We are thankful to Junbeom Lee for providing the E. coli WM3064+pRL27 strain for conjugation and guidance in the procedure, Kathrin H&#252;ffmeier for helping with troubleshooting during mutant library generation, and Prof. Andr&#233; Rodrigues for supporting insect collection and permit acquisition. We also thank Rebekka Janke and Dagmar Klebsch for support in the collection and rearing of the insects. We acknowledge the Brazilian authorities for granting the following permits for access, collection, and export of insect specimens: SISBIO authorization Nr. 45742-1, 45742-7 and 45742-10, CNPq process n&#186; 01300.004320/2014-21 and 01300.0013848/2017-33, IBAMA Nr. 14BR016151DF and 20BR035212/DF). This research was supported by funding from the German Science Foundation (DFG) Research Grants FL1051/1-1 and KA2846/6-1.

<ol>
	<li>Cain, A. K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+decade+of+advances+in+transposon-insertion+sequencing.">A decade of advances in transposon-insertion sequencing.</a> Nature Reviews Genetics. 21 (9), 526-540 (2020).</li><li>Chao, M. C., Abel, S., Davis, B. M., Waldor, M. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+design+and+analysis+of+transposon+insertion+sequencing+experiments.">The design and analysis of transposon insertion sequencing experiments.</a> Nature Reviews Microbiology. 14 (2), 119-128 (2016).</li><li>Barquist, L., Boinett, C. J., Cain, A. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Approaches+to+querying+bacterial+genomes+with+transposon-insertion+sequencing.">Approaches to querying bacterial genomes with transposon-insertion sequencing.</a> RNA Biology. 10 (7), 1161-1169 (2013).</li><li>Fl&#243;rez, L. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Antibiotic-producing+symbionts+dynamically+transition+between+plant+pathogenicity+and+insect-defensive+mutualism.">Antibiotic-producing symbionts dynamically transition between plant pathogenicity and insect-defensive mutualism.</a> Nature Communications. 8 (1), 15172 (2017).</li><li>Fl&#243;rez, L. V., Kaltenpoth, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Symbiont+dynamics+and+strain+diversity+in+the+defensive+mutualism+between+Lagria+beetles+and+Burkholderia.">Symbiont dynamics and strain diversity in the defensive mutualism between Lagria beetles and Burkholderia.</a> Environmental Microbiology. 19 (9), 3674-3688 (2017).</li><li>Fl&#243;rez, L. V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+antifungal+polyketide+associated+with+horizontally+acquired+genes+supports+symbiont-mediated+defense+in+Lagria+villosa+beetles.">An antifungal polyketide associated with horizontally acquired genes supports symbiont-mediated defense in Lagria villosa beetles.</a> Nature Communications. 9 (1), 2478 (2018).</li><li>. FastQC A quality control tool for high throughput sequence data Available from: <a target="_blank" href="https://www.bioinformatics.babraham.ac.uk/projects/fastqc/">https://www.bioinformatics.babraham.ac.uk/projects/fastqc/</a> (2012)</li><li>Martin, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cutadapt+removes+adapter+sequences+from+high-throughput+sequencing+reads.">Cutadapt removes adapter sequences from high-throughput sequencing reads.</a> EMBnet.journal. 17 (1), 10-12 (2011).</li><li>Bolger, A. M., Lohse, M., Usadel, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Trimmomatic:+A+flexible+trimmer+for+Illumina+sequence+data.">Trimmomatic: A flexible trimmer for Illumina sequence data.</a> Bioinformatics. 30 (15), 2114-2120 (2014).</li><li>Langmead, B., Salzberg, S. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fast+gapped-read+alignment+with+Bowtie+2.">Fast gapped-read alignment with Bowtie 2.</a> Nature Methods. 9 (4), 357-359 (2012).</li><li>Liao, Y., Smyth, G. K., Shi, W. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=FeatureCounts:+An+efficient+general+purpose+program+for+assigning+sequence+reads+to+genomic+features.">FeatureCounts: An efficient general purpose program for assigning sequence reads to genomic features.</a> Bioinformatics. 30 (7), 923-930 (2014).</li><li>Love, M. I., Huber, W., Anders, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Moderated+estimation+of+fold+change+and+dispersion+for+RNA-seq+data+with+DESeq2.">Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2.</a> Genome Biology. 15 (12), 550 (2014).</li><li>Gayt&#225;n, M. O., Mart&#237;nez-Santos, V. I., Soto, E., Gonz&#225;lez-Pedrajo, B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Type+three+secretion+system+in+attaching+and+effacing+pathogens.">Type three secretion system in attaching and effacing pathogens.</a> Frontiers in Cellular and Infection Microbiology. 6, 129 (2016).</li><li>Hachani, A., Wood, T. E., Filloux, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Type+VI+secretion+and+anti-host+effectors.">Type VI secretion and anti-host effectors.</a> Current Opinion in Microbiology. 29, 81-93 (2016).</li><li>Deep, A., Chaudhary, U., Gupta, V. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Quorum+sensing+and+bacterial+pathogenicity:+From+molecules+to+disease.">Quorum sensing and bacterial pathogenicity: From molecules to disease.</a> Journal of Laboratory Physicians. 3 (1), 4-11 (2011).</li><li>Silva, A. J., Benitez, J. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Vibrio+cholerae+biofilms+and+cholera+pathogenesis.">Vibrio cholerae biofilms and cholera pathogenesis.</a> PLOS Neglected Tropical Diseases. 10 (2), 0004330 (2016).</li><li>Navarro-Garcia, F., Ruiz-Perez, F., Cataldi, &. #. 1. 9. 3. ;., Larz&#225;bal, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Type+VI+secretion+system+in+pathogenic+Escherichia+coli:+structure,+role+in+virulence,+and+acquisition.">Type VI secretion system in pathogenic Escherichia coli: structure, role in virulence, and acquisition.</a> Frontiers in Microbiology. 10, 1965 (2019).</li><li>Ribet, D., Cossart, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=How+bacterial+pathogens+colonize+their+hosts+and+invade+deeper+tissues.">How bacterial pathogens colonize their hosts and invade deeper tissues.</a> Microbes and Infection. 17 (3), 173-183 (2015).</li><li>Schwarz, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Burkholderia+Type+VI+secretion+systems+have+distinct+roles+in+eukaryotic+and+bacterial+cell+interactions.">Burkholderia Type VI secretion systems have distinct roles in eukaryotic and bacterial cell interactions.</a> PLoS Pathogens. 6 (8), 1001068 (2010).</li><li>Jones, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Kill+and+cure:+genomic+phylogeny+and+bioactivity+of+Burkholderia+gladioli+bacteria+capable+of+pathogenic+and+beneficial+lifestyles.">Kill and cure: genomic phylogeny and bioactivity of Burkholderia gladioli bacteria capable of pathogenic and beneficial lifestyles.</a> Microbial Genomics. 7 (1), 000515 (2021).</li><li>Takeshita, K., Kikuchi, Y. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Riptortuspedestris+and+Burkholderia+symbiont:+an+ideal+model+system+for+insect-microbe+symbiotic+associations.">Riptortuspedestris and Burkholderia symbiont: an ideal model system for insect-microbe symbiotic associations.</a> Research in Microbiology. 168 (3), 175-187 (2017).</li><li>Powell, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+screen+identifies+host+colonization+determinants+in+a+bacterial+gut+symbiont.">Genome-wide screen identifies host colonization determinants in a bacterial gut symbiont.</a> Proceedings of the National Academy of Sciences of the United States of America. 113 (48), 13887-13892 (2016).</li><li>Brooks, J. F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+discovery+of+colonization+determinants+in+the+squid+symbiont+Vibrio+fischeri.">Global discovery of colonization determinants in the squid symbiont Vibrio fischeri.</a> Proceedings of the National Academy of Sciences of the United States of America. 111 (48), 17284-17289 (2014).</li><li>Somprasong, N., McMillan, I., Karkhoff-Schweizer, R. R., Mongkolsuk, S., Schweizer, H. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Methods+for+genetic+manipulation+of+Burkholderia+gladioli+pathovar+cocovenenans.">Methods for genetic manipulation of Burkholderia gladioli pathovar cocovenenans.</a> BMC Research Notes. 3 (308), (2010).</li><li>Garcia, E. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Burkholderia+thailandensis:+Genetic+manipulation.">Burkholderia thailandensis: Genetic manipulation.</a> Current Protocols in Microbiology. 45, 1-15 (2017).</li><li>Headd, B., Bradford, S. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+conjugation+window+in+an+Escherichia+coli+K-12+strain+with+an+IncFII+plasmid.">The conjugation window in an Escherichia coli K-12 strain with an IncFII plasmid.</a> Applied and Environmental Microbiology. 86 (17), 00948 (2020).</li><li>Van Opijnen, T., Camilli, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transposon+insertion+sequencing:+A+new+tool+for+systems-level+analysis+of+microorganisms.">Transposon insertion sequencing: A new tool for systems-level analysis of microorganisms.</a> Nature Reviews Microbiology. 11 (7), 435-442 (2013).</li><li>Gallagher, L. A., Ramage, E., Patrapuvich, R., Weiss, E., Brittnacher, M., Manoil, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Sequence-defined+transposon+mutant+library+of+Burkholderia+thailandensis.">Sequence-defined transposon mutant library of Burkholderia thailandensis.</a> mBio. 4 (6), 00604-00613 (2013).</li><li>Wong, Y. -. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Candidate+essential+genes+in+Burkholderia+cenocepacia+J2315+identified+by+genome-wide+TraDIS.">Candidate essential genes in Burkholderia cenocepacia J2315 identified by genome-wide TraDIS.</a> Frontiers in Microbiology. 7, 1288 (2016).</li><li>Moule, M. G., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+saturation+mutagenesis+of+Burkholderia+pseudomallei+K96243+predicts+essential+genes+and+novel+targets+for+antimicrobial+development.">Genome-wide saturation mutagenesis of Burkholderia pseudomallei K96243 predicts essential genes and novel targets for antimicrobial development.</a> mBio. 5 (1), 00926 (2014).</li><li>Ding, Q., Tan, K. S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Himar1+transposon+for+efficient+random+mutagenesis+in+Aggregatibacter+actinomycetemcomitans.">Himar1 transposon for efficient random mutagenesis in Aggregatibacter actinomycetemcomitans.</a> Frontiers in Microbiology. 8, 1842 (2017).</li><li>Green, B., Bouchier, C., Fairhead, C., Craig, N. L., Cormack, B. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insertion+site+preference+of+Mu,+Tn5,+and+Tn7+transposons.">Insertion site preference of Mu, Tn5, and Tn7 transposons.</a> Mobile DNA. 3, 3 (2012).</li><li>Lodge, J. K., Weston-Hafer, K., Berg, D. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transposon+Tn5+target+specificity:+Preference+for+insertion+at+G/C+pairs.">Transposon Tn5 target specificity: Preference for insertion at G/C pairs.</a> Genetics. 120 (3), 645-650 (1988).</li><li>Ar&#225; Ujo, W. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+sequencing+and+transposon+mutagenesis+of+Burkholderia+seminalis+TC3.4.2R3+identify+genes+contributing+to+suppression+of+orchid+necrosis+caused+by+B.+gladioli.">Genome sequencing and transposon mutagenesis of Burkholderia seminalis TC3.4.2R3 identify genes contributing to suppression of orchid necrosis caused by B. gladioli.</a> Molecular Plant-microbe Interactions: MPMI. 29 (6), 435-446 (2016).</li><li>Dobritsa, A. P., Samadpour, M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reclassification+of+Burkholderiainsecticola+as+Caballeroniainsecticola+comb.+nov.+and+reliability+of+conserved+signature+indels+as+molecular+synapomorphies.">Reclassification of Burkholderiainsecticola as Caballeroniainsecticola comb. nov. and reliability of conserved signature indels as molecular synapomorphies.</a> International Journal of Systematic and Evolutionary Microbiology. 69 (7), 2057-2063 (2019).</li><li>Ohbayashi, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Insect's+intestinal+organ+for+symbiont+sorting.">Insect's intestinal organ for symbiont sorting.</a> Proceedings of the National Academy of Sciences of the United States of America. 112 (37), 5179-5188 (2015).</li><li>Ross, C., Scherlach, K., Kloss, F., Hertweck, C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+molecular+basis+of+conjugated+polyyne+biosynthesis+in+phytopathogenic+bacteria.">The molecular basis of conjugated polyyne biosynthesis in phytopathogenic bacteria.</a> Angewandte Chemie International Edition. 53 (30), 7794-7798 (2014).</li><li>Atkins, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+mutant+of+Burkholderia+pseudomallei,+auxotrophic+in+the+branched+chain+amino+acid+biosynthetic+pathway,+is+attenuated+and+protective+in+a+murine+model+of+melioidosis.">A mutant of Burkholderia pseudomallei, auxotrophic in the branched chain amino acid biosynthetic pathway, is attenuated and protective in a murine model of melioidosis.</a> Infection and Immunity. 70 (9), 5290-5294 (2002).</li></ol>

The authors declare that they have no conflict of interest pertaining to the study.

A B. gladioli transposon mutant library was generated to identify important host colonization factors in the symbiotic interaction between L. villosa beetles and B. gladioli bacteria. The major steps in the protocol were conjugation, host-infection, DNA library preparation, and sequencing.
As many strains of Burkholderia are amenable to genetic modification by conjugation24,25, the plasmid carrying the transposon and antibiotic insertion cassette was conjugated successfully into the target B. gladioli Lv-StA strain from E. coli. Previous attempts of transformation by electroporation yielded very low to almost no B. gladioli transformants. It is advisable to optimize the transformation technique for the target organism to efficiently yield a large number of transformants.
One round of conjugation and 40 conjugation spots disrupted 3,736 genes in B. gladioli Lv-StA. In hindsight, multiple rounds of conjugation would be necessary to disrupt most of the 7,468 genes and obtain a saturated library. Notably, the incubation time during conjugation was not allowed to exceed 12-18 h, which is the end of the exponential growth phase of B. gladioli. Allowing conjugation beyond the exponential growth phase of bacterial cells reduces the chances of success of obtaining transconjugants26. Therefore, the conjugation period should be adjusted according to the growth of the bacterial species.
To successfully carry out an experiment involving the infection of mutant libraries in a host, it is important to assess the bacterial population bottleneck size during colonization and the diversity of mutants in the library before infection1,2,27. In preparation for the experiment, we estimated the minimum number of beetles that must be infected to have a high chance that each mutant in the library is sampled and allowed to colonize. The approximate in vivo bacterial generation time&#160;and the number of generations for the duration of the experiment were also calculated. The in vitro culture was then grown up to a comparable number of generations by adjusting the incubation time. For a similar infection experiment in other non-model hosts, the ability to maintain a laboratory culture and a constant source of the host organisms is desirable.
Following the growth of the mutant library in vivo and in vitro and sample collection, a modified DNA library preparation protocol for transposon insertion sequencing was carried out. The modification in the protocol involved designing custom PCR primers and adding PCR steps to select for DNA fragments containing the insertion cassette. Because the protocol was customized, additional PCR cycles in the protocol increased the risk of overamplification and obtaining hybridized adapter-adapter fragments in the end libraries. Hence, a final cleanup step (without size selection) after the two PCRs is recommended, as it helps in removing these fragments. The size distribution of the DNA libraries was still broader than expected. However, increasing the sequencing depth provided sufficient data that were filtered during bioinformatics analysis, obtaining satisfactory results.
As transposon-mediated mutagenesis generates thousands of random insertions in a single experiment, it is possible to generate a saturated library of mutants that contains all except those mutants where genes essential for bacterial growth have been disrupted. We most likely did not work with a saturated mutant library, given the estimations of essential genes in other studies on Burkholderia sp.28,29. A non-saturated library nevertheless helps in exploring various candidate genes for further studies using targeted mutagenesis. Before the experiments, it is also important to remember that some transposons have specific insertion target sites that increase the abundance of mutants at certain loci in the genome30. Mariner transposons are known to target AT sites for insertion31, and Tn5 transposons have a GC bias32,33. Including steps during bioinformatics analysis to recognize hotspots for transposon insertions will help in assessing any distribution bias.
Although prone to setbacks, a well-designed transposon insertion sequencing experiment can be a powerful tool to identify many conditionally important genes in bacteria within a single experiment. For example, a dozen genes in Burkholderia seminalis important for the suppression of orchid leaf necrosis were identified by combining transposon mutagenesis and genomics34. Beyond Burkholderia, several adhesion and motility genes and transporters have been identified as important colonization factors in Snodgrassella alvi symbionts of Apis mellifera (Honeybee)22, and in the Vibrio fischerii symbionts of Euprymna scolopes (Hawaiian bobtail squid)23 using the transposon-insertion mutagenesis approach.
As an alternative approach, transposon mutagenesis may be followed by screening for individual mutants using selective media instead of sequencing. Phenotypic screening or bioassays to identify deficiencies, such as motility, production of bioactive secondary metabolites, or specific auxotrophies, are feasible. For example, screening of a Burkholderia insecticola (reassigned to genus Caballeronia35) transposon mutant library has been key in identifying that the symbionts employ motility genes for colonizing Riptortus pedestris, their insect host36. Furthermore, using transposon mutagenesis and phenotypic screening, the biosynthetic gene cluster for the bioactive secondary metabolite caryoynencin was identified in Burkholderia caryophylli37. An auxotrophic mutant of Burkholderia pseudomallei was identified following transposon mutagenesis and screening and is a possible attenuated vaccine candidate against melioidosis, a dangerous disease in humans and animals38. Thus, transposon mutagenesis and sequencing is a valuable approach in studying the molecular traits of bacteria that are important for the interactions with their respective hosts in pathogenic or mutualistic associations.

Burkholderia gladioli can engage in a symbiotic association with Lagria villosa beetles, playing an important role in defense against microbial antagonists of the insect host4,5,6. Female beetles house several strains of B. gladioli in specialized glands accessory to the reproductive system. Upon egg-laying, females smear B. gladioli cells on the egg surface where antimicrobial compounds produced by B. gladioli inhibit infections by entomopathogenic fungi4,6. During late embryonic development or early after the larvae hatch, the bacteria colonize cuticular invaginations on the dorsal surface of the larvae. Despite this specialized localization and vertical transmission route of the symbionts, L. villosa can presumably also acquire B. gladioli horizontally from the environment4. Furthermore, at least three strains of B. gladioli have been found in association with L. villosa4,6. Among these, B. gladioli Lv-StA is the only one that is amenable to cultivation in vitro.
B. gladioli Lv-StA has a genome size of 8.56 Mb6 and contains 7,468 genes. Which of these genes are important for B. gladioli bacteria to colonize the beetle host? To answer this question, we used transposon-insertion sequencing (Tn-seq), an explorative method to identify conditionally essential microbial genes1,2,3. A mutant library of B. gladioli Lv-StA was created using a Tn5 transposon. Through conjugation from Escherichia coli donor cells to B. gladioli Lv-StA, a pRL27 plasmid carrying the Tn5 transposon and an antibiotic resistance cassette flanked by inverted repeats was transferred (Figure 1). Thereby, a set of mutants that individually carry disruptions of 3,736 symbiont genes was generated (Figure 2).
The mutant pool was infected onto beetle eggs to identify the colonization factors and, as a control, was also grown in vitro in King&#39;s B (KB) medium. After allowing sufficient time for colonization, hatched larvae were collected and pooled for DNA extraction. Fragments of DNA containing the transposon insert and the flanking genomic region of B. gladioli Lv-StA were selected using a modified DNA library preparation protocol for sequencing. Read quality processing followed by analysis with DESeq2 was carried out to identify specific genes crucial for B. gladioli Lv-StA to colonize L. villosa larvae when transmitted via the egg surface.

<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>2,6- Diaminopimelic Acid</td>
			<td>Alfa Aesar</td>
			<td>B22391</td>
			<td>For E.coli WM3064+ pRL27</td>
		</tr>
		<tr>
			<td>Agar - Agar</td>
			<td>Roth</td>
			<td>5210</td>
			<td></td>
		</tr>
		<tr>
			<td>Agarose</td>
			<td>Biozym</td>
			<td>840004</td>
			<td></td>
		</tr>
		<tr>
			<td>AMPure beads XP (magentic beads + polyethylene glycol + salts)</td>
			<td>Beckman Coulter</td>
			<td>A63880</td>
			<td>Size selection in step 6.6</td>
		</tr>
		<tr>
			<td>Bleach (NaOCl) 12%</td>
			<td>Roth</td>
			<td>9062</td>
			<td></td>
		</tr>
		<tr>
			<td>Bowtie2 v.2.4.2</td>
			<td></td>
			<td></td>
			<td>Bioinfromatic tool for read mapping. Reference 10 in main manuscript.</td>
		</tr>
		<tr>
			<td>Buffer-S</td>
			<td>Peqlab</td>
			<td>PEQL01-1020</td>
			<td>For PCRs</td>
		</tr>
		<tr>
			<td>Cell scraper</td>
			<td>Sarstedt</td>
			<td>83.1830</td>
			<td></td>
		</tr>
		<tr>
			<td>Cutadapt v.2.10</td>
			<td></td>
			<td></td>
			<td>Bioinformatic tool for removing specific adapter sequences from the reads. Reference 8 in main manuscript.</td>
		</tr>
		<tr>
			<td>DESeq2</td>
			<td></td>
			<td></td>
			<td>RStudio package for assessing differential mutant abundance. Usually used for RNAseq analysis. Reference 12 in main manuscript.</td>
		</tr>
		<tr>
			<td>DNA ladder 100 bp</td>
			<td>Roth</td>
			<td>T834.1</td>
			<td></td>
		</tr>
		<tr>
			<td>dNTPs</td>
			<td>Life Technology</td>
			<td>R0182</td>
			<td>PCR for confirming success of conjugation</td>
		</tr>
		<tr>
			<td>EDTA, Di-Sodium salt</td>
			<td>Roth</td>
			<td>8043</td>
			<td></td>
		</tr>
		<tr>
			<td>Epicentre MasterPure Complete DNA and RNA Purification Kit</td>
			<td>Lucigen</td>
			<td>MC85200</td>
			<td></td>
		</tr>
		<tr>
			<td>Ethidium bromide</td>
			<td>Roth</td>
			<td>2218.1</td>
			<td></td>
		</tr>
		<tr>
			<td>FastQC v.0.11.8</td>
			<td></td>
			<td></td>
			<td>Bioinformatic tool for assessing the quality of sequencing data. Reference 7 in main manuscript.</td>
		</tr>
		<tr>
			<td>FeatureCounts v.2.0.1</td>
			<td></td>
			<td></td>
			<td>Bioinformatic tool to obtain read counts per genomic feature. Reference 11 in main manuscript.</td>
		</tr>
		<tr>
			<td>Glycerol</td>
			<td>Roth</td>
			<td>7530</td>
			<td></td>
		</tr>
		<tr>
			<td>K2HPO4</td>
			<td>Roth</td>
			<td>P749</td>
			<td></td>
		</tr>
		<tr>
			<td>Kanamycin sulfate</td>
			<td>Serva</td>
			<td>26899</td>
			<td></td>
		</tr>
		<tr>
			<td>KCl</td>
			<td>Merck</td>
			<td>4936</td>
			<td></td>
		</tr>
		<tr>
			<td>KH2PO4</td>
			<td>Roth</td>
			<td>3904</td>
			<td></td>
		</tr>
		<tr>
			<td>MgSO4.7H2O</td>
			<td>Roth</td>
			<td>PO27</td>
			<td></td>
		</tr>
		<tr>
			<td>Na2HPO4</td>
			<td>Roth</td>
			<td>P030</td>
			<td></td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>Merck</td>
			<td>6404</td>
			<td></td>
		</tr>
		<tr>
			<td>NEBNext Multiplex Oligos for Illumina (Index primers set 1)</td>
			<td>New England Biolabs</td>
			<td>E7335S</td>
			<td></td>
		</tr>
		<tr>
			<td>NEBNext Ultra II DNA library prep kit for Illumina</td>
			<td>New England Biolabs</td>
			<td>E7645S</td>
			<td></td>
		</tr>
		<tr>
			<td>Peptone (soybean)</td>
			<td>Roth</td>
			<td>2365</td>
			<td>For Burkholderia gladioli Lv-StA KB-medium</td>
		</tr>
		<tr>
			<td>peqGOLD &#39;Hot&#39; Taq- DNA Polymerase</td>
			<td>VWR</td>
			<td>PEQL01-1020</td>
			<td>PCR for confirming success of conjugation</td>
		</tr>
		<tr>
			<td>Petri plates - 145 x 20 mm</td>
			<td>Roth</td>
			<td>XH90.1</td>
			<td>For selecting transconjugants</td>
		</tr>
		<tr>
			<td>Petri plates - 90 x 16 mm</td>
			<td>Roth</td>
			<td>N221.2</td>
			<td></td>
		</tr>
		<tr>
			<td>Qiaxcel (StarSEQ GmbH, Germany)</td>
			<td></td>
			<td></td>
			<td>Quality check after DNA library preparation</td>
		</tr>
		<tr>
			<td>Streptavidin beads</td>
			<td>Roth</td>
			<td>HP57.1</td>
			<td></td>
		</tr>
		<tr>
			<td>Taq DNA polymerase</td>
			<td>VWR</td>
			<td>01-1020</td>
			<td></td>
		</tr>
		<tr>
			<td>Trimmomatic v.0.36</td>
			<td></td>
			<td></td>
			<td>Bioinformatic tool for trimming low quality reads and also adapter sequences. Reference 9 in main manuscript.</td>
		</tr>
		<tr>
			<td>Tris -HCl</td>
			<td>Roth</td>
			<td>9090.1</td>
			<td></td>
		</tr>
		<tr>
			<td>Tryptone</td>
			<td>Roth</td>
			<td>2366</td>
			<td>For Escherichia coli WM3064+pRL27 LB medium</td>
		</tr>
		<tr>
			<td>Ultrasonicator</td>
			<td>Bandelin</td>
			<td>GM 70 HD</td>
			<td>For shearing</td>
		</tr>
		<tr>
			<td>USER enzyme (uracil DNA glycosylase + DNA glycosylase- lyase Endonuclease VIII)</td>
			<td>New England Biolabs</td>
			<td>E7645S</td>
			<td>Ligation step 6.5.2</td>
		</tr>
		<tr>
			<td>Yeast extract</td>
			<td>Roth</td>
			<td>2363</td>
			<td></td>
		</tr>
	</tbody>
</table>

transposon-insertion sequencing as a tool to elucidate bacterial colonization factors in a burkholderia gladioli symbiont of lagria villosa beetles

Inferring the function of genes by manipulating their activity is an essential tool for understanding the genetic underpinnings of most biological processes. Advances in molecular microbiology have seen the emergence of diverse mutagenesis techniques for the manipulation of genes. Among them, transposon-insertion sequencing (Tn-seq) is a valuable tool to simultaneously assess the functionality of many candidate genes in an untargeted way. The technique has been key to identify&#160;molecular mechanisms for the colonization of eukaryotic hosts in several pathogenic microbes and a few beneficial symbionts.
Here, Tn-seq is established as a method to identify colonization factors in a mutualistic Burkholderia gladioli symbiont of the beetle Lagria villosa. By conjugation, Tn5 transposon-mediated insertion of an antibiotic-resistance cassette is&#160;carried out at random genomic locations in B. gladioli. To identify the effect of gene disruptions on the ability of the bacteria to colonize the beetle host, the generated B. gladioli transposon-mutant library is inoculated on the beetle eggs, while a control is grown in vitro in a liquid culture medium. After allowing sufficient time for colonization, DNA is extracted from the in vivo and in vitro grown libraries. Following a DNA library preparation protocol, the DNA samples are prepared for transposon-insertion sequencing. DNA fragments that contain the transposon-insert edge and flanking bacterial DNA are selected, and the mutation sites are determined by sequencing away from the transposon-insert edge. Finally, by analyzing and comparing the frequencies of each mutant between the in vivo and in vitro libraries, the importance of specific symbiont genes during beetle colonization can be predicted.

Host-associated bacteria can employ several factors to establish an association, including those mediating adhesion, motility, chemotaxis, stress responses, or specific transporters. While factors important for pathogen-host interactions have been reported for several bacteria13,14,15,16,17,18, including members of the genus Burkholderia19,20, fewer studies have explored the molecular mechanisms used by beneficial symbionts for colonization21,22,23. Using transposon insertion sequencing, the aim was to identify molecular factors that enable B. gladioli to&#160;colonize L. villosa beetles.
Transposon-mediated mutagenesis was performed using the pRL27 plasmid, which carries a Tn5 transposon and a kanamycin resistance cassette flanked by invert repeat sites. The plasmid was introduced into the target B. gladioli Lv-StA cells by conjugation with the plasmid donor E. coli WM3064 strain (as shown in Figure 1). After conjugation, the conjugation mix containing B. gladioli recipient and E. coli donor cells were plated on selective agar plates containing kanamycin. The absence of DAP on the plates eliminated the donor E. coli cells, and the presence of kanamycin selected for successful B. gladioli Lv-StA transconjugants. The pooled B. gladioli Lv-StA mutant library obtained from harvesting the 100,000 transconjugant colonies&#160;was prepared for sequencing using a modified DNA library preparation kit and custom primers. Figure 2 highlights the DNA library preparation steps. Sequencing yielded 4 Mio paired reads; 3,736 genes out of 7,468 genes in B. gladioli Lv-StA were disrupted.
To identify mutants that were colonization-defective in the host, the B. gladioli Lv-StA mutant library was infected on the beetle eggs and grown in vitro in KB medium as a control. The in vivo colonization bottleneck size was calculated before the experiment. A known number of B. gladioli Lv-StA cells was infected on beetle eggs, and the number of colonizing cells in freshly hatched first instar larvae was obtained by plating a suspension from each larva and counting colony-forming units per individual. These calculations were done to ensure that the number of colonizing cells is enough to assess all or a high percentage of the mutants in the library for their ability to colonize the host. Additionally, the growth time between in vitro and in vivo conditions was normalized based on the number of bacterial generations to make these samples comparable.
After the eggs hatched, 1,296 larvae were collected in 13 pools. The corresponding in vitro mutant cultures were grown and stored as glycerol stocks. DNA of the in vivo and in vitro grown mutant libraries was extracted and fragmented in an ultrasonicator. Figure 3 shows the size distribution of the sheared DNA, where the majority of the fragments span between 100 and 400 bp, as expected. This step was followed by the modified DNA library preparation protocol for sequencing. At each step of the protocol, the concentration of remaining DNA was checked to ensure that the steps were performed correctly and to track losses of DNA. A quality check (see the Table of Materials) before sequencing revealed that the DNA libraries contained unexpectedly large (&#62;800 bp) DNA fragments, and this was more pronounced in the in vivo libraries. Given the difficulty in optimizing the clustering of fragments in the sequencing lanes, it was necessary to increase the sequencing depth to 10 Mio paired reads in the in vivo libraries to attain the desired number of reads. The analysis of the sequencing results revealed that an average of 4 Mio reads in the in vivo libraries and 3.1 Mio reads in the in vitro libraries contained the Transposon edge in the 5&#39; end of Read-1 (Table 9), which was satisfactory for this experiment. The distribution of the 24,224 unique insertions across the B. gladioli genome in the original library is shown in Figure 4. An analysis carried out using DESeq2 revealed that the abundances of 271 mutants were significantly different between the in vivo and in vitro conditions.
<img alt="Figure 3" class="xfigimg" src="/files/ftp_upload/62843/62843fig03.jpg" /> 
Figure 3: Agarose gels of a mutant and DNA libraries. (A) Agarose gel with unsheared DNA of a mutant in lane x and a 1 kbp ladder for scale. (B) Gel with sheared DNA library. The band sizes of the ladder in the first lane are indicated on the left side. The first three lanes a, b, and c contain sheared DNA fragments of the in vivo libraries. Lanes d, e, f, and g contain sheared DNA fragments of the in vitro libraries. <a href="https://www.jove.com/files/ftp_upload/62843/62843fig03large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<img alt="Figure 4" class="xfigimg" src="/files/ftp_upload/62843/62843fig04.jpg" /> 
Figure 4:&#160;Location of unique insertion sites in the original library across the four replicons in the Burkholderia gladioli Lv-StA genome. Each bar along the x-axis is located at a site of insertion. The height of a bar along the y-axis corresponds to the number of reads associated with that site. Note that the two chromosomes and two plasmids are shown in full length and thus have different scales on the x-axis. <a href="https://www.jove.com/files/ftp_upload/62843/62843fig04large.jpg" target="_blank">Please click here to view a larger version of this figure.</a>
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="2">King&#8217;s B medium/ agar</td>
		</tr>
		<tr>
			<td>Peptone (soybean)</td>
			<td>20 g/L</td>
		</tr>
		<tr>
			<td>K2HPO4</td>
			<td>1.5 g/L</td>
		</tr>
		<tr>
			<td>MgSO4.7H2O</td>
			<td>1.5 g/L</td>
		</tr>
		<tr>
			<td>Agar</td>
			<td>15 g/L</td>
		</tr>
		<tr>
			<td colspan="2">Dissolved in distilled water</td>
		</tr>
		<tr>
			<td colspan="2">LB medium/agar</td>
		</tr>
		<tr>
			<td>Tryptone</td>
			<td>10 g/L</td>
		</tr>
		<tr>
			<td>Yeast extract</td>
			<td>5 g/L</td>
		</tr>
		<tr>
			<td>NaCl</td>
			<td>10 g/L</td>
		</tr>
		<tr>
			<td colspan="2">Dissolved in distilled water</td>
		</tr>
	</tbody>
</table>
Table 1: Media components.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>No.</td>
			<td>Primers</td>
			<td colspan="2">Sequence</td>
			<td>PCR annealing temp. (&#176;C)</td>
		</tr>
		<tr>
			<td>1</td>
			<td>tpnRL17&#8211;1RC</td>
			<td colspan="2">5&#8217;-CGTTACATCCCTGGCTTGTT-3&#8217;</td>
			<td rowspan="2">58.2</td>
		</tr>
		<tr>
			<td>2</td>
			<td>tpnRL13&#8211;2RC</td>
			<td colspan="2">5&#8217;-TCGTGAAGAAGGTGTTGCTG-3&#8217;</td>
		</tr>
	</tbody>
</table>
Table 2: Primers to confirm the success of conjugation.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Component</td>
			<td>Volume (&#956;L)</td>
		</tr>
		<tr>
			<td>HPLC-purified water</td>
			<td>4.92</td>
		</tr>
		<tr>
			<td>10x Buffer S (high specificity)</td>
			<td>1</td>
		</tr>
		<tr>
			<td>MgCl2 (25 mM)</td>
			<td>0.2</td>
		</tr>
		<tr>
			<td>dNTPs (2 mM)</td>
			<td>1.2</td>
		</tr>
		<tr>
			<td>Primer 1 (10 pmol/&#181;L)</td>
			<td>0.8</td>
		</tr>
		<tr>
			<td>Primer 2 (10 pmol/&#181;L)</td>
			<td>0.8</td>
		</tr>
		<tr>
			<td>Taq (5 U/&#181;L)</td>
			<td>0.08</td>
		</tr>
		<tr>
			<td>Mastermix total</td>
			<td>9</td>
		</tr>
		<tr>
			<td>Template</td>
			<td>1</td>
		</tr>
	</tbody>
</table>
Table 3: PCR master mix to confirm the success of conjugation. Abbreviations: HPLC = high-performance liquid chromatography; dNTPs = deoxynucleoside triphosphate.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Steps</td>
			<td>Temperature &#176;C</td>
			<td>Time</td>
			<td>Cycles</td>
		</tr>
		<tr>
			<td>Initial Denaturation</td>
			<td>95</td>
			<td>3 min</td>
			<td>1</td>
		</tr>
		<tr>
			<td>Denaturation</td>
			<td>95</td>
			<td>40 s</td>
			<td></td>
		</tr>
		<tr>
			<td>Annealing</td>
			<td>58.2</td>
			<td>40 s</td>
			<td>30 to 35</td>
		</tr>
		<tr>
			<td>Extension</td>
			<td>72</td>
			<td>1-2 min</td>
			<td></td>
		</tr>
		<tr>
			<td>Final Extension</td>
			<td>72</td>
			<td>4 min</td>
			<td>1</td>
		</tr>
		<tr>
			<td>Hold</td>
			<td>4</td>
			<td colspan="2">&#8734;</td>
		</tr>
	</tbody>
</table>
Table 4: PCR conditions to confirm the success of conjugation.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Primers</td>
			<td colspan="2">Sequence</td>
			<td>Tm &#176;C</td>
			<td>Use</td>
			<td>Source</td>
		</tr>
		<tr>
			<td>Transposon-specific biotinylated primer</td>
			<td colspan="2">5&#8217;-Biotin-ACAGGAACACTTAACGGCTGACATG 
			-3&#8217;</td>
			<td>63.5</td>
			<td>6.7.1. PCR I</td>
			<td>Custom</td>
		</tr>
		<tr>
			<td>Modified Universal PCR primer</td>
			<td colspan="2">5&#8217;- AATGATACGGCGACCACCGAGATC 
			TACACTCTTTCCCTACACGACGCTC 
			TTCCGATCTGAATTCATCGATGAT 
			GGTTGAGATGTGT &#8211; 3&#8217;</td>
			<td>62</td>
			<td>6.10.1. PCR II</td>
			<td>Custom</td>
		</tr>
		<tr>
			<td>Index primer</td>
			<td colspan="3">Refer to the manufacturer&#8217;s manual</td>
			<td>6.7.1. PCR I &#38; 6.10.1. PCR II</td>
			<td>NEBNext Multiplex Oligos for Illumina (Index primers set 1)</td>
		</tr>
		<tr>
			<td>Adapter</td>
			<td colspan="3">Refer to the manufacturer&#8217;s manual</td>
			<td>6.5. Adapter ligation</td>
			<td>NEBNext Ultra II DNA library prep kit for Illumina</td>
		</tr>
	</tbody>
</table>
Table 5: Primers and adapter for PCR I and II during DNA library preparation. 
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>PCR mix</td>
			<td>(&#181;L)</td>
		</tr>
		<tr>
			<td>Adapter-ligated DNA fragments</td>
			<td>15</td>
		</tr>
		<tr>
			<td>NEBNext Ultra II Q5 master mix</td>
			<td>25</td>
		</tr>
		<tr>
			<td>Index primer (10 pmol/ &#181;L)</td>
			<td>5</td>
		</tr>
		<tr>
			<td>Transposon specific biotinylated primer (10 pmol/ &#181;L)</td>
			<td>5</td>
		</tr>
		<tr>
			<td>Total volume</td>
			<td>50</td>
		</tr>
	</tbody>
</table>
Table 6: DNA library preparation-PCR I master mix.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>Steps</td>
			<td>Temperature</td>
			<td>Time</td>
			<td>Cycles</td>
		</tr>
		<tr>
			<td>Initial Denaturation</td>
			<td>98 &#176;C</td>
			<td>30 s</td>
			<td>1</td>
		</tr>
		<tr>
			<td>Denaturation</td>
			<td>98 &#176;C</td>
			<td>10 s</td>
			<td rowspan="3">6 to 12</td>
		</tr>
		<tr>
			<td>Annealing</td>
			<td>65 &#176;C</td>
			<td>30 s</td>
		</tr>
		<tr>
			<td>Extension</td>
			<td>72 &#176;C</td>
			<td>30 s</td>
		</tr>
		<tr>
			<td>Final Extension</td>
			<td>72 &#176;C</td>
			<td>2 min</td>
			<td>1</td>
		</tr>
		<tr>
			<td>Hold</td>
			<td>16 &#176;C</td>
			<td colspan="2">&#8734;</td>
		</tr>
	</tbody>
</table>
Table 7: DNA library preparation-PCR I and II conditions.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td>PCR mix</td>
			<td>(&#181;L)</td>
		</tr>
		<tr>
			<td>Bead-selected DNA</td>
			<td>15</td>
		</tr>
		<tr>
			<td>NEBNext Ultra II Q5 master mix</td>
			<td>25</td>
		</tr>
		<tr>
			<td>Index primer</td>
			<td>5</td>
		</tr>
		<tr>
			<td>Modified universal PCR primer</td>
			<td>5</td>
		</tr>
		<tr>
			<td>Total volume</td>
			<td>50</td>
		</tr>
	</tbody>
</table>
Table 8: DNA library preparation-PCR II master mix.
<table border="1" fo:keep-together.within-page="1" fo:keep-with-next.within-page="always">
	<tbody>
		<tr>
			<td colspan="2">Libraries</td>
			<td>Invivo-1</td>
			<td>Invivo-2</td>
			<td>Invivo-3</td>
			<td>Invitro-1</td>
			<td>Invitro-2</td>
			<td>Invitro-3</td>
			<td>Original library</td>
		</tr>
		<tr>
			<td colspan="2">No. of reads (PE)</td>
			<td>56,57,710</td>
			<td>39,19,051</td>
			<td>30,65,849</td>
			<td>35,73,494</td>
			<td>28,83,440</td>
			<td>36,61,956</td>
			<td>46,09,410</td>
		</tr>
		<tr>
			<td colspan="2">No. of reads containing Tn &#8211; edge on 5&#8217; end of Read-1</td>
			<td>54,15,880</td>
			<td>37,31,169</td>
			<td>29,36,247</td>
			<td>33,00,499</td>
			<td>27,35,705</td>
			<td>33,50,402</td>
			<td>41,53,270</td>
		</tr>
		<tr>
			<td colspan="2">Bowtie2 overall alignment rate (%) (Read-1 only)</td>
			<td>95.53%</td>
			<td>83.71%</td>
			<td>89.87%</td>
			<td>80.79%</td>
			<td>78.00%</td>
			<td>73.06%</td>
			<td>74.92%</td>
		</tr>
		<tr>
			<td colspan="2">Number of unique insertions</td>
			<td>8,539</td>
			<td>4,134</td>
			<td>7,183</td>
			<td>18,930</td>
			<td>18,421</td>
			<td>20,438</td>
			<td>24,224</td>
		</tr>
		<tr>
			<td colspan="2">Number of genes hit</td>
			<td>1575</td>
			<td>993</td>
			<td>1450</td>
			<td>2793</td>
			<td>2597</td>
			<td>3037</td>
			<td>3736</td>
		</tr>
	</tbody>
</table>
Table 9: Summary of sequencing output and transposon insertion frequency per library. Abbreviation: PE = paired-end.

Watch this Scientific Journal Video about Transposon-insertion Sequencing as a Tool to Elucidate Bacterial Colonization Factors in a Burkholderia gladioli Symbiont of Lagria villosa Beetles at JoVE.co

Transposon-insertion Sequencing as a Tool to Elucidate Bacterial Colonization Factors in a Burkholderia gladioli Symbiont of Lagria villosa Beetles

This is an adapted method for identifying candidate insect colonization factors in a Burkholderia beneficial symbiont. The beetle host is infected with a random mutant library generated via transposon mutagenesis, and library complexity after colonization is compared to a control grown in vitro.

Transposon-insertion Sequencing as a Tool to Elucidate Bacterial Colonization Factors in a Burkholderia gladioli Symbiont of Lagria villosa Beetles

Inferring the function of genes by manipulating their activity is an essential tool for understanding the genetic underpinnings of most biological ...

transposon-insertion-sequencing-as-tool-to-elucidate-bacterial

Research

JoVE Journal

Biology

3.6K Views.  Johannes Gutenberg University. This is an adapted method for identifying candidate insect colonization factors in a Burkholderia beneficial symbiont. The beetle host is infected with a random mutant library generated via transposon mutagenesis, and library complexity after colonization is compared to a control grown in vitro. 

Video: Transposon-insertion Sequencing as a Tool to Elucidate Bacterial Colonization Factors in a Burkholderia gladioli Symbiont of Lagria villosa Beetles

Use of Rotorod as a Method for the Qualitative Analysis of Walking in Rat

High speed videoanalysis of the details of movement can provide a source of information about qualitative aspects of walking movements. When walking on a rotorod, animals remain in approximately the same place making repetitive movements of stepping. Thus the task provides a rich source of information on the details of foot stepping movements. Subjects were hemi-Parkinson analogue rats, produced by injection of 6-hydroxydopamine (6-OHDA) into the right nigrostriatal bundle to deplete nigrostriatal dopamine (DA). The present report provides a video analysis illustration of animals previously were filmed from frontal, lateral, and posterior views as they walked (15). Rating scales and frame-by-frame replay of the video records of stepping behavior indicated that the hemi-Parkinson rats were chronically impaired in posture and limb use contralateral to the DA-depletion. The contralateral limbs participated less in initiating and sustaining propulsion than the ipsilateral limbs. These deficits secondary to unilateral DA-depletion show that the rotorod provides a use task for the analysis of stepping movements.

The rotorod test is used to assess motor status in the walking movement of hemi-Parkinson analogue rats.

High speed videoanalysis of the details of movement can provide a source of information about qualitative aspects of walking movements. When walking on a ...

A Microfluidic Device for Quantifying Bacterial Chemotaxis in Stable Concentration Gradients

Chemotaxis allows bacteria to approach sources of attractant chemicals or to avoid sources of repellent chemicals. Bacteria constantly monitor the concentration of specific chemoeffectors by comparing the current concentration to the concentration detected a few seconds earlier. This comparison determines the net direction of movement. Although multiple, competing gradients often coexist in nature, conventional approaches for investigating bacterial chemotaxis are suboptimal for quantifying migration in response to concentration gradients of attractants and repellents. Here, we describe the development of a microfluidic chemotaxis model for presenting precise and stable concentration gradients of chemoeffectors to bacteria and quantitatively investigating their response to the applied gradient. The device is versatile in that concentration gradients of any desired absolute concentration and gradient strength can be easily generated by diffusive mixing. The device is demonstrated using the response of Escherichia coli RP437 to gradients of amino acids and nickel ions.

This protocol describes the development of a microfluidic device for investigating bacterial chemotaxis in stable concentration gradients of chemoeffectors.

Chemotaxis allows bacteria to approach sources of attractant chemicals or to avoid sources of repellent chemicals. Bacteria constantly monitor the ...

Correlative Light and Electron Microscopy (CLEM) as a Tool to Visualize Microinjected Molecules and their Eukaryotic Sub-cellular Targets

The eukaryotic cell relies on complex, highly regulated, and functionally distinct membrane bound compartments that preserve a biochemical polarity necessary for proper cellular function. Understanding how the enzymes, proteins, and cytoskeletal components govern and maintain this biochemical segregation is therefore of paramount importance. The use of fluorescently tagged molecules to localize to and/or perturb subcellular compartments has yielded a wealth of knowledge and advanced our understanding of cellular regulation. Imaging techniques such as fluorescent and confocal microscopy make ascertaining the position of a fluorescently tagged small molecule relatively straightforward, however the resolution of very small structures is limited 1.
On the other hand, electron microscopy has revealed details of subcellular morphology at very high resolution, but its static nature makes it difficult to measure highly dynamic processes with precision 2,3. Thus, the combination of light microscopy with electron microscopy of the same sample, termed Correlative Light and Electron Microscopy (CLEM) 4,5, affords the dual advantages of ultrafast fluorescent imaging with the high-resolution of electron microscopy 6. This powerful technique has been implemented to study many aspects of cell biology 5,7. Since its inception, this procedure has increased our ability to distinguish subcellular architectures and morphologies at high resolution. 
Here, we present a streamlined method for performing rapid microinjection followed by CLEM (Fig. 1). The microinjection CLEM procedure can be used to introduce specific quantities of small molecules and/or proteins directly into the eukaryotic cell cytoplasm and study the effects from millimeter to multi-nanometer resolution (Fig. 2). The technique is based on microinjecting cells grown on laser etched glass gridded coverslips affixed to the bottom of live cell dishes and imaging with both confocal fluorescent and electron microscopy. Localization of the cell(s) of interest is facilitated by the grid pattern, which is easily transferred, along with the cells of interest, to the Epon resin used for immobilization of samples and sectioning prior to electron microscopy analysis (Fig. 3). Overlay of fluorescent and EM images allows the user to determine the subcellular localization as well as any morphological and/or ultrastructural changes induced by the microinjected molecule of interest (Fig. 4). This technique is amenable to time points ranging from &le;5 s up to several hours, depending on the nature of the microinjected sample.

Correlative Light and Electron Microscopy CLEM as a Tool to Visualize Microinjected Molecules and their Eukaryotic Sub-cellular Targets

The CLEM technique has been adapted to analyze ultrastructural morphology of membranes, organelles, and subcellular structures affected by microinjected molecules. This method combines the powerful techniques of micromanipulation/microinjection, confocal fluorescent microscopy, and electron microscopy to allow millimeter to multi-nanometer resolution. This technique is amenable to a wide variety of applications.


The eukaryotic cell relies on complex, highly regulated, and functionally distinct membrane bound compartments that preserve a biochemical polarity ...

Electroantennographic Bioassay as a Screening Tool for Host Plant Volatiles

Plant volatiles play an important role in plant-insect interactions. Herbivorous insects use plant volatiles, known as kairomones, to locate their host plant.1,2 When a host plant is an important agronomic commodity feeding damage by insect pests can inflict serious economic losses to growers. Accordingly, kairomones can be used as attractants to lure or confuse these insects and, thus, offer an environmentally friendly alternative to pesticides for insect control.3 Unfortunately, plants can emit a vast number volatiles with varying compositions and ratios of emissions dependent upon the phenology of the commodity or the time of day. This makes identification of biologically active components or blends of volatile components an arduous process. To help identify the bioactive components of host plant volatile emissions we employ the laboratory-based screening bioassay electroantennography (EAG). EAG is an effective tool to evaluate and record electrophysiologically the olfactory responses of an insect via their antennal receptors. The EAG screening process can help reduce the number of volatiles tested to identify promising bioactive components. However, EAG bioassays only provide information about activation of receptors. It does not provide information about the type of insect behavior the compound elicits; which could be as an attractant, repellent or other type of behavioral response. Volatiles eliciting a significant response by EAG, relative to an appropriate positive control, are typically taken on to further testing of behavioral responses of the insect pest. The experimental design presented will detail the methodology employed to screen almond-based host plant volatiles4,5 by measurement of the electrophysiological antennal responses of an adult insect pest navel orangeworm (Amyelois transitella) to single components and simple blends of components via EAG bioassay. The method utilizes two excised antennae placed across a "fork" electrode holder. The protocol demonstrated here presents a rapid, high-throughput standardized method for screening volatiles. Each volatile is at a set, constant amount as to standardize the stimulus level and thus allow antennal responses to be indicative of the relative chemoreceptivity. The negative control helps eliminate the electrophysiological response to both residual solvent and mechanical force of the puff. The positive control (in this instance acetophenone) is a single compound that has elicited a consistent response from male and female navel orangeworm (NOW) moth. An additional semiochemical standard that provides consistent response and is used for bioassay studies with the male NOW moth is (Z,Z)-11,13-hexdecadienal, an aldehyde component from the female-produced sex pheromone.6-8

A method to rapidly screen host plant volatiles by measurement of the electrophysiological response of adult navel orangeworm (Amyelois transitella) antennae to single components and blends via electroantennographic analysis is demonstrated.

Plant volatiles play an important role in plant-insect interactions. Herbivorous insects use plant volatiles, known as kairomones, to locate their host ...

Using SecM Arrest Sequence as a Tool to Isolate Ribosome Bound Polypeptides

Extensive research has provided ample evidences suggesting that protein folding in the cell is a co-translational process1-5. However, the exact pathway that polypeptide chain follows during co-translational folding to achieve its functional form is still an enigma. In order to understand this process and to determine the exact conformation of the co-translational folding intermediates, it is essential to develop techniques that allow the isolation of RNCs carrying nascent chains of predetermined sizes to allow their further structural analysis.
SecM (secretion monitor) is a 170 amino acid E. coli protein that regulates expression of the downstream SecA (secretion driving) ATPase in the secM-secA operon6. Nakatogawa and Ito originally found that a 17 amino acid long sequence (150-FSTPVWISQAQGIRAGP-166) in the C-terminal region of the SecM protein is sufficient and necessary to cause stalling of SecM elongation at Gly165, thereby producing peptidyl-glycyl-tRNA stably bound to the ribosomal P-site7-9. More importantly, it was found that this 17 amino acid long sequence can be fused to the C-terminus of virtually any full-length and/or truncated protein thus allowing the production of RNCs carrying nascent chains of predetermined sizes7. Thus, when fused or inserted into the target protein, SecM stalling sequence produces arrest of the polypeptide chain elongation and generates stable RNCs both in vivo in E. coli cells and in vitro in a cell-free system. Sucrose gradient centrifugation is further utilized to isolate RNCs.
The isolated RNCs can be used to analyze structural and functional features of the co-translational folding intermediates. Recently, this technique has been successfully used to gain insights into the structure of several ribosome bound nascent chains10,11. Here we describe the isolation of bovine Gamma-B Crystallin RNCs fused to SecM and generated in an in vitro translation system.

We describe here a technique that is now routinely used to isolate stably bound ribosome nascent chain complexes (RNCs). This technique takes advantage of the discovery that a 17 amino acid long SecM "arrest sequence" can halt translation elongation in a prokaryotic (E. coli) system, when inserted into (or fused to the C-terminus) of virtually any protein.

Extensive research has provided ample evidences suggesting that protein folding in the cell is a co-translational process1-5. However, the exact pathway ...

Using Caenorhabditis elegans as a Model System to Study Protein Homeostasis in a Multicellular Organism

The folding and assembly of proteins is essential for protein function, the long-term health of the cell, and longevity of the organism. Historically, the function and regulation of protein folding was studied in vitro, in isolated tissue culture cells and in unicellular organisms. Recent studies have uncovered links between protein homeostasis (proteostasis), metabolism, development, aging, and temperature-sensing. These findings have led to the development of new tools for monitoring protein folding in the model metazoan organism Caenorhabditis elegans. In our laboratory, we combine behavioral assays, imaging and biochemical approaches using temperature-sensitive or naturally occurring metastable proteins as sensors of the folding environment to monitor protein misfolding. Behavioral assays that are associated with the misfolding of a specific protein provide a simple and powerful readout for protein folding, allowing for the fast screening of genes and conditions that modulate folding. Likewise, such misfolding can be associated with protein mislocalization in the cell. Monitoring protein localization can, therefore, highlight changes in cellular folding capacity occurring in different tissues, at various stages of development and in the face of changing conditions. Finally, using biochemical tools ex vivo, we can directly monitor protein stability and conformation. Thus, by combining behavioral assays, imaging and biochemical techniques, we are able to monitor protein misfolding at the resolution of the organism, the cell, and the protein, respectively.

Using Caenorhabditis elegans as a Model System to Study Protein Homeostasis in a Multicellular Organism

To study the relationship between protein homeostasis, stress and aging, we monitored changes in protein folding by following protein dysfunction, protein localization in the cell and protein stability at the organismal, cellular and protein levels, using the genetically tractable metazoan Caenorhabditis elegans as a model system.

The folding and assembly of proteins is essential for protein function, the long-term health of the cell, and longevity of the organism. Historically, the ...

BEST: Barcode Enabled Sequencing of Tetrads

Tetrad analysis is a valuable tool for yeast genetics, but the laborious manual nature of the process has hindered its application on large scales. Barcode Enabled Sequencing of Tetrads (BEST)1 replaces the manual processes of isolating, disrupting and spacing tetrads. BEST isolates tetrads by virtue of a sporulation-specific GFP fusion protein that permits fluorescence-activated cell sorting of tetrads directly onto agar plates, where the ascus is enzymatically digested and the spores are disrupted and randomly arrayed by glass bead plating. The haploid colonies are then assigned sister spore relationships, i.e. information about which spores originated from the same tetrad, using molecular barcodes read during genotyping. By removing the bottleneck of manual dissection, hundreds or even thousands of tetrads can be isolated in minutes. Here we present a detailed description of the experimental procedures required to perform BEST in the yeast Saccharomyces cerevisiae, starting with a heterozygous diploid strain through the isolation of colonies derived from the haploid meiotic progeny.

Barcode Enabled Sequencing of Tetrads (BEST) replaces the manual processes of isolating, disrupting and spacing tetrads. BEST isolates tetrads by fluorescence-activated cell sorting onto agar plates, separates the spores by agitation with glass beads, and determines which randomly arrayed colonies were derived from the same original tetrad using molecular barcodes.

Tetrad analysis is a valuable tool for yeast genetics, but the laborious manual nature of the process has hindered its application on large scales. ...

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

Many studies seek to identify and map the brain regions involved in specific physiological regulations. The proto-oncogene c-fos, an immediate early gene, is expressed in neurons in response to various stimuli. The protein product can be readily detected with immunohistochemical techniques leading to the use of c-FOS detection to map groups of neurons that display changes in their activity. In this article, we focused on the identification of brainstem neuronal populations involved in the ventilatory adaptation to hypoxia or hypercapnia. Two approaches were described to identify involved neuronal populations in vivo in animals and ex vivo in deafferented brainstem preparations. In vivo, animals were exposed to hypercapnic or hypoxic gas mixtures. Ex vivo, deafferented preparations were superfused with hypoxic or hypercapnic artificial cerebrospinal fluid. In both cases, either control in vivo animals or ex vivo preparations were maintained under normoxic and normocapnic conditions. The comparison of these two approaches allows the determination of the origin of the neuronal activation i.e., peripheral and/or central. In vivo and ex vivo, brainstems were collected, fixed, and sliced into sections. Once sections were prepared, immunohistochemical detection of the c-FOS protein was made in order to identify the brainstem groups of cells activated by hypoxic or hypercapnic stimulations. Labeled cells were counted in brainstem respiratory structures. In comparison to the control condition, hypoxia or hypercapnia increased the number of c-FOS labeled cells in several specific brainstem sites that are thus constitutive of the neuronal pathways involved in the adaptation of the central respiratory drive.

The c-FOS Protein Immunohistological Detection: A Useful Tool As a Marker of Central Pathways Involved in Specific Physiological Responses In Vivo and Ex Vivo

Here, we present a protocol based on c-FOS protein immunohistological detection, a classical technique used for the identification of neuronal populations involved in specific physiological responses in vivo and ex vivo.

Many studies seek to identify and map the brain regions involved in specific physiological regulations. The proto-oncogene c-fos, an immediate early gene, ...

Laser-assisted Microdissection (LAM) as a Tool for Transcriptional Profiling of Individual Cell Types

The understanding of developmental processes at the molecular level requires insights into transcriptional regulation, and thus the transcriptome, at the level of individual cell types. While the methods described here are generally applicable to a wide range of species and cell types, our research focuses on plant reproduction. Plant cultivation and seed production is of crucial importance for human and animal nutrition. A detailed understanding of the regulatory networks that govern the formation of the reproductive lineage (germline) and ultimately of seeds is a precondition for the targeted manipulation of plant reproduction. In particular, the engineering of apomixis (asexual reproduction through seeds) into crop plants promises great improvements, as it leads to the formation of clonal seeds that are genetically identical to the mother plant. Consequently, the cell types of the female germline are of major importance for the understanding and engineering of apomixis. However, as the corresponding cells are deeply embedded within the floral tissues, they are very difficult to access for experimental analyses, including cell-type specific transcriptomics. To overcome this limitation, sections of individual cells can be isolated by laser-assisted microdissection (LAM). While LAM in combination with transcriptional profiling allows the identification of genes and pathways active in any cell type with high specificity, establishing a suitable protocol can be challenging. Specifically, the quality of RNA obtained after LAM can be compromised, especially when small, single cells are targeted. To circumvent this problem, we have established a workflow for LAM that reproducibly results in high RNA quality that is well suitable for transcriptomics, as exemplified here by the isolation of cells of the female germline in apomictic Boechera. In this protocol, procedures are described for tissue preparation and LAM, also with regard to RNA extraction and quality control.

Laser-assisted Microdissection LAM as a Tool for Transcriptional Profiling of Individual Cell Types

Here we present a protocol for laser-assisted microdissection of specific plant cell types for transcriptional profiling. While the protocol is suitable for different species and cell types, the focus is on highly inaccessible cells of the female germline important for sexual and apomictic reproduction in the crucifer genus Boechera.

The understanding of developmental processes at the molecular level requires insights into transcriptional regulation, and thus the transcriptome, at the ...

Efficient Nucleic Acid Extraction and 16S rRNA Gene Sequencing for Bacterial Community Characterization

There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing technologies have allowed for the rapid and efficient characterization of bacterial communities using 16S rRNA gene sequencing from a variety of sources. Although readily available tools for 16S rRNA sequence analysis have standardized computational workflows, sample processing for DNA extraction remains a continued source of variability across studies. Here we describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs. We also delineate downstream methods for 16S rRNA gene sequencing, including generation of sequencing libraries, data quality control, and sequence analysis. The workflow can accommodate multiple samples types, including stool and swabs collected from a variety of anatomical locations and host species. Additionally, recovered DNA and RNA can be separated and used for other applications, including whole genome sequencing or RNA-seq. The method described allows for a common processing approach for multiple sample types and accommodates downstream analysis of genomic, metagenomic and transcriptional information.

We describe an efficient, robust, and cost effective method for extracting nucleic acid from swabs for characterization of bacterial communities using 16S rRNA gene amplicon sequencing. The method allows for a common processing approach for multiple sample types and accommodates a number of downstream analytic processes.

There is a growing appreciation for the role of microbial communities as critical modulators of human health and disease. High throughput sequencing ...