Generation and Characterization of Rat Uterus Organoids from Rat Endometrial Epithelial Stem Cells

Summary

Here, we present a protocol to isolate and culture rat endometrial epithelial stem cells (reESCs), generating rat endometrial organoids. This method facilitates in vitro studies of endometrial diseases, enabling gene editing and other cellular manipulations.

Abstract

Endometrial organoids offer valuable insights into the development and pathophysiology of endometrial diseases and serve as platforms for drug testing. While human and mouse endometrial organoids have been developed, research on rat endometrial organoids remains limited. Given that rats can better simulate certain endometrial pathologies, such as intrauterine adhesions, this study aimed to establish rat endometrial organoids. We present a detailed protocol for the isolation and culture of rat endometrial epithelial stem cells (reESCs) and the generation of rat endometrial organoids. Using a refined reESCs expansion medium, we successfully isolated and stably expanded reESCs, demonstrating their long-term culture potential. The reESC-generated organoids exhibited typical structural and functional characteristics of the endometrium, including hormone responsiveness. Our results showed that rat endometrial organoids could be cultured over a long term with stable proliferation, maintaining the glandular structure, cell polarity, and functional characteristics of the endometrial epithelium. This novel rat-derived endometrial organoid model provides a valuable platform for studying endometrial diseases and testing therapeutic interventions, with potential applications across various mammalian species.

Introduction

The endometrium, a versatile and regenerative tissue in the human body, undergoes periodic shedding, regeneration, and differentiation under the influence of ovarian hormones¹. Abnormalities in the endometrium are linked to various female reproductive system diseases, such as endometriosis, endometrial cancer, and infertility². The lack of reliable research models for the endometrium hampers in-depth studies of the pathogenesis, clinical diagnosis, and treatment of these diseases. While cell lines and animal models are commonly utilized for endometrial research, challenges such as phenotypic instabi....

Protocol

Six 7/8-week-old female Sprague-Dawley rats weighing 200-250 g were used in this work. The rats were housed in a climate-controlled animal facility with ad libitum access to food and water. All experimental procedures involving animals were conducted in adherence to the Institutional Guidelines for the Care and Use of Laboratory Animals and were approved by the institutional review board for animal experiments at the Research Ethics Committee of the Meizhou People's Hospital.

The .......

Discussion

In this study, we have described a straightforward method for isolating and culturing rat endometrial epithelial stem cells (reESCs) and refined the previously established ex vivo system for human endometrial epithelial stem cells⁸. Our approach utilizes a small molecule culture medium containing Y27632, A8301, and CHIR99021 as core components to enable stable and long-term ex vivo culture. Moreover, we successfully generated rat endometrial organoids in real time using reESCs. T.......

Materials

Name	Company	Catalog Number	Comments
Anti-CD15 (SSEA-1)	Abcam	ab135377	Rabbit, 1:200 (IHC)
Anti-Estrogen Receptor alpha	Abcam	ab32063	Rabbit, 1:200 (IHC)
Anti-pan Cytokeratin	Abcam	ab7753	Mouse, 1:250 (IHC)
Anti-Progesterone Receptor	Abcam	ab101688	Rabbit, 1:200 (IHC)
Anti-Ki67	Abcam	ab279653	Mouse, 1:250 (IHC)
A8301	TargetMol	909910-43-6
β-Estradiol	Merck	E8875
Cell Counting Kit-8	Beyotime	C0038
CD9	BioLegend	109819	1:20 (FC), Pacific Blue
CD24	BioLegend	101806	1:20 (FC), FITC
CD31	BioLegend	303120	1:20 (FC), APC
CD45	BioLegend	301703	1:20 (FC), PE
CHIR99021	TargetMol	CT99021
Cultrex Organoid Harvesting Solution	R&D Systems	3700-100-01
Cy3 TSA Fluorescence System Kit	APExBIO	K1051
Cy5 TSA Fluorescence System Kit	APExBIO	K1052
DAPI	Sigma	D9542	1 μg/mL
DMEM/F-12	Invitrogen	11330032
EpCAM	BioLegend	369803	1:20 (FC), PerCP
Fluorescein TSA Fluorescence System Kit	APExBIO	K1050
Goat anti-Rabbit IgG, Alexa Fluor 488	Invitrogen	A-11008	1:500
Goat anti-Mouse IgG, Alexa Fluor 555	Invitrogen	A-21422	1:500
Goat Anti-rabbit IgG/HRP antibody	APExBIO	bs-0295G-HRP
Knockout serum replacement	Invitrogen	10828028
Matrigel	Corning	356234
PrimeScript RT Master Mix	Takara	RR063A
Progesterone	Merck	57-83-0
Sprague-Dawley rat	Shanghai JieSiJie Laboratory Animals Co., LTD, China
SSEA-1	BioLegend	323047	1:20 (FC), APC
TB Green Fast qPCR Mix	Takara	RR820A
TriZOL	Invitrogen	15596026CN	RNA extraction
u-Slide 8-well plates	Ibidi	80827
Y27632	TargetMol	146986-50-7
qPCR primers of target genes
Genes	Company	Sequences
rat GAPDH F	Sangon biotech	GACATGCCGCCTGGAGAAAC
rat GAPDH R	Sangon biotech	AGCCCAGGATGCCCTTTAGT
rat Nanog F	Sangon biotech	GACTAGCAACGGCCTGACTCA
rat Nanog R	Sangon biotech	CTGCAATGGATGCTGGGATA
rat Sox2 F	Sangon biotech	ATTACCCGCAGCAAAATGAC
rat Sox2 R	Sangon biotech	ATCGCCCGGAGTCTAGTTCT
rat Oct4 F	Sangon biotech	CCCAGCGCCGTGAAGTTGGA
rat Oct4 R	Sangon biotech	ACCTTTCCAAAGAGAACGCCCA GG