D.X. is supported by the National Natural Science Foundation of China (32000441), the Natural Science Foundation of Fujian Province, China (2023J01130), the Fundamental Research Funds for the Central Universities of Huaqiao University (ZQN-924), and the Scientific Research Funds of Huaqiao University (18BS205). P.K. is supported by the National Natural Science Foundation of China (32170619), the Research Fund for International Senior Scientists from the National Natural Science Foundation of China (32150710525), and the Natural Science Foundation of Fujian Province, China (2020J02006).

Figure 1 provides a schematic overview of the InSET method. For optimal coverage, prepare five parallel libraries from 1 &#181;g of genomic DNA, then pool them for next-generation sequencing. This procedure has been successfully completed continuously in previous tests, though users may introduce pause points based on their discretion. Detailed information on the reagents and equipment used in this study can be found in the Table of Materials.
1. Capture of lentivirus integration sites in the genome
<ol>
	<li>Use the Genomic DNA isolated from lentivirus-based insertional mutagenesis cell library (1 &#181;g), as described in a previous study32, as the template for a linear PCR in a 50 &#181;L reaction containing 1x Taq Buffer, 2.5 U Taq DNA Polymerase, 4 &#181;L of dNTP Mixture (2.5 mM each), and 0.3 &#181;M of biotinylated primer 3-LTR_prime (Table 1) in a PCR tube. 
	NOTE: The 3-LTR_prime primer anneals to the LTR region of the lentivirus sequence. If it anneals to the 5&#39; LTR, the amplified fragment includes the flanking genomic sequence. If it anneals to the 3&#39; LTR, the amplified fragment contains an internal lentivirus sequence, which cannot be aligned to the host genome and will, therefore, be filtered out during downstream sequencing data analysis. This primer can also be modified to adapt to other types of vectors used to generate an insertional mutagenesis cell library.</li>
	<li>Perform 50 cycles of linear PCR in a standard PCR thermocycler, adding 2.5 U of Taq DNA Polymerase at the start and again immediately after 25 cycles. PCR conditions are as follows: 94 &#176;C for 5 min; 50 cycles of 94 &#176;C for 30 s, 55 &#176;C for 30 s and 72 &#176;C for 30 s; 72 &#176;C for 5 min. 
	NOTE: To maintain the activity of the Taq DNA Polymerase during prolonged reactions, it is recommended to add the enzyme at both the beginning and the midpoint of the reaction.</li>
	<li>Transfer the PCR products to a new, clean 1.5 mL centrifuge tube.</li>
	<li>Mix the PCR products thoroughly with 10 &#181;L of biotin-streptavidin magnetic beads.</li>
	<li>Incubate the mixture for 2 hours at room temperature, shaking at 400 rpm in a metal bath. 
	NOTE: Take out the tube to mix well with the pipette every 15 min.</li>
	<li>Use a magnetic stand to collect the beads, then carefully remove the supernatant.</li>
	<li>Wash the beads with 300 &#181;L of Binding/Wash Buffer (10 mM of Tris-HCl (pH 7.5), 1 mM of EDTA, 1 M of NaCl, 0.1% Tween-20) 6 times and discard the supernatant.</li>
	<li>Wash with 300 &#181;L (65 &#176;C) DNase/RNase-free distilled water twice and discard the supernatant.</li>
	<li>For the second strand synthesis, resuspend the beads in a 24 &#181;L reaction volume containing 1x Klenow Fragment Buffer, 2 &#181;L of dNTP Mixture (2.5 mM each), and 6.25 &#181;M of P5_N6 primer (Table 1) in a PCR tube. 
	NOTE: Prepare a 100 &#181;M stock solution of P5_N6 primer. The P5_N6 primer is composed of a fixed P5 adaptor sequence at the 5&#39; end and a random hexamer sequence at the 3&#39; end. The random hexamer can bind to a diverse range of target sequences, making it suitable for amplifying various DNA fragments generated through linear PCR.</li>
	<li>Pre-incubate the mixture at 15 &#176;C for 20 min in a PCR thermocycler.</li>
	<li>Add 2 U of Klenow Fragment (Large Fragment E.coli DNA Polymerase).</li>
	<li>Incubate the mixtures in a PCR thermocycler at the following conditions: slowly ramp at 0.5 &#176;C/min from 15 &#176;C to 25 &#176;C followed by 30 min incubation; then slowly ramp at 0.5 &#176;C/min to 37 &#176;C followed by 1 h incubation.</li>
	<li>Transfer the PCR products into a new, clean 1.5 mL centrifuge tube.</li>
	<li>Use a magnetic stand to capture the beads, then discard the supernatant.</li>
	<li>Wash the beads gently with 300 &#181;L of 4 &#176;C DNase/RNase-free distilled water. Collect the beads and discard the supernatant.</li>
</ol>
2. Construction of NGS library with nested PCR
<ol>
	<li>Resuspend the beads from step 1.15 in a 25 &#181;L PCR reaction volume containing 1x Taq Buffer, 1.25 U Taq DNA Polymerase, 0.5 &#181;M of primer P5 (Table 1), 2 &#181;L of dNTP Mixture (2.5 mM each), and 0.5 &#181;M of primer 3-LTR_Nest (Table 1) in a PCR tube.</li>
	<li>Perform PCR reactions in a PCR thermocycler under the following conditions: 94 &#176;C for 3 min; 20 cycles of 94 &#176;C for 30 s, 55 &#176;C for 30 s and 72 &#176;C for 30 s; 72 &#176;C for 7 min.</li>
	<li>Use 5 &#181;L of the PCR products from step 2.2 as the template for the next round of PCR in 50 &#181;L volume containing 1x Taq Buffer, 2.5 U Taq DNA Polymerase, 4 &#181;L of dNTP Mixture (2.5 mM each), 0.4 &#181;M of primer Illumina_P5 (Table 1) and 0.4 &#181;M of primer Illumina_P7-3LTR (Table 1).</li>
	<li>Perform PCR reactions in a PCR thermocycler under the following conditions: 94 &#176;C for 3 min; 15 cycles of 94 &#176;C for 30 s, 55 &#176;C for 30 s, and 72 &#176;C for 30 s; 72 &#176;C for 7 min.</li>
	<li>Transfer the PCR products to a clean 1.5 mL centrifuge tube. 
	NOTE: The protocol can be paused at this step, and the samples can be stored at -20 &#176;C.</li>
	<li>Purify the PCR products using 1.2x volumes of DNA clean beads, bringing the final volume to 21 &#181;L. 
	NOTE: Take 10 &#181;L of PCR products from each of the 5 libraries prepared in parallel, pool them together, and purify to a final volume of 21 &#181;L. The purification protocol for the PCR products is adapted from the manufacturer&#39;s instructions for the DNA clean beads (see Table of Materials).
	<ol>
		<li>Equilibrate the beads from 2-8 &#176;C to room temperature for 30 min.</li>
		<li>Mix the beads thoroughly by inverting or vortexing.</li>
		<li>Pipette 1.2x volumes of the beads into a clean 1.5 mL centrifuge tube.</li>
		<li>Add the PCR products into the beads and mix thoroughly by pipetting up and down 10 times.</li>
		<li>Incubate at room temperature for 5 min to allow DNA binding to the beads.</li>
		<li>Place the samples on a magnetic stand and remove the supernatant once the solution is clear (about 5 min).</li>
		<li>Add 200 &#181;L of 80% ethanol to wash the beads, incubate at room temperature for 30 s, and remove the supernatant. 
		NOTE: The 80% ethanol should be prepared freshly.</li>
		<li>Repeat step 2.6.7 once.</li>
		<li>Air dry the beads at room temperature with the lid open for about 5 min.</li>
		<li>Remove the tube from the magnetic stand, add 22 &#181;L of DNase/RNase-free distilled water, mix thoroughly by pipetting up and down 10 times, and let it sit at room temperature for 2 min.</li>
		<li>Place the tube on the magnetic stand until the solution is clear (about 2 min), then transfer 21 &#181;L of supernatant to a clean 1.5 mL centrifuge tube. 
		NOTE: The protocol can be paused at this step, and the samples can be stored at -20 &#176;C.</li>
	</ol>
	</li>
	<li>Use 1 &#181;L of purified PCR products to measure the concentration using the Fluorometer with the commercially available dsDNA fluorescence detection kit (see Table of Materials). 
	NOTE: The concentration measurement protocol follows the manufacturer&#39;s instructions for the dsDNA detection kit.
	<ol>
		<li>Prepare the Working Solution preparation by mixing the Reagent and Buffer (provided in the kit) at a ratio of 1:200.</li>
		<li>Prepare the assay standards by mixing 10 &#181;L of Standard #1 and 10 &#181;L of Standard #2 (provided in the kit), each with 190 &#181;L of Working Solution. Gently vortex the mixture for 2-3 s.</li>
		<li>Prepare the assay sample by mixing 1 &#181;L of the purified PCR products with 190 &#181;L of Working Solution. Gently vortex the mixture for 2-3 s.</li>
		<li>Incubate the assay standards and assay samples for 2 min at room temperature, keeping them protected from light.</li>
		<li>Turn on the Fluorometer.</li>
		<li>Select the dsDNA High Sensitivity&#160;program from the main menu.</li>
		<li>For calibration, insert Standard #1 into the machine, press the Read standard button to measure the first standard, then insert Standard #2 and press the Read standard button to measure the second standard.</li>
		<li>For sample measurement, press the Run samples button to go to the sample measurement page. Insert each tube containing the assay sample, and press the Read tube button to obtain the concentration. 
		NOTE: The protocol can be paused at this step, and the samples can be stored at -20 &#176;C.</li>
	</ol>
	</li>
	<li>Perform NGS on Illumina platforms using paired-end 150 bp (PE150) strategy on a 30 giga-base (GB) scale. 
	NOTE: This step is usually outsourced to the sequencing companies.</li>
</ol>
3. Data analysis
NOTE: The analysis in human cell lines was used as an example in this section.
<ol>
	<li>Mapping of lentivirus-integration sites
	<ol>
		<li>Filter out sequencing reads with more than 50% low-quality bases (Phred score &#60;20), more than 15 &#39;N&#39; bases, or shorter than 150 bases using fastp tool33 (see Table of Materials).</li>
		<li>Select only paired-end reads with the read 2 starting with LTR tag &#34;GCCTTGTGTGTGGTAGATCCACAG 
		ATCAAGGATATCTTGTCTTCGTTGGGAGTGA&#8203;AT 
		TAGCCCTTCCA&#34;. 
		NOTE: This sequence depends on the sequence of the vector used to generate the insertional mutagenesis cell library.</li>
		<li>Trim the LTR tag sequence from the reads selected from step 3.1.2.</li>
		<li>Align the trimmed reads to the GRCh37/hg19 using BWA-MEM 34 (see Table of Materials) with default settings.</li>
		<li>Retain only read pairs in which both read 1 and read 2 are uniquely mapped to the genome with correct configuration and spacing, indicated by FLAG 147 and FLAG 163.</li>
		<li>Define the insertion position as the first aligned base of the trimmed read 2.</li>
		<li>Normalize the read counts at each unique insertion site to the total number of uniquely aligned reads in each sample.</li>
	</ol>
	</li>
	<li>Identification of insertions affecting cellular fitness (IACFs) 
	NOTE: In the statistical analysis, it is advisable to conduct pairwise comparisons among the three biological replicates of both control and treated samples to identify significantly enriched or depleted positions. The number of replicates mentioned above is minimal. It is recommended to use as many replicates as practically possible to ensure the reliability and accuracy of the results.
	<ol>
		<li>Convert the normalized read counts of each position to log10 values.</li>
		<li>Set the log10 values of positions with zero reads as &#8722;5.</li>
		<li>Perform two-sided paired Student&#39;s t-test on the log10 values.</li>
		<li>Adjust the p-values for multiple comparisons using the Benjamini-Hochberg method within the R environment.</li>
		<li>Select positions with a False Discovery Rate (FDR) threshold of 25% as IACFs.</li>
	</ol>
	</li>
	<li>Identification of clusters affecting cellular fitness (CACFs) 
	NOTE: Three biological replicates of control and treated samples were recommended for this analysis.
	<ol>
		<li>Identify the significantly enriched or depleted insertion clusters between control and treated samples using SICER35 (see Table of Materials) with an FDR threshold of 1%. The command for SICER analysis is &#34;sh $SICER/SICER.sh $InputDir $In $Control $OutputDir hg19 1 10 1 0.8 30 0.01&#34;. 
		NOTE: The meanings of the parameters in the command above are as follows: [&#34;InputDir&#34;] [&#34;treated sample insertion sites bed file&#34;] [&#34;control sample insertion sites bed file&#34;] [&#34;OutputDir&#34;] [&#34;species&#34;] [&#34;redundancy threshold&#34;] [&#34;window size (bp)&#34;] [&#34;fragment size&#34;] [&#34;effective genome fraction&#34;] [&#34;gap size (bp)&#34;] [&#34;E-value&#34;].</li>
		<li>Obtain cluster regions shared by at least two biological replicates with the &#34;intersect&#34; function of the BEDTools suite36 (see Table of Materials) and denote these cluster regions as CACFs.</li>
	</ol>
	</li>
</ol>

InSET: A Novel Tool for Unbiased Genome-Wide Functional Element Discovery

<ol>
	<li>Kapranov, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-scale+transcriptional+activity+in+chromosomes+21+and+22.">Large-scale transcriptional activity in chromosomes 21 and 22.</a> Science. 296 (5569), 916-919 (2002).</li><li>Bertone, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+identification+of+human+transcribed+sequences+with+genome+tiling+arrays.">Global identification of human transcribed sequences with genome tiling arrays.</a> Science. 306 (5705), 2242-2246 (2004).</li><li>Carninci, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+transcriptional+landscape+of+the+mammalian+genome.">The transcriptional landscape of the mammalian genome.</a> Science. 309 (5740), 1559-1563 (2005).</li><li>Kapranov, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+majority+of+total+nuclear-encoded+non-ribosomal+RNA+in+a+human+cell+is+'dark+matter'+un-annotated+RNA.">The majority of total nuclear-encoded non-ribosomal RNA in a human cell is 'dark matter' un-annotated RNA.</a> BMC Biol. 8, 149 (2010).</li><li>Djebali, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Landscape+of+transcription+in+human+cells.">Landscape of transcription in human cells.</a> Nature. 489 (7414), 101-108 (2012).</li><li>Kapranov, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Examples+of+the+complex+architecture+of+the+human+transcriptome+revealed+by+race+and+high-density+tiling+arrays.">Examples of the complex architecture of the human transcriptome revealed by race and high-density tiling arrays.</a> Genome Res. 15 (7), 987-997 (2005).</li><li>Denoeud, F., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Prominent+use+of+distal+5'+transcription+start+sites+and+discovery+of+a+large+number+of+additional+exons+in+encode+regions.">Prominent use of distal 5' transcription start sites and discovery of a large number of additional exons in encode regions.</a> Genome Res. 17 (6), 746-759 (2007).</li><li>Mercer, T. R., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Targeted+RNA+sequencing+reveals+the+deep+complexity+of+the+human+transcriptome.">Targeted RNA sequencing reveals the deep complexity of the human transcriptome.</a> Nat Biotechnol. 30 (1), 99-104 (2011).</li><li>Deveson, I. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Universal+alternative+splicing+of+non-coding+exons.">Universal alternative splicing of non-coding exons.</a> Cell Syst. 6 (2), 245-255.e5 (2018).</li><li>Xu, D., Tang, L., Kapranov, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Complexities+of+mammalian+transcriptome+revealed+by+targeted+RNA+enrichment+techniques.">Complexities of mammalian transcriptome revealed by targeted RNA enrichment techniques.</a> Trends Genet. 39 (4), 320-333 (2023).</li><li>Amaral, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+status+of+the+human+gene+catalogue.">The status of the human gene catalogue.</a> Nature. 622 (7981), 41-47 (2023).</li><li>Mattick, J. S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Long+non-coding+RNAs:+Definitions,+functions,+challenges+and+recommendations.">Long non-coding RNAs: Definitions, functions, challenges and recommendations.</a> Nat Rev Mol Cell Biol. 24 (6), 430-447 (2023).</li><li>Bassik, M. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+systematic+mammalian+genetic+interaction+map+reveals+pathways+underlying+ricin+susceptibility.">A systematic mammalian genetic interaction map reveals pathways underlying ricin susceptibility.</a> Cell. 152 (4), 909-922 (2013).</li><li>Wang, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Identification+and+characterization+of+essential+genes+in+the+human+genome.">Identification and characterization of essential genes in the human genome.</a> Science. 350 (6264), 1096-1101 (2015).</li><li>Zhu, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-scale+deletion+screening+of+human+long+non-coding+RNAs+using+a+paired-guide+RNA+CRISPR-Cas9+library.">Genome-scale deletion screening of human long non-coding RNAs using a paired-guide RNA CRISPR-Cas9 library.</a> Nat Biotechnol. 34 (12), 1279-1286 (2016).</li><li>Liu, S. J., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPRi-based+genome-scale+identification+of+functional+long+non-coding+RNA+loci+in+human+cells.">CRISPRi-based genome-scale identification of functional long non-coding RNA loci in human cells.</a> Science. 355, 6320 (2017).</li><li>Bester, A. C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=An+integrated+genome-wide+CRISPRa+approach+to+functionalize+lncRNAs+in+drug+resistance.">An integrated genome-wide CRISPRa approach to functionalize lncRNAs in drug resistance.</a> Cell. 173 (3), 649-664.e20 (2018).</li><li>Liu, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+screening+for+functional+long+non-coding+RNAs+in+human+cells+by+Cas9+targeting+of+splice+sites.">Genome-wide screening for functional long non-coding RNAs in human cells by Cas9 targeting of splice sites.</a> Nat Biotechnol. 36, 1203-1210 (2018).</li><li>Xu, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+CRISPR/Cas13-based+approach+demonstrates+biological+relevance+of+vlinc+class+of+long+non-coding+RNAs+in+anticancer+drug+response.">A CRISPR/Cas13-based approach demonstrates biological relevance of vlinc class of long non-coding RNAs in anticancer drug response.</a> Sci Rep. 10 (1), 1794 (2020).</li><li>Noguchi, Y., Matsui, R., Suh, J., Dou, Y., Suzuki, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome-wide+screening+approaches+for+biochemical+reactions+independent+of+cell+growth.">Genome-wide screening approaches for biochemical reactions independent of cell growth.</a> Annu Rev Genomics Hum Genet. 25 (1), 51-76 (2024).</li><li>Recinos, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=CRISPR-dCas13d-based+deep+screening+of+proximal+and+distal+splicing-regulatory+elements.">CRISPR-dCas13d-based deep screening of proximal and distal splicing-regulatory elements.</a> Nat Commun. 15 (1), 3839 (2024).</li><li>Cho, S. W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Analysis+of+off-target+effects+of+CRISPR/Cas-derived+RNA-guided+endonucleases+and+nickases.">Analysis of off-target effects of CRISPR/Cas-derived RNA-guided endonucleases and nickases.</a> Genome Res. 24 (1), 132-141 (2014).</li><li>Zhang, X. H., Tee, L. Y., Wang, X. G., Huang, Q. S., Yang, S. H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Off-target+effects+in+CRISPR/Cas9-mediated+genome+engineering.">Off-target effects in CRISPR/Cas9-mediated genome engineering.</a> Mol Ther Nucleic Acids. 4 (11), e264 (2015).</li><li>Stojic, L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Specificity+of+RNAi,+LNA+and+CRISPRi+as+loss-of-function+methods+in+transcriptional+analysis.">Specificity of RNAi, LNA and CRISPRi as loss-of-function methods in transcriptional analysis.</a> Nucleic Acids Res. 46 (12), 5950-5966 (2018).</li><li>Gao, F., Cai, Y., Kapranov, P., Xu, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Reverse-genetics+studies+of+lncRNAs-what+we+have+learnt+and+paths+forward.">Reverse-genetics studies of lncRNAs-what we have learnt and paths forward.</a> Genome Biol. 21 (1), 93 (2020).</li><li>Leoni, C., Volpicella, M., De Leo, F., Gallerani, R., Ceci, L. R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Genome+walking+in+eukaryotes.">Genome walking in eukaryotes.</a> FEBS J. 278 (21), 3953-3977 (2011).</li><li>Carette, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Haploid+genetic+screens+in+human+cells+identify+host+factors+used+by+pathogens.">Haploid genetic screens in human cells identify host factors used by pathogens.</a> Science. 326 (5957), 1231-1235 (2009).</li><li>Carette, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Global+gene+disruption+in+human+cells+to+assign+genes+to+phenotypes+by+deep+sequencing.">Global gene disruption in human cells to assign genes to phenotypes by deep sequencing.</a> Nat Biotechnol. 29 (6), 542-546 (2011).</li><li>Burckstummer, T., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+reversible+gene+trap+collection+empowers+haploid+genetics+in+human+cells.">A reversible gene trap collection empowers haploid genetics in human cells.</a> Nat Methods. 10 (10), 965-971 (2013).</li><li>Carette, J. E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Ebola+virus+entry+requires+the+cholesterol+transporter+niemann-pick+c1.">Ebola virus entry requires the cholesterol transporter niemann-pick c1.</a> Nature. 477 (7364), 340-343 (2011).</li><li>Cao, J. Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+genome-wide+haploid+genetic+screen+identifies+regulators+of+glutathione+abundance+and+ferroptosis+sensitivity.">A genome-wide haploid genetic screen identifies regulators of glutathione abundance and ferroptosis sensitivity.</a> Cell Rep. 26 (6), 1544-1556.e8 (2019).</li><li>Xu, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Evidence+for+widespread+existence+of+functional+novel+and+non-canonical+human+transcripts.">Evidence for widespread existence of functional novel and non-canonical human transcripts.</a> BMC Biol. 21 (1), 271 (2023).</li><li>Chen, S., Zhou, Y., Chen, Y., Gu, J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Fastp:+An+ultra-fast+all-in-one+FASTQ+preprocessor.">Fastp: An ultra-fast all-in-one FASTQ preprocessor.</a> Bioinformatics. 34 (17), i884-i890 (2018).</li><li>Li, H. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Aligning+sequence+reads,+clone+sequences+and+assembly+contigs+with+bwa-mem.">Aligning sequence reads, clone sequences and assembly contigs with bwa-mem.</a> arXiv preprint arXiv:1303.3997. , (2013).</li><li>Zang, C., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+clustering+approach+for+identification+of+enriched+domains+from+histone+modification+chip-seq+data.">A clustering approach for identification of enriched domains from histone modification chip-seq data.</a> Bioinformatics. 25 (15), 1952-1958 (2009).</li><li>Quinlan, A. R., Hall, I. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Bedtools:+A+flexible+suite+of+utilities+for+comparing+genomic+features.">Bedtools: A flexible suite of utilities for comparing genomic features.</a> Bioinformatics. 26 (6), 841-842 (2010).</li><li>Pule, M. A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flanking-sequence+exponential+anchored-polymerase+chain+reaction+amplification:+A+sensitive+and+highly+specific+method+for+detecting+retroviral+integrant-host-junction+sequences.">Flanking-sequence exponential anchored-polymerase chain reaction amplification: A sensitive and highly specific method for detecting retroviral integrant-host-junction sequences.</a> Cytotherapy. 10 (5), 526-539 (2008).</li><li>Demeulemeester, J., De Rijck, J., Gijsbers, R., Debyser, Z. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Retroviral+integration:+Site+matters:+Mechanisms+and+consequences+of+retroviral+integration+site+selection.">Retroviral integration: Site matters: Mechanisms and consequences of retroviral integration site selection.</a> Bioessays. 37 (11), 1202-1214 (2015).</li><li>Kvaratskhelia, M., Sharma, A., Larue, R. C., Serrao, E., Engelman, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Molecular+mechanisms+of+retroviral+integration+site+selection.">Molecular mechanisms of retroviral integration site selection.</a> Nucleic Acids Res. 42 (16), 10209-10225 (2014).</li><li>Ambrosi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Estimated+comparative+integration+hotspots+identify+different+behaviors+of+retroviral+gene+transfer+vectors.">Estimated comparative integration hotspots identify different behaviors of retroviral gene transfer vectors.</a> PLoS Comput Biol. 7 (12), e1002292 (2011).</li></ol>

The authors have no disclosures.

In forward genetics analysis, genome-walking is essential for profiling integration sites in insertional mutagenesis cell libraries. Classical genome-walking methods like I-PCR&#160;and LAM-PCR&#160;often require restriction enzyme digestion and ligation, which can reduce library complexity and introduce biases due to enzyme site dependency27,28,29. The InSET method overcomes these limitations by eliminating the restriction dige...

Functional genomics remains a crucial and challenging field, even in the post-genome era, with a significant portion of genomic regions still lacking functional characterization. A key reason for these challenges lies in the intricate nature of the human genome and transcriptome, which are characterized by pervasive transcription and universal alternative splicing in both protein-coding and non-coding regions1,2,3,4,5. This complexity has been extensively highlighted through RNA-targeted enrichment studies6,7,8,9. It is increasingly recognized that numerous novel genomic elements remain unmapped and functionally unannotated10,11,12in addition to the well-annotated segments of the human genome.
In recent years, advancements in reverse-genetics tools have been seen, such as RNA interference (RNAi) and CRISPR/Cas systems13,14,15,16,17,18,19,20,21. However, these methods have notable disadvantages, including non-specific effects and high costs associated with generating complex libraries of short hairpin RNAs (shRNAs) or single guide RNAs (sgRNAs)22,23,24,25. Additionally, these methods predominantly focus on annotated genomic elements. In contrast, forward genetics has the advantage of identifying novel, unannotated functional genomic elements. Given the complexity of the human genome and transcriptome, as well as the vast number of novel genomic elements, this capability of forward genetics is of significant importance.
Forward genetics cell libraries are frequently generated through random retroviral integration, making the efficient detection of genome-wide integration sites crucial for a forward genetics assay. Detecting these integration sites typically involves genome-walking tools26. While there have been significant advancements in these tools, few are optimized for next-generation sequencing (NGS) applications and subsequently applied in insertional mutagenesis studies. Insertional mutagenesis in cell lines often utilizes methods like inverse PCR (I-PCR) or linear amplification-mediated PCR (LAM-PCR) to detect integration sites27,28,29. These methods, however, usually require restriction enzyme digestion or ligation steps, which can reduce efficiency and introduce biases in the results.
To enhance the efficient detection of genome-wide integration sites in forward genetics screens, a method called the Insertion-based Screen for functional Elements and Transcripts (InSET) method was introduced here. By integrating genome-walking with NGS, InSET enables the high-throughput identification of lentivirus integration sites in lentivirus-based insertional mutagenesis libraries. Compared to existing methods27,28,29, InSET is relatively straightforward and simple, eliminating the restriction enzyme digestion or ligation steps, making it more convenient and accessible. Furthermore, although the existing forward genetics screen in mammalian cells is limited to very few haploid or near-haploid cell lines27,28,29,30,31, InSET has been proven to work in aneuploid cell lines32.
This study provides a detailed, step-by-step protocol for implementing the InSET method. Additionally, it demonstrates the application of InSET in insertional mutagenesis studies. InSET serves as a powerful tool for identifying novel exons within genomic elements, encompassing both protein-coding and non-coding RNAs in human cell lines.

<table><tbody><tr><td>0.5 M EDTA</td><td>Invitrogen</td><td>AM9260G</td><td>To make Binding/Wash Buffer</td></tr><tr><td>1 M Tris-HCl (Ph 8.0)</td><td>Invitrogen</td><td>15568025</td><td>To make Binding/Wash Buffer</td></tr><tr><td>10&amp;times; Klenow Fragment Buffer&amp;nbsp;</td><td>Takara</td><td>2140A</td><td></td></tr><tr><td>10&amp;times; Taq Buffer</td><td>Tiangen</td><td>ET101-01-01</td><td></td></tr><tr><td>5 M NaCl</td><td>Invitrogen</td><td>AM9659</td><td>To make Binding/Wash Buffer</td></tr><tr><td>BeaverBeads Streptavidin</td><td>Beaver</td><td>22307-1</td><td>1 &amp;mu;m</td></tr><tr><td>BEDTools</td><td></td><td>Software, v2</td><td>https://bedtools.readthedocs.io/en/latest/</td></tr><tr><td>BWA-MEM</td><td></td><td></td><td>Software, v0.7.12</td></tr><tr><td>dNTP Mixture</td><td>Takara</td><td>4030</td><td>2.5 mM each</td></tr><tr><td>Equalbit dsDNA HS Assay Kit</td><td>Vazyme</td><td>EQ111-02</td><td></td></tr><tr><td>fastp</td><td></td><td></td><td>Software</td></tr><tr><td>HiSeq X Ten</td><td>Illumina</td><td>SY-412-1001</td><td>Illumina platform, outsourced to Novogene Corporation (Beijing)</td></tr><tr><td>Klenow Fragment</td><td>Takara</td><td>2140A</td><td></td></tr><tr><td>NovaSeq 6000</td><td>Illumina</td><td>20012850</td><td>Illumina platform, outsourced to Novogene Corporation (Beijing)</td></tr><tr><td>Qubit 3.0 Fluorometer</td><td>ThermoFisher Scientific</td><td>Q33216</td><td></td></tr><tr><td>SICER</td><td></td><td></td><td>Software, v1.1</td></tr><tr><td>Taq DNA Polymerase</td><td>Tiangen</td><td>ET101-01-01</td><td></td></tr><tr><td>Tween-20</td><td>HuShi</td><td>30189328</td><td>To make Binding/Wash Buffer</td></tr><tr><td>UltraPure Distilled Water</td><td>Invitrogen</td><td>10977015</td><td></td></tr><tr><td>VAHTS DNA Clean Beads</td><td>Vazyme</td><td>N411-01</td><td></td></tr></tbody></table>

identification of functionally-relevant lentivirus integration sites in an insertional mutagenesis cell library

The extent of functional sequences within the human genome is a pivotal yet debated topic in biology. Although high-throughput reverse genetic screens have made strides in exploring this, they often limit their scope to known genomic elements and may introduce non-specific effects. This underscores the urgent need for novel functional genomics tools that enable a deeper, unbiased understanding of genome functionality. This protocol introduces the Insertion-based Screen for functional Elements and Transcripts (InSET), a method for identifying lentivirus integration sites within a lentivirus-based insertional mutagenesis cell library. InSET facilitates the capture of genome-wide lentiviral integration sites, with next-generation sequencing used to detect and quantify flanking sequences. InSET's design enables the analysis of integration site abundance variations in phenotypic screens on a large scale, establishing it as a robust tool for forward genetics and for identifying functional genomic elements. A key benefit of InSET is its capacity to reveal previously unidentified genomic elements, including novel functional exons of both protein-coding and non-coding RNAs, independent of prior annotation. Overall, InSET holds significant value in studying the intricate complexity of the human genome and transcriptome, where many genomic elements await functional characterization.

Quality control assessment of an NGS library, typically performed by the sequencing provider, serves as the standard quality check before sequencing. To demonstrate the impact of library quality, two samples were compared. The high-quality library, labeled s2-20-15, was prepared using the standard nested PCR protocol, consisting of two sequential amplification steps: the first with 20 cycles, followed by the second with 15 cycles. In contrast, the low-quality library, labeled s1-30, was prepared using a single-step PCR w...

Identification of Functionally-Relevant Lentivirus Integration Sites in an Insertional Mutagenesis Cell Library

Insertional mutagenesis is an essential tool in forward genetics for identifying functional genomic elements. Here, we describe the Insertion-based Screen for functional Elements and Transcripts (InSET), a method for detecting lentivirus integration sites within a lentivirus-based insertional mutagenesis cell library.

The extent of functional sequences within the human genome is a pivotal yet debated topic in biology. Although high-throughput reverse genetic screens ...

identification-functionally-relevant-lentivirus-integration-sites-an

Research

JoVE Journal

Genetics

173 Views.  Huaqiao University. Insertional mutagenesis is an essential tool in forward genetics for identifying functional genomic elements. Here, we describe the Insertion-based Screen for functional Elements and Transcripts (InSET), a method for detecting lentivirus integration sites within a lentivirus-based insertional mutagenesis cell library.

Video: Identification of Functionally-Relevant Lentivirus Integration Sites in an Insertional Mutagenesis Cell Library

Optogenetic Random Mutagenesis Using Histone-miniSOG in C. elegans

Forward genetic screening in model organisms is the workhorse to discover functionally important genes and pathways in many biological processes. In most mutagenesis-based screens, researchers have relied on the use of toxic chemicals, carcinogens, or irradiation, which requires designated equipment, safety setup, and/or disposal of hazardous materials. We have developed a simple approach to induce heritable mutations in C. elegans using germline-expressed histone-miniSOG, a light-inducible potent generator of reactive oxygen species. This mutagenesis method is free of toxic chemicals and requires minimal laboratory safety and waste management. The induced DNA modifications include single-nucleotide changes and small deletions, and complement those caused by classical chemical mutagenesis. This methodology can also be used to induce integration of extrachromosomal transgenes. Here, we provide the details of the LED setup and protocols for standard mutagenesis and transgene integration.

Optogenetic Random Mutagenesis Using Histone-miniSOG in C. elegans

Genetically-encoded histone-miniSOG induces genome-wide heritable mutations in a blue&#160;light-dependent manner. This mutagenesis method is simple, fast, free of toxic chemicals, and well-suited for forward genetic screening and transgene integration.

Forward genetic screening in model organisms is the workhorse to discover functionally important genes and pathways in many biological processes. In most ...

Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast

We describe a PCR- and homologous recombination-based system for generating targeted mutations in histone genes in budding yeast cells. The resulting mutant alleles reside at their endogenous genomic sites and no exogenous DNA sequences are left in the genome following the procedure. Since in haploid yeast cells each of the four core histone proteins is encoded by two non-allelic genes with highly homologous open reading frames (ORFs), targeting mutagenesis specifically to one of two genes encoding a particular histone protein can be problematic. The strategy we describe here bypasses this problem by utilizing sequences outside, rather than within, the ORF of the target genes for the homologous recombination step. Another feature of this system is that the regions of DNA driving the homologous recombination steps can be made to be very extensive, thus increasing the likelihood of successful integration events. These features make this strategy particularly well-suited for histone gene mutagenesis, but can also be adapted for mutagenesis of other genes in the yeast genome.

Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast

A strategy for generating mutations in histone genes at their endogenous location in Saccharomyces cerevisiae is presented.

We describe a PCR- and homologous recombination-based system for generating targeted mutations in histone genes in budding yeast cells. The resulting ...

Bidirectional Retroviral Integration Site PCR Methodology and Quantitative Data Analysis Workflow

Integration Site (IS) assays are a critical component of the study of retroviral integration sites and their biological significance. In recent retroviral gene therapy studies, IS assays, in combination with next-generation sequencing, have been used as a cell-tracking tool to characterize clonal stem cell populations sharing the same IS. For the accurate comparison of repopulating stem cell clones within and across different samples, the detection sensitivity, data reproducibility, and high-throughput capacity of the assay are among the most important assay qualities. This work provides a detailed protocol and data analysis workflow for bidirectional IS analysis. The bidirectional assay can simultaneously sequence both upstream and downstream vector-host junctions. Compared to conventional unidirectional IS sequencing approaches, the bidirectional approach significantly improves IS detection rates and the characterization of integration events at both ends of the target DNA. The data analysis pipeline described here accurately identifies and enumerates identical IS sequences through multiple steps of comparison that map IS sequences onto the reference genome and determine sequencing errors. Using an optimized assay procedure, we have recently published the detailed repopulation patterns of thousands of Hematopoietic Stem Cell (HSC) clones following transplant in rhesus macaques, demonstrating for the first time the precise time point of HSC repopulation and the functional heterogeneity of HSCs in the primate system. The following protocol describes the step-by-step experimental procedure and data analysis workflow that accurately identifies and quantifies identical IS sequences.

This manuscript describes the experimental procedure and software analysis for a bidirectional integration site assay that can simultaneously analyze upstream and downstream vector-host junction DNA. Bidirectional PCR products can be used for any downstream sequencing platform. The resulting data are useful for a high-throughput, quantitative comparison of integrated DNA targets.

Integration Site (IS) assays are a critical component of the study of retroviral integration sites and their biological significance. In recent retroviral ...

Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions

Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV integration sites can be used as functional markers of active regulatory elements. Here, we present a retroviral scanning tool, which allows the genome-wide identification of cell-specific enhancers and promoters. Briefly, the target cell population is transduced with an mLV-derived vector and genomic DNA is digested with a frequently cutting restriction enzyme. After ligation of genomic fragments with a compatible DNA linker, linker-mediated polymerase chain reaction (LM-PCR) allows the amplification of the virus-host genome junctions. Massive sequencing of the amplicons is used to define the mLV integration profile genome-wide. Finally, clusters of recurrent integrations are defined to identify cell-specific regulatory regions, responsible for the activation of cell-type specific transcriptional programs.
The retroviral scanning tool allows the genome-wide identification of cell-specific promoters and enhancers in prospectively isolated target cell populations. Notably, retroviral scanning represents an instrumental technique for the retrospective identification of rare populations (e.g. somatic stem cells) that lack robust markers for prospective isolation.

Here, we describe a protocol for genome-wide mapping of the integration sites of Moloney murine leukemia virus-based retroviral vectors in human cells.

Moloney murine leukemia (MLV) virus-based retroviral vectors integrate predominantly in acetylated enhancers and promoters. For this reason, mLV ...

A Universal Protocol for Large-scale gRNA Library Production from any DNA Source

The popularity of the CRISPR/Cas9 system for both genome and epigenome engineering stems from its simplicity and adaptability. An effector (the Cas9 nuclease or a nuclease-dead dCas9 fusion protein) is targeted to a specific site in the genome by a small synthetic RNA known as the guide RNA, or gRNA. The bipartite nature of the CRISPR system enables its use in screening approaches since plasmid libraries containing expression cassettes of thousands of individual gRNAs can be used to interrogate many different sites in a single experiment. 
To date, gRNA sequences for the construction of libraries have been almost exclusively generated by oligonucleotide synthesis, which limits the achievable complexity of sequences in the library and is relatively cost-intensive. Here, a detailed protocol for CORALINA (comprehensive gRNA library generation through controlled nuclease activity), a simple and cost-effective method for the generation of highly complex gRNA libraries based on enzymatic digestion of input DNA, is described. Since CORALINA libraries can be generated from any source of DNA, plenty of options for customization exist, enabling a large variety of CRISPR-based screens.

Methods for generating large-scale gRNA libraries should be simple, efficient and cost-effective. We describe a protocol for the production of gRNA libraries based on enzymatic digestion of target DNA. This method, CORALINA (comprehensive gRNA library generation through controlled nuclease activity) presents an alternative to costly custom oligonucleotide synthesis.

The popularity of the CRISPR/Cas9 system for both genome and epigenome engineering stems from its simplicity and adaptability. An effector (the Cas9 ...

CRISPR/Cas9-mediated Targeted Integration In Vivo Using a Homology-mediated End Joining-based Strategy

As a promising genome editing platform, the CRISPR/Cas9 system has great potential for efficient genetic manipulation, especially for targeted integration of transgenes. However, due to the low efficiency of homologous recombination (HR) and various indel mutations of non-homologous end joining (NHEJ)-based strategies in non-dividing cells, in vivo genome editing remains a great challenge. Here, we describe a homology-mediated end joining (HMEJ)-based CRISPR/Cas9 system for efficient in vivo precise targeted integration. In this system, the targeted genome and the donor vector containing homology arms (~800 bp) flanked by single guide RNA (sgRNA) target sequences are cleaved by CRISPR/Cas9. This HMEJ-based strategy achieves efficient transgene integration in mouse zygotes, as well as in hepatocytes in vivo. Moreover, a HMEJ-based strategy offers an efficient approach for correction of fumarylacetoacetate hydrolase (Fah) mutation in the hepatocytes and rescues Fah-deficiency induced liver failure mice. Taken together, focusing on targeted integration, this HMEJ-based strategy provides a promising tool for a variety of applications, including generation of genetically modified animal models and targeted gene therapies.

CRISPR/Cas9-mediated Targeted Integration In Vivo Using a Homology-mediated End Joining-based Strategy

The clustered regularly interspaced short palindromic repeats/CRISPR associated protein 9 (CRISPR/Cas9) system provides a promising tool for genetic engineering, and opens up the possibility of targeted integration of transgenes. We describe a homology-mediated end joining (HMEJ)-based strategy for efficient DNA targeted integration in vivo and targeted gene therapies using CRISPR/Cas9.

As a promising genome editing platform, the CRISPR/Cas9 system has great potential for efficient genetic manipulation, especially for targeted integration ...

A Protocol for the Production of Integrase-deficient Lentiviral Vectors for CRISPR/Cas9-mediated Gene Knockout in Dividing Cells

Lentiviral vectors are an ideal choice for delivering gene-editing components to cells due to their capacity for stably transducing a broad range of cells and mediating high levels of gene expression. However, their ability to integrate into the host cell genome enhances the risk of insertional mutagenicity and thus raises safety concerns and limits their usage in clinical settings. Further, the persistent expression of gene-editing components delivered by these integration-competent lentiviral vectors (ICLVs) increases the probability of promiscuous gene targeting. As an alternative, a new generation of integrase-deficient lentiviral vectors (IDLVs) has been developed that addresses many of these concerns. Here the production protocol of a new and improved IDLV platform for CRISPR-mediated gene editing and list the steps involved in the purification and concentration of such vectors is described and their transduction and gene-editing efficiency using HEK-293T cells was demonstrated. This protocol is easily scalable and can be used to generate high titer IDLVs that are capable of transducing cells in vitro and in vivo. Moreover, this protocol can be easily adapted for the production of ICLVs.

We describe the production strategy of integrase-deficient lentiviral vectors (IDLVs) as vehicles for delivering CRISPR/Cas9 to cells. With an ability to mediate quick and robust gene editing in cells, IDLVs present a safer and equally effective vector platform for gene delivery compared to integrase-competent vectors.

Lentiviral vectors are an ideal choice for delivering gene-editing components to cells due to their capacity for stably transducing a broad range of cells ...

Profiling DNA Replication Timing Using Zebrafish as an In Vivo Model System

DNA replication timing is an important cellular characteristic, exhibiting significant relationships with chromatin structure, transcription, and DNA mutation rates. Changes in replication timing occur during development and in cancer, but the role replication timing plays in development and disease is not known. Zebrafish were recently established as an in vivo model system to study replication timing. Here is detailed the protocols for using the zebrafish to determine DNA replication timing. After sorting cells from embryos and adult zebrafish, high-resolution genome-wide DNA replication timing patterns can be constructed by determining changes in DNA copy number through analysis of next generation sequencing data. The zebrafish model system allows for evaluation of the replication timing changes that occur in vivo throughout development, and can also be used to assess changes in individual cell types, disease models, or mutant lines. These methods will enable studies investigating the mechanisms and determinants of replication timing establishment and maintenance during development, the role replication timing plays in mutations and tumorigenesis, and the effects of perturbing replication timing on development and disease.

Profiling DNA Replication Timing Using Zebrafish as an In Vivo Model System

Zebrafish were recently used as an in vivo model system to study DNA replication timing during development. Here is detailed the protocols for using zebrafish embryos to profile replication timing. This protocol can be easily adapted to study replication timing in mutants, individual cell types, disease models, and other species.

DNA replication timing is an important cellular characteristic, exhibiting significant relationships with chromatin structure, transcription, and DNA ...

CRISPR-Cas9-based Genome Engineering to Generate Jurkat Reporter Models for HIV-1 Infection with Selected Proviral Integration Sites

Human immunodeficiency virus (HIV) integrates its proviral DNA non-randomly into the host cell genome at recurrent sites and genomic hotspots. Here we present a detailed protocol for the generation of novel in vitro models for HIV infection with chosen genomic integration sites using CRISPR-Cas9-based genome engineering technology. With this method, a reporter sequence of choice can be integrated into a targeted, chosen genomic locus, reflecting clinically relevant integration sites.
In the protocol, the design of an HIV-derived reporter and choosing of a target site and gRNA sequence are described. A targeting vector with homology arms is constructed and transfected into Jurkat T cells. The reporter sequence is targeted to the selected genomic site by homologous recombination facilitated by a Cas9-mediated double-strand break at the target site. Single-cell clones are generated and screened for targeting events by flow cytometry and PCR. Selected clones are then expanded, and correct targeting is verified by PCR, sequencing, and Southern blotting. Potential off-target events of CRISPR-Cas9-mediated genome engineering are analyzed.
By using this protocol, novel cell culture systems that model HIV infection at clinically relevant integration sites can be generated. Although the generation of single-cell clones and verification of correct reporter sequence integration is time-consuming, the resulting clonal lines are powerful tools to functionally analyze proviral integration site choice.

We present a genome engineering workflow for the generation of new in vitro models for HIV-1 infection that recapitulate proviral integration at selected genomic sites. Targeting of HIV-derived reporters is facilitated by CRISPR-Cas9-mediated, site-specific genome manipulation. Detailed protocols for single-cell clone generation, screening, and correct targeting verification are provided.

Human immunodeficiency virus (HIV) integrates its proviral DNA non-randomly into the host cell genome at recurrent sites and genomic hotspots. Here we ...

Immunology and Infection

Amplification, Next-generation Sequencing, and Genomic DNA Mapping of Retroviral Integration Sites

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of diverse libraries of retroviral integration sites using ligation-mediated PCR (LM-PCR) amplification and next-generation sequencing (NGS), (2) mapping the genomic location of each virus-host junction using BEDTools, and (3) analyzing the data for statistical relevance. Genomic DNA extracted from infected cells is fragmented by digestion with restriction enzymes or by sonication. After suitable DNA end-repair, double-stranded linkers are ligated onto the DNA ends, and semi-nested PCR is conducted using primers complementary to both the long terminal repeat (LTR) end of the virus and the ligated linker DNA. The PCR primers carry sequences required for DNA clustering during NGS, negating the requirement for separate adapter ligation. Quality control (QC) is conducted to assess DNA fragment size distribution and adapter DNA incorporation prior to NGS. Sequence output files are filtered for LTR-containing reads, and the sequences defining the LTR and the linker are cropped away. Trimmed host cell sequences are mapped to a reference genome using BLAT and are filtered for minimally 97% identity to a unique point in the reference genome. Unique integration sites are scrutinized for adjacent nucleotide (nt) sequence and distribution relative to various genomic features. Using this protocol, integration site libraries of high complexity can be constructed from genomic DNA in three days. The entire protocol that encompasses exogenous viral infection of susceptible tissue culture cells to integration site analysis can therefore be conducted in approximately one to two weeks. Recent applications of this technology pertain to longitudinal analysis of integration sites from HIV-infected patients.

We describe a protocol for amplifying retroviral integration sites from the genomic DNA of infected cells, sequencing the amplified virus-host junctions, and then mapping these sequences to a reference genome. We also describe techniques to quantify the distribution of integration sites relative to various genomic annotations using BEDTools.

Retroviruses exhibit signature integration preferences on both the local and global scales. Here, we present a detailed protocol for (1) generation of ...

Identification of Functionally-Relevant Lentivirus Integration Sites in an Insertional Mutagenesis Cell Library

Summary

Explore More Videos

Chapters in this video

Optogenetic Random Mutagenesis Using Histone-miniSOG in C. elegans

Targeted in Situ Mutagenesis of Histone Genes in Budding Yeast

Bidirectional Retroviral Integration Site PCR Methodology and Quantitative Data Analysis Workflow

Retroviral Scanning: Mapping MLV Integration Sites to Define Cell-specific Regulatory Regions

A Universal Protocol for Large-scale gRNA Library Production from any DNA Source

CRISPR/Cas9-mediated Targeted Integration In Vivo Using a Homology-mediated End Joining-based Strategy

A Protocol for the Production of Integrase-deficient Lentiviral Vectors for CRISPR/Cas9-mediated Gene Knockout in Dividing Cells

Profiling DNA Replication Timing Using Zebrafish as an In Vivo Model System

CRISPR-Cas9-based Genome Engineering to Generate Jurkat Reporter Models for HIV-1 Infection with Selected Proviral Integration Sites

Amplification, Next-generation Sequencing, and Genomic DNA Mapping of Retroviral Integration Sites