A Quantitative Detection Method for MicroRNAs in the Kidney of an Ischemic Kidney Injury Mouse Model

Summary

This article presents a protocol for detecting microRNA expression in the kidneys of an acute kidney injury mouse model using quantitative real-time reverse-transcription polymerase chain reaction. This protocol emphasizes an ischemic kidney injury mouse model and the careful extraction of microRNA samples.

Abstract

MicroRNAs (miRNAs) are involved in various disease states and are effective biomarkers for the early diagnosis of diseases and treatment in mice. However, standard protocols for the purification of miRNAs and detection of their expression in the kidneys of acute kidney injury (AKI) mice have not been well established. This study developed an effective and simple protocol to purify and quantify miRNAs in the kidneys of an AKI mouse model induced by renal ischemia-reperfusion using quantitative real-time reverse-transcription polymerase chain reaction (qRT-PCR). This protocol comprises five steps: 1) induction of AKI by renal ischemia-reperfusion, 2) harvesting of kidneys, 3) purification of total RNA, including miRNAs, from kidneys, 4) cDNA synthesis by reverse transcription of miRNA, and 5) qRT-PCR to detect miRNA expression. Using this protocol, the renal ischemia-reperfusion injury model can be generated with mild to severe forms of AKI. Additionally, if the procedure is followed properly, a consistent AKI model with minimal individual differences can be obtained. This qRT-PCR assay shows a very wide dynamic range and enables the discrimination of mature miRNAs, which can be accurately quantified with high specificity. This protocol can be used to study the miRNA expression profile in AKI kidneys.

Introduction

Ischemia-reperfusion injury (IRI) of the kidney represents one of the major risk factors for Acute kidney injury (AKI) development¹. AKI plays a significant role in patient prognosis, but specific therapies and early diagnostic biomarkers have not been established.

MicroRNAs (miRNAs) are short, non-coding RNAs with approximately 18–25 bases. miRNAs are stable in body fluids, and their sequences are highly conserved among animals². MiRNAs regulate the expression of multiple proteins through thousands of targets, thereby influencing diverse signaling pathways^2,....

Protocol

All animal experimental protocols were approved by the animal ethics committee of Jichi Medical University and performed in accordance with the Use and Care of Experimental Animals guidelines from the Jichi Medical University Guide for Laboratory Animals.

1. IRI model

NOTE: Carefully monitor for hypothermia, intestinal moisturization, and depth of anesthesia throughout the procedure.

1. Prepare the following items: a 50 mL centrifuge tube containing cotton drenched in isoflurane, a heated surgical pad, a Petri dish with phosphate-buffered saline (PBS), surgical scissors, and forceps. Maintain the PBS at ....

Results

Here, the miRNA expression profile in AKI mice was investigated. The miRNA expression profile has been investigated in various organs and tissues in mice. MiRNAs are important post-transcriptional regulators and are now being extensively studied in the characterization of a variety of diseases, including AKI. MiRNAs have the potential to help elucidate pathological conditions and be applied to the treatment of AKI¹². The major causes of AKI are IRI, nephrotoxic insult, and sepsis. IRI of the kidne.......

Discussion

Using the protocol presented in this manuscript, miRNAs from the kidney of IRI mice were successfully purified and detected using qRT-PCR. Critical points of the IRI-inducing procedure in the protocol include careful monitoring of body temperature and anesthesia concentrations, which are known to affect AKI²⁰. The strength of this protocol is that it allows visual confirmation of whether ischemia-reperfusion has been achieved. However, there are some limitations to this IRI model. Prolonging the c.......

Materials

Name	Company	Catalog Number	Comments
Bent Tip Tapered Tweezers without Hook	Natsume Seisakusho	MA-47
Buffer RLT	Qiagen	79216	wash buffer 1
Buffer RWT	Qiagen	1067933	wash buffer 2
C57B6 mice	SLC	not assign
forcep with Teeth	Natsume Seisakusho	MA-49
forcep without Teeth	Natsume Seisakusho	MA-48-1
Hemostatic clips	Natsume Seisakusho	KN−353
MicroAmp Optical 96 well reaction plate for qRT-PCR	Thermo Fisher Scientific	4316813	96-well reaction plate
MicroAmp Optical Adhesive Film	Thermo Fisher Scientific	4311971	adhesive film for 96-well reaction plate
miRNA-132-3p primer	Qiagen	MS00003458	5'UAACAGUCUACAGCCAUGGUCG
miRNA-17-5p primer	Qiagen	MS00029274	5'CAAAGUGCUUACAGUGCAGGUAG
miRNA-18a-5p primer	Qiagen	MS00031514	5'UAAGGUGCAUCUAGUGCAGAUAG
miRNA-212-3p primer	Qiagen	MS00003815	5'UAACAGUCUCCAGUCACGGCC
miRNA-21a-5p primer	Qiagen	MS00009079	5'UAGCUUAUCAGACUGAUGUUGA
miRNA-223-3p primer	Qiagen	MS00003871	5'UGUCAGUUUGUCAAAUACCCCA
miRNA-574-5p primer	Qiagen	MS00043617	5'UGAGUGUGUGUGUGUGAGUGUGU
miRNeasy Mini kit	Qiagen	217004	silica-membrane based spin column
miScript II RT kit	Qiagen	218161
miScript SYBR Green PCR kit	Qiagen	218073
QIA shredder	Qiagen	79654	biopolymer-shredding system in a micro centrifuge spin-column
QIAzol Lysis Reagent	Qiagen	79306	phenol/guanidine-based lysis reagent
QuantStudio 12K Flex Flex Real-Time PCR system	Thermo Fisher Scientific	4472380	real-time PCR instrument
QuantStudio 12K Flex Software version 1.2.1.	Thermo Fisher Scientific	4472380	real-time PCR instrument software
RNU6-2 primer	Qiagen	MS00033740	not disclosed
surgical scissors	Natsume Seisakusho	B-2
Vascular clip applier	VITALITEC	1621420