model should provide neural cell replacement as a valuable therapeutic opportunity. 
Such a model would not only allow screening of therapeutic molecules but also can be used to optimize neural protocol differentiation [for example, in the context of transplantation in Parkinson's disease (PD)]. This study describes two in vitro protocols of 1) human glioblastoma development within a human neural organoids (NO) and 2) neuron dopaminergic (DA) differentiation generating a three-dimensional (3D) organoid. For this purpose, a well-standardized protocol was established that allows the production of size-calibrated neurospheres derived from human embryonic stem cell (hESC) differentiation. The first model can be used to reveal molecular and cellular events occurring during in glioblastoma development within the neural organoid, while the DA organoid not only represents a suitable source of DA neurons for cell therapy in Parkinson's disease but also can be used for drug testing.

The critical steps of this protocol must be well-identified and handled properly. Therefore, a diagram of culture conditions indicating the time-lapse for each step as well as the compounds used for the differentiation protocol are illustrated in Figure 1A and Figure 3A for NO plus GBM and DA neural organoids, respectively. Figure 1B,C,D,E,F illustrates the cells, spheres, and NO and show the typical morphology for each step. Figure 1G,H,I illustrates immunofluorescence staining with some neural markers.
<img alt="Figure 1" class="xfigimg" src="/files/ftp_upload/59682/59682fig1.jpg" /> 
Figure 1: Human neural organoid (NO)&#160;differentiation protocol. (A) Standardized protocol for the generation of NO derived from human embryonic stem cells (hESC). (B) hESCs are maintained on extracellular matrix in hESC medium. (C) Microwell plates were used to generate calibrated neurospheres. At 2 weeks, neurospheres were plated onto the insert containing a PTFE membrane (scale bar = 50 &#181;m). (D) Macroscopic view of NO into the insert in one well of a 6 well plate. During the first days, rosettes were observed (black arrow) (E). (F) Macroscopic view of a NO plus GIC sphere on the top. (G-I) Immunofluorescence analysis of NO plus GIC sphere (EGFR-positive; scale bar = 50 &#181;m) (G) and NO alone, which showed immune reactivity for the neuronal marker &#946;III-tubulin and slightly positive for nestin; however, synapsin 1 showed a weak signal (H,I) (scale bars = 100 &#181;m and 50 &#181;m, respectively). <a href="https://www.jove.com/files/ftp_upload/59682/59682fig1large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 2" class="xfigimg" src="/files/ftp_upload/59682/59682fig2.jpg" /> 
Figure 2: Illustration of necrotic spheres and immature NO. The neurospheres (A) and NO (B) can undergo necrosis when they are too numerous in the well or oversized (C) (scale bar = 10 &#181;m). (D) One GIC infected with a tomato reporter help to track tumor cell invasion in NO, scale bar, 10 &#181;m. Example of immature NO with neural tubes (E) and no neural tubes (F) (scale bar = 50 &#181;m). <a href="https://www.jove.com/files/ftp_upload/59682/59682fig2large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/59682/59682fig3.jpg" /> 
Figure 3: Standardized protocol for generation of DA neural organoid&#160;and electrophysiological and morphological analysis. (A) Standardized protocol for the generation of DA neural organoids. (B) Immunofluorescence analysis of DA neural organoid; TH-immunoreactive cells co-expressing Nurr1, a midbrain specific marker (scale bar = 50 &#181;m). Data are represented as mean &#177; SEM (n = 3). (C) Graphs represent kinetics of TH and Nurr1 gene expression evaluated by qRT-PCR. (D) Representative HPLC: dopamine peak (arrow) was detected by HPLC from DA neural organoid lysate. (E) Example of raw data recorded with MEA platform. Each spike is displayed by a vertical line (time stamps), whereas the remaining trace is noise. (F) Picture representing a neurosphere deposited on the MEA. (G) Superposition of typical spikes (blue and red curves) detected from the raw data. The black bold curve indicates the average of the corresponding red curves. (H) Raster plot showing the time stamps associated with each spike detected. The different colors highlight the different electrodes. <a href="https://www.jove.com/files/ftp_upload/59682/59682fig3large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Gene</td>
			<td>Foward</td>
			<td>Reverse</td>
		</tr>
		<tr>
			<td>Nurr1</td>
			<td>GGCTGAAGCCATGCCTTGT</td>
			<td>GTGAGGTCCATGCTAAACTTGACA</td>
		</tr>
		<tr>
			<td>TH</td>
			<td>GCACCTTCGCGCAGTTCT</td>
			<td>CCCGAACTCCACCGTGAA</td>
		</tr>
		<tr>
			<td>EEF1</td>
			<td>AGCAAAAATGACCCACCAATG</td>
			<td>GCCTGGATGGTTCAGGATA</td>
		</tr>
		<tr>
			<td>GAPDH</td>
			<td>GCACAAGAGGAAAGAGAGAGAACC</td>
			<td>AGGGGAGATTCAGTGTGGGT</td>
		</tr>
	</tbody>
</table>
Table 1: Primers used in this protocol.

Watch this Scientific Journal Video about Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases at JoVE.com

Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases

This study introduces and describes protocols to derive two specific human neural organoids&#160;as a relevant and accurate model for studying 1) human glioblastoma development within human neural organoids exclusively in humans and 2) neuron dopaminergic differentiation generating a three-dimensional organoid.

The lack of relevant in vitro neural models is an important obstacle on medical progress for neuropathologies. Establishment of relevant cellular models ...

human-neural-organoids-for-studying-brain-cancer-neurodegenerative

Research

JoVE Journal

Bioengineering

9.7K Views.  University of Geneva. This study introduces and describes protocols to derive two specific human neural organoids as a relevant and accurate model for studying 1) human glioblastoma development within human neural organoids exclusively in humans and 2) neuron dopaminergic differentiation generating a three-dimensional organoid.

Video: Human Neural Organoids for Studying Brain Cancer and Neurodegenerative Diseases

Utilization of Plasmonic and Photonic Crystal Nanostructures for Enhanced Micro- and Nanoparticle Manipulation

A method to manipulate the position and orientation of submicron particles nondestructively would be an incredibly useful tool for basic biological research. Perhaps the most widely used physical force to achieve noninvasive manipulation of small particles has been dielectrophoresis(DEP).1 However, DEP on its own lacks the versatility and precision that are desired when manipulating cells since it is traditionally done with stationary electrodes. Optical tweezers, which utilize a three dimensional electromagnetic field gradient to exert forces on small particles, achieve this desired versatility and precision.2 However, a major drawback of this approach is the high radiation intensity required to achieve the necessary force to trap a particle which can damage biological samples.3 A solution that allows trapping and sorting with lower optical intensities are optoelectronic tweezers (OET) but OET's have limitations with fine manipulation of small particles; being DEP-based technology also puts constraint on the property of the solution.4,5
This video article will describe two methods that decrease the intensity of the radiation needed for optical manipulation of living cells and also describe a method for orientation control. The first method is plasmonic tweezers which use a random gold nanoparticle (AuNP) array as a substrate for the sample as shown in Figure 1. The AuNP array converts the incident photons into localized surface plasmons (LSP) which consist of resonant dipole moments that radiate and generate a patterned radiation field with a large gradient in the cell solution. Initial work on surface plasmon enhanced trapping by Righini et al and our own modeling have shown the fields generated by the plasmonic substrate reduce the initial intensity required by enhancing the gradient field that traps the particle.6,7,8 The plasmonic approach allows for fine orientation control of ellipsoidal particles and cells with low optical intensities because of more efficient optical energy conversion into mechanical energy and a dipole-dependent radiation field. These fields are shown in figure 2 and the low trapping intensities are detailed in figures 4 and 5. The main problems with plasmonic tweezers are that the LSP's generate a considerable amount of heat and the trapping is only two dimensional. This heat generates convective flows and thermophoresis which can be powerful enough to expel submicron particles from the trap.9,10 The second approach that we will describe is utilizing periodic dielectric nanostructures to scatter incident light very efficiently into diffraction modes, as shown in figure 6.11 Ideally, one would make this structure out of a dielectric material to avoid the same heating problems experienced with the plasmonic tweezers but in our approach an aluminum-coated diffraction grating is used as a one-dimensional periodic dielectric nanostructure. Although it is not a semiconductor, it did not experience significant heating and effectively trapped small particles with low trapping intensities, as shown in figure 7. Alignment of particles with the grating substrate conceptually validates the proposition that a 2-D photonic crystal could allow precise rotation of non-spherical micron sized particles.10 The efficiencies of these optical traps are increased due to the enhanced fields produced by the nanostructures described in this paper.

Plasmonic tweezers and photonic crystal nanostructures are shown to produce useful enhancements in the efficiency and orientation control of optically trapping micro- and nano-particles.

A method to manipulate the position and orientation of submicron particles nondestructively would be an incredibly useful tool for basic biological ...

Endothelialized Microfluidics for Studying Microvascular Interactions in Hematologic Diseases

Advances in microfabrication techniques have enabled the production of inexpensive and reproducible microfluidic systems for conducting biological and biochemical experiments at the micro- and nanoscales 1,2. In addition, microfluidics have also been specifically used to quantitatively analyze hematologic and microvascular processes, because of their ability to easily control the dynamic fluidic environment and biological conditions3-6. As such, researchers have more recently used microfluidic systems to study blood cell deformability, blood cell aggregation, microvascular blood flow, and blood cell-endothelial cell interactions6-13.However, these microfluidic systems either did not include cultured endothelial cells or were larger than the sizescale relevant to microvascular pathologic processes. A microfluidic platform with cultured endothelial cells that accurately recapitulates the cellular, physical, and hemodynamic environment of the microcirculation is needed to further our understanding of the underlying biophysical pathophysiology of hematologic diseases that involve the microvasculature.
Here, we report a method to create an "endothelialized" in vitro model of the microvasculature, using a simple, single mask microfabrication process in conjunction with standard endothelial cell culture techniques, to study pathologic biophysical microvascular interactions that occur in hematologic disease. This "microvasculature-on-a-chip" provides the researcher with a robust assay that tightly controls biological as well as biophysical conditions and is operated using a standard syringe pump and brightfield/fluorescence microscopy. Parameters such as microcirculatory hemodynamic conditions, endothelial cell type, blood cell type(s) and concentration(s), drug/inhibitory concentration etc., can all be easily controlled. As such, our microsystem provides a method to quantitatively investigate disease processes in which microvascular flow is impaired due to alterations in cell adhesion, aggregation, and deformability, a capability unavailable with existing assays.

A method to culture an endothelial cell monolayer throughout the entire inner 3D surface of a microfluidic device with microvascular-sized channels (&lt;30 &mu;m) is described. This in vitro microvasculature model enables the study of biophysical interactions between blood cells, endothelial cells, and soluble factors in hematologic diseases.

Advances in  microfabrication techniques have enabled the production of inexpensive and  reproducible microfluidic systems for conducting biological and ...

Improved Method for the Preparation of a Human Cell-based, Contact Model of the Blood-Brain Barrier

The blood-brain barrier (BBB) comprises impermeable but adaptable brain capillaries which tightly control the brain environment. Failure of the BBB has been implied in the etiology of many brain pathologies, creating a need for development of human in vitro BBB models to assist in clinically-relevant research. Among the numerous BBB models thus far described, a static (without flow), contact BBB model, where astrocytes and brain endothelial cells (BECs) are cocultured on the opposite sides of a porous membrane, emerged as a simplified yet authentic system to simulate the BBB with high throughput screening capacity. Nevertheless the generation of such model presents few technical challenges. Here, we describe a protocol for preparation of a contact human BBB model utilizing a novel combination of primary human BECs and immortalized human astrocytes. Specifically, we detail an innovative method for cell-seeding on inverted inserts as well as specify insert staining techniques and exemplify how we use our model for BBB-related research.

Establishment of human models of the blood-brain barrier (BBB) can benefit research into brain conditions associated with BBB failure. We describe here an improved technique for preparation of a contact BBB model, which permits coculturing of human astrocytes and brain endothelial cells on the opposite sides of a porous membrane.

The blood-brain barrier (BBB) comprises impermeable but adaptable brain capillaries which tightly control the brain environment. Failure of the BBB has ...

Fabrication and Implantation of Miniature Dual-element Strain Gages for Measuring In Vivo Gastrointestinal Contractions in Rodents.

Gastrointestinal dysfunction remains a major cause of morbidity and mortality. Indeed, gastrointestinal (GI) motility in health and disease remains an area of productive research with over 1,400 published animal studies in just the last 5 years. Numerous techniques have been developed for quantifying smooth muscle activity of the stomach, small intestine, and colon. In vitro and ex vivo techniques offer powerful tools for mechanistic studies of GI function, but outside the context of the integrated systems inherent to an intact organism. Typically, measuring in vivo smooth muscle contractions of the stomach has involved an anesthetized preparation coupled with the introduction of a surgically placed pressure sensor, a static pressure load such as a mildly inflated balloon or by distending the stomach with fluid under barostatically-controlled feedback. Yet many of these approaches present unique disadvantages regarding both the interpretation of results as well as applicability for in vivo use in conscious experimental animal models. The use of dual element strain gages that have been affixed to the serosal surface of the GI tract has offered numerous experimental advantages, which may continue to outweigh the disadvantages. Since these gages are not commercially available, this video presentation provides a detailed, step-by-step guide to the fabrication of the current design of these gages. The strain gage described in this protocol is a design for recording gastric motility in rats. This design has been modified for recording smooth muscle activity along the entire GI tract and requires only subtle variation in the overall fabrication. Representative data from the entire GI tract are included as well as discussion of analysis methods, data interpretation and presentation.

Fabrication and Implantation of Miniature Dual-element Strain Gages for Measuring In Vivo Gastrointestinal Contractions in Rodents.

The in vivo measurement of smooth muscle contractions along the gastrointestinal tract of laboratory animals remains a powerful, though underutilized, technique. Flexible, dual element strain gages are not commercially available and require fabrication. This protocol describes the construction of reliable, inexpensive strain gages for acute or chronic implantation in rodents.

Gastrointestinal dysfunction remains a major cause of morbidity and mortality. Indeed, gastrointestinal (GI) motility in health and disease remains an ...

Sensitive Detection of Proteopathic Seeding Activity with FRET Flow Cytometry

Increasing evidence supports transcellular propagation of toxic protein aggregates, or proteopathic seeds, as a mechanism for the initiation and progression of pathology in several neurodegenerative diseases, including Alzheimer's disease and the related tauopathies. The potentially critical role of tau seeds in disease progression strongly supports the need for a sensitive assay that readily detects seeding activity in biological samples. 
By combining the specificity of fluorescence resonance energy transfer (FRET), the sensitivity of flow cytometry, and the stability of a monoclonal cell line, an ultra-sensitive seeding assay has been engineered and is compatible with seed detection from recombinant or biological samples, including human and mouse brain homogenates. The assay employs monoclonal HEK 293T cells that stably express the aggregation-prone repeat domain (RD) of tau harboring the disease-associated P301S mutation fused to either CFP or YFP, which produce a FRET signal upon protein aggregation. The uptake of proteopathic tau seeds (but not other proteins) into the biosensor cells stimulates aggregation of RD-CFP and RD-YFP, and flow cytometry sensitively and quantitatively monitors this aggregation-induced FRET. The assay detects femtomolar concentrations (monomer equivalent) of recombinant tau seeds, has a dynamic range spanning three orders of magnitude, and is compatible with brain homogenates from tauopathy transgenic mice and human tauopathy subjects. With slight modifications, the assay can also detect seeding activity of other proteopathic seeds, such as &#945;-synuclein, and is also compatible with primary neuronal cultures. The ease, sensitivity, and broad applicability of FRET flow cytometry makes it useful to study a wide range of protein aggregation disorders.

Cell-to-cell transfer of protein aggregates, or proteopathic seeds, may underlie the progression of pathology in neurodegenerative diseases. Here, a novel FRET flow cytometry assay is described that enables specific and sensitive detection of seeding activity from recombinant or biological samples.

Increasing evidence supports transcellular propagation of toxic protein aggregates, or proteopathic seeds, as a mechanism for the initiation and ...

A Human 3D Extracellular Matrix-Adipocyte Culture Model for Studying Matrix-Cell Metabolic Crosstalk

The extracellular matrix (ECM) plays a central role in regulating tissue homeostasis, engaging in crosstalk with cells and regulating multiple aspects of cellular function. The ECM plays a particularly important role in adipose tissue function in obesity, and alterations in adipose tissue ECM deposition and composition are associated with metabolic disease in mice and humans. Tractable in vitro models that permit dissection of the roles of the ECM and cells in contributing to global tissue phenotype are sparse. We describe a novel 3D in vitro model of human ECM-adipocyte culture that permits study of the specific roles of the ECM and adipocytes in regulating adipose tissue metabolic phenotype. Human adipose tissue is decellularized to isolate ECM, which is subsequently repopulated with preadipocytes that are then differentiated within the ECM into mature adipocytes. This method creates ECM-adipocyte constructs that are metabolically active and retain characteristics of the tissues and patients from which they are derived. We have used this system to demonstrate disease-specific ECM-adipocyte crosstalk in human adipose tissue. This culture model provides a tool for dissecting the roles of the ECM and adipocytes in contributing to global adipose tissue metabolic phenotype and permits study of the role of the ECM in regulating adipose tissue homeostasis.

We describe a 3D human extracellular matrix-adipocyte in vitro culture system that permits dissection of the roles of the matrix and adipocytes in contributing to adipose tissue metabolic phenotype.

The extracellular matrix (ECM) plays a central role in regulating tissue homeostasis, engaging in crosstalk with cells and regulating multiple aspects of ...

Scalable Generation of Mature Cerebellar Organoids from Human Pluripotent Stem Cells and Characterization by Immunostaining

The cerebellum plays a critical role in the maintenance of balance and motor coordination, and a functional defect in different cerebellar neurons can trigger cerebellar dysfunction. Most of the current knowledge about disease-related neuronal phenotypes is based on postmortem tissues, which makes understanding of disease progression and development difficult. Animal models and immortalized cell lines have also been used as models for neurodegenerative disorders. However, they do not fully recapitulate human disease. Human induced pluripotent stem cells (iPSCs) have great potential for disease modeling and provide a valuable source for regenerative approaches. In recent years, the generation of cerebral organoids from patient-derived iPSCs improved the prospects for neurodegenerative disease modeling. However, protocols that produce large numbers of organoids and a high yield of mature neurons in 3D culture systems are lacking. The protocol presented is a new approach for reproducible and scalable generation of human iPSC-derived organoids under chemically-defined conditions using scalable single-use bioreactors, in which organoids acquire cerebellar identity. The generated organoids are characterized by the expression of specific markers at both mRNA and protein level. The analysis of specific groups of proteins allows the detection of different cerebellar cell populations, whose localization is important for the evaluation of organoid structure. Organoid cryosectioning and further immunostaining of organoid slices are used to evaluate the presence of specific cerebellar cell populations and their spatial organization.

This protocol describes a dynamic culture system to produce controlled size aggregates of human pluripotent stem cells and further stimulate differentiation in cerebellar organoids under chemically-defined and feeder-free conditions using a single-use bioreactor.

The cerebellum plays a critical role in the maintenance of balance and motor coordination, and a functional defect in different cerebellar neurons can ...

Manipulation of Single Neural Stem Cells and Neurons in Brain Slices using Robotic Microinjection

A central question in developmental neurobiology is how neural stem and progenitor cells form the brain. To answer this question, one needs to label, manipulate, and follow single cells in the brain tissue with high resolution over time. This task is extremely challenging due to the complexity of tissues in the brain. We have recently developed a robot, that guide a microinjection needle into brain tissue upon utilizing images acquired from a microscope to deliver femtoliter volumes of solution into single cells. The robotic operation increases resulting an overall yield that is an order of magnitude greater than manual microinjection and allows for precise labeling and flexible manipulation of single cells in living tissue. With this, one can microinject hundreds of cells within a single organotypic slice. This article demonstrates the use of the microinjection robot for automated microinjection of neural progenitor cells and neurons in the brain tissue slices. More broadly, it can be used on any epithelial tissue featuring a surface that can be reached by the pipette. Once set up, the microinjection robot can execute 15 or more microinjections per minute. The microinjection robot because of its throughput and versality will make microinjection a broadly straightforward high-performance cell manipulation technique to be used in bioengineering, biotechnology, and biophysics for performing single-cell analyses in organotypic brain slices.

This protocol demonstrates the use of a robotic platform for microinjection into single neural stem cells and neurons in brain slices. This technique is versatile and offers a method of tracking cells in tissue with high spatial resolution.

A central question in developmental neurobiology is how neural stem and progenitor cells form the brain. To answer this question, one needs to label, ...

Toxicity Screens in Human Retinal Organoids for Pharmaceutical Discovery

Organoids provide a promising platform to study disease mechanism and treatments, directly in the context of human tissue with the versatility and throughput of cell culture. Mature human retinal organoids are utilized to screen potential pharmaceutical treatments for the age-related retinal degenerative disease macular telangiectasia type 2 (MacTel).
We have recently shown that MacTel can be caused by elevated levels of an atypical lipid species, deoxysphingolipids (deoxySLs). These lipids are toxic to the retina and may drive the photoreceptor loss that occurs in MacTel patients. To screen drugs for their ability to prevent deoxySL photoreceptor toxicity, we generated human retinal organoids from a non-MacTel induced pluripotent stem cell (iPSC) line and matured them to a post-mitotic age where they develop all of the neuronal lineage-derived cells of the retina, including functionally mature photoreceptors. The retinal organoids were treated with a deoxySL metabolite and apoptosis was measured within the photoreceptor layer using immunohistochemistry. Using this toxicity model, pharmacological compounds that prevent deoxySL-induced photoreceptor death were screened. Using a targeted candidate approach, we determined that fenofibrate, a drug commonly prescribed for the treatment of high cholesterol and triglycerides, can also prevent deoxySL toxicity in the cells of the retina.
The toxicity screen successfully identified an FDA-approved drug that can prevent photoreceptor death. This is a directly actionable finding owing to the highly disease-relevant model tested. This platform can be easily modified to test any number of metabolic stressors and potential pharmacological interventions for future treatment discovery in retinal diseases.

Here we present a step-by-step protocol to generate mature human retinal organoids and utilize them in a photoreceptor toxicity assay to identify pharmaceutical candidates for the age-related retinal degenerative disease macular telangiectasia type 2 (MacTel).

Organoids provide a promising platform to study disease mechanism and treatments, directly in the context of human tissue with the versatility and ...

Fibroblast Derived Human Engineered Connective Tissue for Screening Applications

Fibroblasts are phenotypically highly dynamic cells, which quickly transdifferentiate into myofibroblasts in response to biochemical and biomechanical stimuli. The current understanding of fibrotic processes, including cardiac fibrosis, remains poor, which hampers the development of new anti-fibrotic therapies. Controllable and reliable human model systems are crucial for a better understanding of fibrosis pathology. This is a highly reproducible and scalable protocol to generate engineered connective tissues (ECT) in a 48-well casting plate to facilitate studies of fibroblasts and the pathophysiology of fibrotic tissue in a 3-dimensional (3D) environment. ECT are generated around the poles with tunable stiffness, allowing for studies under a defined biomechanical load. Under the defined loading conditions, phenotypic adaptations controlled by cell-matrix interactions can be studied. Parallel testing is feasible in the 48-well format with the opportunity for the time-course analysis of multiple parameters, such as tissue compaction and contraction against the load. From these parameters, biomechanical properties such as tissue stiffness and elasticity can be studied.

Presented here is a protocol to generate engineered connective tissues for a parallel culture of 48 tissues in a multi-well plate with double poles, suitable for mechanistic studies, disease modeling, and screening applications. The protocol is compatible with fibroblasts from different organs and species and is exemplified here with human primary cardiac fibroblasts.

Fibroblasts are phenotypically highly dynamic cells, which quickly transdifferentiate into myofibroblasts in response to biochemical and biomechanical ...