This work was supported by grants from CONACyT-SEP (SEP-2008-84582; CB-2011-01-168497) and Promep-SEP for R.A.G.; P.H. received a scholarship from CONACyT (447442).

1. HFF Zellkultur und Ad-Infektion <ol><li> Ausbreiten Ad5 Virus in Monoschichten von HEK-293 Zellen und Titer als fluoreszierende bildenden Einheiten (FFU) auf HFF-Zellen, wie zuvor. 8 beschrieben </li><li> Wachsen Menschliche Vorhautfibroblasten (HFF) in 10 ml DMEM / 10% fötales Rinderserum (FBS) in sterile Kulturschalen von 100 mm bei 37 ° C und 5% CO 2 in einem befeuchteten Inkubator. Bestimmen Sie die Zellzahl unter Verwendung einer Neubauer Kammer durch Zählen der Zellen in den vier 16-Quadratmeter-Sets. Die Zellzahl pro ml wird durch Berechnen der Anzahl der Zellen in den vier 16-Quadrat-Sets und Multiplizieren dieser Zahl mit 10 4 erhalten. Für jeden Zeit nach der Infektion in Schritt 1.3 verwendet, so führen 1 x 10 7 HFF-Zellen. </li><li> Mock-Infektion oder infizieren HFF-Zellen mit Adenovirus Typ 5 (Ad5) Wildtyp (WT) (H5pg4100 8) in 100 mm Gewebekulturschalen mit 1 ml von Ad5 in DMEM pro Schale bei einer MOI von 30 Fokus Erzeugungseinheit oder FFU pro Zelle. Inkubieren für 2 Stunden in ahumidified Zellkulturbrutschrank bei 37 ° C und 5% CO 2, sorgfältig rockt die Gerichte alle 15 Minuten, um eine homogene Verteilung des Virusinokulum über die Zellen zu gewährleisten. Nach dieser Zeit, entfernen Sie das Medium und fügen Sie frisches DMEM mit 10% FBS und Inkubation für 16, 24 oder 36 Stunden in einem befeuchteten Zellkulturbrutschrank bei 37 ° C und 5% CO 2. Fahren Sie mit Schritt 2.1. </li></ol> 2. Herstellung von Sub-Kern Fraktionen mit Adenovirus RC Angereichert <ol><li> Ernte-Ad5-infizierte oder scheininfizierte HFF-Zellen mit einem Zell scrapper und sammeln die Zellen in sterile Zentrifugenröhrchen. Bestimmen Sie die Anzahl der Zellen, wie in Schritt 1.2. Verwenden 1 x 10 7 Zellen für jede Zeit nach der Infektion in Schritt 1.3 angegeben. </li><li> Zentrifugieren Sie die Zellen bei 220 × g, 4 ° C für 5 min. </li><li> Zellpellet in eiskaltem PBS (137 mM NaCl, 2,7 mM KCl, 10 mM Na 2 HPO 4 und 1,8 mM KH 2 PO 4). Wash Zellpellets 3 mal mit 5 ml eiskaltem PBS pro Waschgang. Zu diesem Zweck Zentrifuge die Zellen bei 220 × g, 4 ° C für 5 min, dekantieren und den Überstand verwerfen (SN) und Zellpellet durch vorsichtiges Pipettieren. </li><li> An der Plasmamembran zu stören, Zellpellet in 700 ul eiskaltem hypotonischen Puffer (10 mM HEPES pH 7,9, 10 mM KCl, 1,5 mM MgCl 2, 0,5 mM DTT, 20 μ g / ml Phenylmethylsulfonylfluorid (PMSF) eine Mischung aus Cystein, Serin, Threonin und Aspartylproteasehemmstoffen einschließlich 10 μ g / ml Rinderpankreas-Trypsininhibitor, 10 μ g / ml Pepstatin A und 10 μ g / ml N-Acetyl-L-Leucyl-L-Leucyl-L -argininal) und lassen Sie die Zellen schwellen auf Eis für 3 Stunden. </li><li> Lyse der Zellen unter Verwendung eines Homogenisators mit einem locker sitzende A-Typ Teflonpistill. Führen Sie 80 Dounce Schlaganfälle und Monitorproben alle 20 Hübe von Hellfeld-Mikroskopie, um sicherzustellen, dass alle Zellen lysiert worden sind, aber das Kerne not beschädigt oder zerrissen. </li><li> Zentrifugieren Sie die Zellhomogenat bei 300 × g, 4 ° C für 5 min. Lagern Sie den SN als cytoplasmatische Fraktion bei -20 ºC in einem Zentrifugenröhrchen. </li><li> Um Zelltrümmer aus Keimen in 750 μ l der Lösung 1 (S1) (zu entfernen, das Pellet 0,25 M Saccharose, 10 mM MgCl 2 20 μ g / ml PMSF, eine Mischung aus Cystein, Serin, Threonin und Aspartyl-Protease-Inhibitoren einschließlich 10 μ g / ml Rinderpankreas-Trypsininhibitor, 10 μ g / ml Pepstatin A und 10 μ g / ml N-Acetyl-L-Leucyl-L-Leucyl-L-argininal) und die Schicht über ein gleiches Volumen der Lösung 2 (S2) (0,35 M Saccharose, 0,5 mM MgCl 2, 20 μ g / ml PMSF, eine Mischung aus Cystein, Serin, Threonin und Aspartyl-Protease-Inhibitoren einschließlich 10 μ g / ml Rinderpankreas-Trypsininhibitor, 10 μ g / ml Pepstatin A und 10 μ g / ml N-Acetyl-L-Leucyl-L-Leucyl-L-argininal). Centrifuge bei 1.400 × g, 4 ° C für 5 min. </li><li> Entsorgen Sie die SN mit einer Mikropipette. Vermeiden Sie das Pellet aufzurühren. </li><li> Das Pellet enthält isolierten Zellkernen in 750 μ l S2. </li><li> Um subnuclear Fraktionen mit Adenovirus RC (RCF) angereichert zu isolieren, beschallen resuspendiert Kerne mit einem Ultraschallbad, mit Hilfe von zwei 5 min Impulse, oder bis alle Kerne werden lysiert, wie durch Hellfeldmikroskopie beobachtet. Gebraucheissätze in Ultraschallbad wie notwendig, um Proben, die bei oder unter 4 ° C zu halten. </li><li> Schichten beschallt Kernen über einem gleichen Volumen der Lösung 3 (S3) (0,88 M Saccharose, 0,5 mM MgCl 2) und Zentrifuge bei 3.000 x g, 4 ° C für 10 min. Bewahren Sie die 1,5 ml Überstand als nukleoplasmatischen Fraktion (NPL) bei -70 ºC. Das Pellet in 700 μ l S2 und speichern als RCF bei -70 ºC. </li></ol> 3. Western-Blot-Analysen der RCF HINWEIS: Western-Blot-Analyse der Npl und RCF Fraktionen set Seite 640 &amp; mgr; l für Npl und 300 μ l RCF aus dem in Stufe 2.11 erhaltenen Gesamtvolumens. <ol><li> Mix 15 μ l jeder subnuclear Fraktion in Laemmli-Puffer 2x (4% SDS, 20% Glycerin, 10% 2-Mercaptoethanol, 0,004% Bromphenolblau, 0,125 M Tris HCl pH 6,8) und Kochen bei 95 ºC für 5 min. Laden der Proben in einem 10% Natriumdodecylsulfat-Polyacrylamid-Gelelektrophorese (SDS-PAGE) Denaturierungsgel und separaten Proteinen für 1,5 h bei 20 Milliampere (mA). </li><li> Transferproteine ​​durch Elektroblotting für 1,5 h bei 400 mA auf Polyvinylidendifluorid (PVDF) -Membranen. </li><li> Block Membran für 2 Stunden bei RT mit 3% fettfreier Trockenmilch in PBS. </li><li> Inkubieren O / N bei 4 ºC mit dem primären Antikörper gegen virale E2A DNA-bindendes Protein (B6-8 9) bei einer 1: 500-Verdünnung in PBS / 0,3% fettfreier Trockenmilch. </li><li> Waschen der Membran 3 mal mit PBS / 0,1% Tween 20 für 10 min. </li><li> Inkubieren Sie die Membran mit Maus-anti-IgG-Sekundär ein10.000-Verdünnung in PBS für 2 h bei RT: tibody bei einer 1 bis Meerrettichperoxidase (HRP) gekoppelt. </li><li> 3 mal für 10 min Waschen der Membran mit PBS / 0,1% Tween 20. </li><li> Entwickeln Sie die Membran unter Verwendung verstärkter Chemilumineszenz und Röntgenfilme. </li></ol> 4. Virale DNA-Nachweis in RCF HINWEIS: DNA-Isolierung aus beiden Npl und RCF Fraktionen, verwenden Sie 210 μ l für Npl und 100 μ l für RCF des in Stufe 2.11 erhaltenen Gesamtvolumen. <ol><li> Inkubieren subnuklearer Fraktionen für 1 h bei 55 ° C mit 1 mg / ml Proteinase K und 0,5% Tween 20. </li><li> Proteinase K inaktiviert durch Inkubation der Proben für 10 min bei 95 ° C. </li><li> Zentrifugieren Sie die Probe bei 20000 · g, bei Raumtemperatur für 2 min. </li><li> Sammeln Sie die SN. Ausfällung der DNA mit 1/10 Volumen 3 M Natriumacetat und einem Volumen Isopropanol, O / N bei 4 ° C. </li><li> Zentrifugieren der Proben bei 20.000 xg bei RT für 10 min. </li><li> Entsorgen Sie die SN usingen ein Mikropipette. Bei 20000 × g, 4 ° C für 5 min Waschen des Pellets mit 70% Ethanol und zentrifugiert. </li><li> Resuspendieren der DNA in 10 μ l 10 mM Tris-HCl pH 7,4 </li><li> Quantifizierung DNA unter Verwendung eines Spektrophotometers durch Messung der optischen Dichte (OD) bei 260 nm. </li><li> Zur Amplifikation viraler DNA, verwenden 100 ng DNA aus jedem subnuclear Fraktion in einer Standard-PCR-Reaktion unter Verwendung von Taq-DNA-Polymerase in 25 μ l-Reaktionsvolumen mit Primern, die die Amplifikation einer Region innerhalb des hauptsächlichen späten Transkriptionseinheit zu ermöglichen, von Nucleotid 7273 bis Nukleotid 7353 (81 bp) (Fw: GAGCGAGGTGTGGGTGAGC; Rv: GGATGCGACGACACTGACTTCA). Verwenden Sie die folgenden Zyklusbedingungen: Initiale Denaturierung für 3 min bei 95 ° C, gefolgt von 20 Amplifikationszyklen (1 min bei 95 ° C, Annealing für 1 min bei 62 ° C und Verlängerung für 30 Sekunden bei 72 ° C) und einem abschließenden Verlängerungsschritt für 3 min bei 72 ° C. </li><li> Führen Sie das PCR-Produkt in 2% Agarose-Gelen, bei 90 V. Stain mit EthidiumBromid bei 0,5 μ g / ml Endkonzentration und visualisieren DNA, virale DNA-Anreicherung in der RCF mauern. Griff Ethidiumbromid mit äußerster Vorsicht und immer darauf achten, Handschuhe zu tragen, da diese Verbindung ist ein potenter mutagen. Entsorgen Ethidiumbromid gemäß gültiger Richtlinien. </li></ol> 5. späten viralen mRNA-Nachweis in RCF HINWEIS: Für die RNA-Isolierung aus beiden Npl und RCF Fraktionen, verwenden Sie 640 μ l für Npl und 300 μ l für RCF aus dem in Stufe 2.11 erhaltenen Gesamtvolumen. <ol><li> Isolieren von RNA aus subnuclear Fraktionen unter Verwendung von Trizol nach den Herstelleranweisungen. Resuspendieren RNA in 50 μ l DEPC (diethilpyrocarbonate) behandelten Wasser. </li><li> Quantifizierung der RNA mit einem Spektralphotometer, um die OD bei 260 nm messen (ca. 3 μ g erhalten). Bewahren Sie die RNA in 50 ng / &amp; mgr; l-Aliquots bei -70 ºC. </li><li> Überprüfen gereinigte RNAdie Abwesenheit von DNA-Kontamination durch Durchführung einer PCR-Kontrollreaktion in Abwesenheit von reverser Transkriptase (RT) unter Verwendung von 5 ng Gesamt-RNA und die in Schritt 4.9 beschriebenen Zyklusbedingungen. <ol><li> Wenn DNA-Kontamination fehlt kein Amplikon sollte hergestellt werden. Wenn DNA-Kontamination vorhanden ist, läßt man die Proben mit 10 U DNase I, 10 U RNase-Inhibitor, 0.1 M Tris-HCl pH 8,3, 0,5 M KCl und 15 mM MgCl2 30 Minuten bei 37 ºC. Gehen Sie erneut zu isolieren RNA, wie in Schritt 5.1. </li></ol></li><li> Virale mRNA zu RCF zugeordnet analysieren, verstärken 100 ng RNA aus jeder subnuclear Fraktion durch RT-PCR unter Verwendung von Primern, um adenoviralen späten mRNA aus verschiedenen Genfamilien (Tabelle 1) zu detektieren. <ol><li> Für die reverse Transkription (RT), Verwenden von 100 ng RNA, die voneinander subnuclear Fraktion in einem Standard-RT-Reaktion unter Verwendung von M-MuLV RT-Enzym in 20 μ l Reaktionsvolumen 1 h bei 42 ºC und 10 min bei 70 ºC. </li><li> Zur Verstärkung, benutzen 1μ l der cDNA in der PCR-Reaktionen, wie in Schritt 4.9. Mithilfe der folgenden Zyklusbedingungen: Initiale Denaturierung für 3 min bei 95 ºC, gefolgt von 25 Zyklen der Amplifizierung (1 min bei 95 ºC, Annealing für 1 min bei der in Tabelle 1 und Erweiterung angegeben für 30 Sekunden bei 72 ºC Temperatur) und ein abschließenden Extensionsschritt für 3 min bei 72 ºC. </li></ol></li><li> Führen Sie die RT-PCR-Produkte in 2% Agarose-Gelen, bei 90 V. Stain Gele mit Ethidiumbromid bei 0,5 μ g / ml Endkonzentration und zu visualisieren, um Viren späten mRNA-Assoziation mit dem RCF mauern. Griff Ethidiumbromid wie in Schritt 4.10 angegeben. </li></ol> 6. Immunfluoreszenz Visualisierung von RCF HINWEIS: Carry-out dieses Verfahren unter einer Sterilbank, um eine Kontamination der Proben zu vermeiden, mit jedem Staubpartikel und alle Lösungen auswählen, vor dem Gebrauch. <ol><li> Spot 5 ul der in Schritt 2.10 dire erhalten RCF Bruchctly auf einem Silan-beschichteten Objektträger. </li><li> Lassen Sie die Stelle trocken für ca. 5 min bei RT. </li><li> Re-Hydrat durch langsam und indirekt Pipettieren von 500 μ l PBS in einem Tropfen neben dem RCF Stelle und lässt sie durch Kippen des Schiebe fließen. Lassen Sie das überschüssige PBS von der Seite. </li><li> Block durch Bedecken der Probe mit 500 μ l PBS / 5% Rinderserumalbumin (BSA) für 2 h bei RT. </li><li> 3 Mal vorsichtig und indirekt Pipettieren von 500 μ l PBS auf die Probe zu waschen der Folie. Neigen Sie den Schieber zum Ableiten des überschüssigen PBS. </li><li> Inkubieren der Probe mit dem primären Antikörper gegen an einer 1-Virus E2A DNA-bindendes Protein (B6-8 9): 500 Verdünnung in PBS für 2 h bei RT. Decken Sie die beschmutzte Probe mit 20 μ l der Antikörperlösung und Inkubation in einer feuchten Kammer, um ein Austrocknen zu verhindern. </li><li> 3 Mal Waschen der Probe mit PBS / 0,02% Tween 20 durch leichtes und indirekt Pipettieren von 500 μ l PBS auf die Probe. Neigen Sie den Schieber, um weg von der ex DrainProzesswaschlösung. </li><li> 2.000 Verdünnung in PBS bei 4 ° C, für 1 h: die Proben mit Maus-anti-IgG-Sekundärantikörper mit einem Fluorophor, das bei 488 nm in einem 1 angeregt wird, gekoppelt zu inkubieren. Decken Sie die beschmutzte Probe mit 20 μ l der Antikörperlösung und Inkubation in einer feuchten Kammer, um ein Austrocknen zu verhindern. </li><li> 3 Mal Waschen der Probe mit PBS / 0,02% Tween 20 durch leichtes und indirekt Pipettieren von 500 μ l PBS auf die Probe. Neigen Sie den Schieber zum Ableiten des überschüssigen Waschlösung. </li><li> Decken Sie die beschmutzte Probe auf dem Objektträger mit einem Deckglas mit 2 μ l PBS / 10% Glycerin als Einschlussmittel. Dichtung mit klarem Nagellack und speichern al -20 ºC. </li><li> Analyse der Proben unter Verwendung eines Fluoreszenzmikroskops mit einem 63x-Objektiv und einem 1,4 numerischen Apertur (NA) bei einer Wellenlänge von 488 nm. </li></ol>

<ol>
	<li>Doucas, V., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+replication+is+coupled+with+the+dynamic+properties+of+the+PML+nuclear+structure.">Adenovirus replication is coupled with the dynamic properties of the PML nuclear structure.</a> Genes &#38; Dev. 10, 196-207 (1996).</li><li>Schmid, M., Speiseder, T., Dobner, T., Gonzalez, R. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=DNA+virus+replication+compartments.">DNA virus replication compartments.</a> J. Virol. 88, 1404-1420 (2014).</li><li>Boon, J. A., Diaz, A., Ahlquist, P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cytoplasmic+viral+replication+complexes.">Cytoplasmic viral replication complexes.</a> Cell host microbe. 8, 77-85 (2010).</li><li>Paul, D., Hoppe, S., Saher, G., Krijnse-Locker, J., Bartenschlager, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Morphological+and+biochemical+characterization+of+the+membranous+hepatitis+C+virus+replication+compartment.">Morphological and biochemical characterization of the membranous hepatitis C virus replication compartment.</a> J. Virol. 87, 10612-10627 (2013).</li><li>Busch, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+Nucleoli.">Isolation of Nucleoli.</a> Exp Cell Res. 24, 150-163 (1963).</li><li>Lam, Y. W., Lyon, C. E., Lamond, A. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Large-scale+isolation+of+Cajal+bodies+from+HeLa+cells.">Large-scale isolation of Cajal bodies from HeLa cells.</a> Mol. Biol. Cell. 13, 2461-2473 (2002).</li><li>Lam, Y. W., Trinkle-Mulcahy, L., Lamond, A. I. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+nucleolus.">The nucleolus.</a> J Cell Sci. 118, 1335-1337 (2005).</li><li>Groitl, P., Dobner, T. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Construction+of+adenovirus+type+5+early+region+1+and+4+virus+mutants.">Construction of adenovirus type 5 early region 1 and 4 virus mutants.</a> Methods Mol Med. 130, 29-39 (2007).</li><li>Reich, N. C., Sarnow, P., Duprey, E., Levine, A. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Monoclonal+antibodies+which+recognize+native+and+denatured+forms+of+the+adenovirus+DNA-binding+protein.">Monoclonal antibodies which recognize native and denatured forms of the adenovirus DNA-binding protein.</a> Virology. 128, 480-484 (1983).</li><li>Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Selective+effects+on+adenovirus+late+gene+expression+of+deleting+the+E1b+55K+protein.">Selective effects on adenovirus late gene expression of deleting the E1b 55K protein.</a> J Gen Virol. 74 (Pt 4), 575-582 (1993).</li><li>Gonzalez, R., Huang, W., Finnen, R., Bragg, C., Flint, S. J. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+E1B+55-kilodalton+protein+is+required+for+both+regulation+of+mRNA+export+and+efficient+entry+into+the+late+phase+of+infection+in+normal+human+fibroblasts.">Adenovirus E1B 55-kilodalton protein is required for both regulation of mRNA export and efficient entry into the late phase of infection in normal human fibroblasts.</a> J. Virol. 80, 964-974 (2006).</li><li>Castillo-Villanueva, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+Mre11+Cellular+Protein+Is+Modified+by+Conjugation+of+Both+SUMO-1+and+SUMO-2/3+during+Adenovirus+Infection.">The Mre11 Cellular Protein Is Modified by Conjugation of Both SUMO-1 and SUMO-2/3 during Adenovirus Infection.</a> ISRN Virology. 2014, 14 (2014).</li><li>Morris, S. J., Scott, G. E., Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus+late-phase+infection+is+controlled+by+a+novel+L4+promoter.">Adenovirus late-phase infection is controlled by a novel L4 promoter.</a> J. Virol. 84, 7096-7104 (2010).</li><li>Wright, J., Leppard, K. N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=The+human+adenovirus+5+L4+promoter+is+activated+by+cellular+stress+response+protein+p53.">The human adenovirus 5 L4 promoter is activated by cellular stress response protein p53.</a> J. Virol. 87, 11617-11625 (2013).</li></ol>

The authors have nothing to disclose.

In order to elucidate the molecular mechanisms that govern regulation of cellular activities by viral infection understanding the composition and activities associated with RC would be instrumental. Therefore, to make a detailed analysis of RC, we established a cell-free system that takes advantage of the size and biochemical composition of these virus-induced structures, to isolate subnuclear fractions enriched with RC using a simple procedure that relies on velocity gradients with sucrose cushions. Critical steps of th...

Adenoviren enthält ein doppelsträngiges DNA-Genom, das in den infizierten Zellkern repliziert. Wenn der Virus-DNA in den Zellkern, lokalisiert es neben PML nuclear bodies 1. Folgende virale frühe Genexpression wird die Kernarchitektur erheblich umstrukturiert Induzieren der Bildung von viralen Mikroumgebungen, bezeichnet als virale Replikation Compartments (RC) 2. Seit Adenovirus (Ad) RC sind Websites, auf denen Virusgenom Replikation und Expression der viralen späten Gene stattfinden, bieten sie eine Umgebung für die Rekrutierung von allen notwendigen viralen und zellulären Faktoren, die in diesen Prozessen zu beteiligen. Interessanterweise eine Vielzahl von zellulären Proteinen für die zelluläre antivirale Reaktion verantwortlich ist, wie das die DNA-Reparatur, die angeborene Immunantwort und Tumorsuppression kooptiert zu diesen viralen Orte 2. Daher kann Ad RC berücksichtigt werden regulatorische Hubs, die effiziente virale Replikation zu fördern, während gleichzeitig die Regulierung derzelluläre antivirale Antwort, die anzeigt, dass diese Strukturen sind der Schlüssel zum Verständnis der Virus-Wirt-Zell-Interaktionen. Dennoch sind die molekularen Mechanismen der RC Bildung, ihrer Zusammensetzung und damit verbundenen Tätigkeiten sind weitgehend unverstanden. Adenoviralen RC sowie RC von anderen DNA-Viren, die im Zellkern repliziert sind nicht auf Membranen cytoplasmatische RC 3 zugeordnet ist, im Gegensatz. Darüber hinaus sind diese virusinduzierten Strukturen wahrscheinlich vollständig von Proteinen und Nukleinsäuren aufgebaut sein. RC in Zellen mit RNA-Viren infiziert gebildet (gewöhnlich als viralen Fabrik) isoliert, unter Ausnutzung ihrer zytoplasmatischen Lokalisation und membrangebundenen Status, der ihre detaillierte morphologische, funktionelle und biochemische Charakterisierung 4 erleichtert hat. Nach unserem Kenntnisstand haben Atom viralen RC nicht isoliert wurden, möglicherweise aufgrund der Komplexität der Kernarchitektur und Abwesenheit der intranukleären membranes, die ihre Isolierung erleichtern würde. Ihre Studie wurde stattdessen auf die Immunfluoreszenzmikroskopie, Fisch und Transmissionselektronenmikroskopie verlassen. Doch trotz Komplikationen inhärenten Isolierung subnuclear Strukturen, andere Kernbereichen wie Kernkörperchen und Cajal Bodies haben, bevor 5,6 isoliert. Da Nucleoli und RC beide aus Proteinen und Nukleinsäuren besteht, und haben einen Durchmesser zwischen 0,5 - 5 um, stellten wir die Hypothese, dass RC auch zugänglich Isolation. Deshalb, um genauer zu charakterisieren, die molekulare Zusammensetzung und Funktionen RC verbunden sind, haben wir eine neuartige Methode, um subnuclear Fraktionen mit RC bereichert zu isolieren. Zu diesem Zweck stellten wir Sub-Kernfraktionen mit Geschwindigkeitsgradienten und Saccharose Kissen ähnlich Verfahren verwendet werden, um Kernkörperchen 7 oder sonstigen Kerndomänen 6 zu isolieren und gründete ein zellfreies System, das die Untersuchung der molekularen Zusammensetzung und die damit verbundenen Tätigkeiten erlaubtRC. Diese Technik ist daher das Verständnis der voran Virus-Wirt-Zell-Wechselwirkungen und ist ein mächtiges Werkzeug, das auch die detaillierte Analyse von RC zu erleichtern, sollte aus anderen Viren, die im Zellkern repliziert und induzieren Bildung replikations Abteile ähnliche Abmessungen wie jene in Adenovirus- gebildet infizierte Zellen, wie Herpesviren, Papillomaviren oder Polyomaviren.

<table border="0">
	<tbody>
		<tr>
			<td>DMEM</td>
			<td>Gibco</td>
			<td>12100-046</td>
			<td>Warm in 37 &#186;C water bath before use</td>
		</tr>
		<tr>
			<td>Fetal Bovine Serum</td>
			<td>Gibco</td>
			<td>12484-028</td>
			<td></td>
		</tr>
		<tr>
			<td>Sucrose, Ultra Pure</td>
			<td>Research Organics</td>
			<td>0928S</td>
			<td>Prepare a 2.55 M stock solution and store at 4 &#186;C</td>
		</tr>
		<tr>
			<td>Dounce homogenizer</td>
			<td>Kontess Glass Company</td>
			<td>884900-0000</td>
			<td></td>
		</tr>
		<tr>
			<td>Branson 1800 Ultrasonic Bath</td>
			<td>Branson</td>
			<td>Z769533&#160;SIGMA</td>
			<td>Turn on 15 min before use.</td>
		</tr>
		<tr>
			<td>Peroxidase AffiniPure F(ab&#39;)&#8322; Fragment Goat Anti-Mouse IgG (H+L)</td>
			<td>Jackson ImmunoResearch</td>
			<td>115-036-003</td>
			<td>Use at a 1:10,000 dilution in PBS/0.03% non-fat milk</td>
		</tr>
		<tr>
			<td>Goat anti-Mouse IgG1 Secondary Antibody, Alexa Fluor 488 conjugate</td>
			<td>Life Technologies</td>
			<td>A-21121</td>
			<td>Use at a 1:2,000 dilution in PBS</td>
		</tr>
		<tr>
			<td>Silane-Prep Slides</td>
			<td>Sigma</td>
			<td>S4651-72EA</td>
			<td>Open in a laminar flow cabinet</td>
		</tr>
		<tr>
			<td>SuperSignal West Pico Chemiluminescent Substrate</td>
			<td>Pierce ThermoScientific</td>
			<td>34080</td>
			<td></td>
		</tr>
	</tbody>
</table>

isolation of viral replication compartment-enriched sub-nuclear fractions from adenovirus-infected normal human cells

During infection of human cells by adenovirus (Ad), the host cell nucleus is dramatically reorganized, leading to formation of nuclear microenvironments through the recruitment of viral and cellular proteins to sites occupied by the viral genome. These sites, called replication compartments (RC), can be considered viral-induced nuclear domains where the viral genome is localized and viral and cellular proteins that participate in replication, transcription and post-transcriptional processing are recruited. Moreover, cellular proteins involved in the antiviral response, such as tumor suppressor proteins, DNA damage response (DDR) components and innate immune response factors are also co-opted to RC. Although RC seem to play a crucial role to promote an efficient and productive replication cycle, a detailed analysis of their composition and associated activities has not been made. To facilitate the study of adenoviral RC and potentially those from other DNA viruses that replicate in the cell nucleus, we adapted a simple procedure based on velocity gradients to isolate Ad RC and established a cell-free system amenable to conduct morphological, functional and compositional studies of these virus-induced subnuclear structures, as well as to study their impact on host-cell interactions.

Da virale Replikation Abteile (RC) sind subnuclear viral induzierten Strukturen von Proteinen und Nukleinsäuren, ähnlich zu anderen Kerndomänen zusammengesetzt, erwiesen sie zugänglich Isolierung zu sein durch Geschwindigkeitsgradienten basierend auf biochemischen Funktionen. Kritischen Schritte bei der Fraktionierung Protokolls sind in Abbildung 1. Bei jedem dargestellten Schritt die Proben müssen durch Hellfeldmikroskopie überwacht, um die Integrität der verschiedenen subzellulären Fraktionen ...

Watch this Scientific Journal Video about Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells at JoVE.com

Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells

We provide a novel strategy to isolate viral replication compartments (RC) from adenovirus (Ad)-infected human cells. This approach represents a cell-free system that can help to elucidate the molecular mechanisms regulating viral genome replication and expression as well as regulation of viral-host interactions established at the RC.

Isolierung der viralen Replikation Compartment angereicherte Teil nuklearen Fraktionen von Adenovirus-infizierten normalen menschlichen Zellen

During infection of human cells by adenovirus (Ad), the host cell nucleus is dramatically reorganized, leading to formation of nuclear microenvironments ...

isolation-viral-replication-compartment-enriched-sub-nuclear

Research

JoVE Journal

Immunology and Infection

8.7K Aufrufe.  Universidad Autónoma del Estado de Morelos. We provide a novel strategy to isolate viral replication compartments (RC) from adenovirus (Ad)-infected human cells. This approach represents a cell-free system that can help to elucidate the molecular mechanisms regulating viral genome replication and expression as well as regulation of viral-host interactions established at the RC. 

Serie: Isolation of Viral Replication Compartment-enriched Sub-nuclear Fractions from Adenovirus-infected Normal Human Cells

Isolation of Fidelity Variants of RNA Viruses and Characterization of Virus Mutation Frequency

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the generation of extreme population diversity that facilitates virus adaptation and evolution. Increasing evidence shows that the intrinsic error rates, and the resulting mutation frequencies, of RNA viruses can be modulated by subtle amino acid changes to the viral polymerase. Although biochemical assays exist for some viral RNA polymerases that permit quantitative measure of incorporation fidelity, here we describe a simple method of measuring mutation frequencies of RNA viruses that has proven to be as accurate as biochemical approaches in identifying fidelity altering mutations. The approach uses conventional virological and sequencing techniques that can be performed in most biology laboratories. Based on our experience with a number of different viruses, we have identified the key steps that must be optimized to increase the likelihood of isolating fidelity variants and generating data of statistical significance. The isolation and characterization of fidelity altering mutations can provide new insights into polymerase structure and function1-3. Furthermore, these fidelity variants can be useful tools in characterizing mechanisms of virus adaptation and evolution4-7.

The present article describes the steps required to isolate and characterize RNA polymerase fidelity variants of RNA viruses and how to use mutation frequency data to confirm fidelity changes in tissue culture.

Isolierung von Fidelity Varianten von RNA-Viren und Charakterisierung von Virus-Mutation Frequency

RNA viruses use RNA dependent RNA polymerases to replicate their genomes. The intrinsically high error rate of these enzymes is a large contributor to the ...

Forschung

Immunologie und Infektion

Preparation of Viral DNA from Nucleocapsids

Viruses are obligate cellular parasites, and thus the study of their DNA requires isolating viral material away from host cell contaminants and DNA. Several downstream applications require large quantities of pure viral DNA, which is provided by this protocol. These applications include viral genome sequencing, where the removal of host DNA is crucial to optimize data output for viral sequences, and the production of new viral recombinant strains, where co-transfection of purified plasmid and linear viral DNA facilitates recombination.1,2,3 
This procedure utilizes a combination of extractions and density-based centrifugation to isolate purified linear herpesvirus nucleocapsid DNA from infected cells.4,5 The initial purification steps aim to isolate purified viral capsids, which contain and protect the viral DNA during the extractions and centrifugation steps that remove cellular proteins and DNA. Lysis of nucleocapsids then releases viral DNA, and two final phenol-chloroform steps remove remaining proteins. The final DNA captured from solution is highly concentrated and pure, with an average OD260/280 of 1.90. Depending on the quantity of infected cells used, yields of viral DNA range from 150-800 &mu;g or more. The purity of this DNA makes it stable during long-term storage at 4C. This DNA is thus ideally suited for high-throughput sequencing, high fidelity PCR reactions, and transfections. 
Prior to beginning the protocol, it is important to know the average number of cells per dish (e.g. an average of 8 x 106 PK-15 cells in a confluent 15 cm dish), and the titer of the viral stock to be used (e.g. 1 x 108 plaque-forming units per ml). These are necessary to calculate the appropriate multiplicity of infection (MOI) for the protocol.6 For instance, to infect one 15 cm dish of PK-15 cells with the above viral stock, at an MOI of 5, you would use 400 &mu;l of viral stock and dilute it with 3.6 ml of medium (total inoculation volume of 4 ml for one 15 cm plate).
Multiple viral DNA preparations can be prepared at the same time. The number of simultaneous preparations is limited only by the number of tubes held by the ultracentrifuge rotor (one per virus; see step 3.9 below). Here we describe the procedure as though being done for one virus.

We describe the process of isolating high purity herpesvirus nucleocapsid DNA from infected cells. The final DNA captured from solution is of high concentration and purity, making it ideally suited for high-throughput sequencing, high fidelity PCR reactions, and transfections to produce new viral recombinants.

Herstellung viraler DNA aus Nukleokapside

Viruses are obligate cellular parasites, and thus the study of their DNA requires isolating viral material away from host cell contaminants and DNA. ...

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The apical and basolateral surfaces of airway epithelial cells demonstrate directional responses to pathogen exposure in vivo. Thus, ideal in vitro models for examining cellular responses to respiratory pathogens polarize, forming apical and basolateral surfaces. One such model is differentiated normal human bronchial epithelial cells (NHBE). However, this system requires lung tissue samples, expertise isolating and culturing epithelial cells from tissue, and time to generate an air-liquid interface culture.
Calu-3 cells, derived from a human bronchial adenocarcinoma, are an alternative model for examining the response of proximal airway epithelial cells to respiratory insult1, pharmacological compounds2-6, and bacterial7-9 and viral pathogens, including influenza virus, rhinovirus and severe acute respiratory syndrome - associated coronavirus10-14. Recently, we demonstrated that Calu-3 cells are susceptible to respiratory syncytial virus (RSV) infection in a manner consistent with NHBE15,16 . Here, we detail the establishment of a polarized, liquid-covered culture (LCC) of Calu-3 cells, focusing on the technical details of growing and culturing Calu-3 cells, maintaining cells that have been cultured into LCC, and we present the method for performing respiratory virus infection of polarized Calu-3 cells.
To consistently obtain polarized Calu-3 LCC, Calu-3 cells must be carefully subcultured before culturing in Transwell inserts. Calu-3 monolayer cultures should remain below 90% confluence, should be subcultured fewer than 10 times from frozen stock, and should regularly be supplied with fresh medium. Once cultured in Transwells, Calu-3 LCC must be handled with care. Irregular media changes and mechanical or physical disruption of the cell layers or plates negatively impact polarization for several hours or days. Polarization is monitored by evaluating trans-epithelial electrical resistance (TEER) and is verified by evaluating the passive equilibration of sodium fluorescein between the apical and basolateral compartments17,18 . Once TEER plateaus at or above 1,000 &Omega;&times;cm2, Calu-3 LCC are ready to use to examine cellular responses to respiratory pathogens.

Establishing a Liquid-covered Culture of Polarized Human Airway Epithelial Calu-3 Cells to Study Host Cell Response to Respiratory Pathogens In vitro

The findings and conclusions in this report are those of the authors and do not necessarily represent the views of the Centers for Disease Control and Prevention.

Aufbau einer Liquid-bedeckten Kultur Polarized Menschliche Airway Epithelial Calu-3-Zellen, um Host-Zell-Antwort, um Atemwegspathogene Studie<em&gt; In-vitro-</em

The  apical and basolateral surfaces of airway epithelial cells demonstrate  directional responses to pathogen exposure in  vivo. Thus, ideal in vitro ...

Isolation of Myeloid Dendritic Cells and Epithelial Cells from Human Thymus

In this protocol we provide a method to isolate dendritic cells (DC) and epithelial cells (TEC) from the human thymus. DC and TEC are the major antigen presenting cell (APC) types found in a normal thymus and it is well established that they play distinct roles during thymic selection. These cells are localized in distinct microenvironments in the thymus and each APC type makes up only a minor population of cells. To further understand the biology of these cell types, characterization of these cell populations is highly desirable but due to their low frequency, isolation of any of these cell types requires an efficient and reproducible procedure. This protocol details a method to obtain cells suitable for characterization of diverse cellular properties. Thymic tissue is mechanically disrupted and after different steps of enzymatic digestion, the resulting cell suspension is enriched using a Percoll density centrifugation step. For isolation of myeloid DC (CD11c+), cells from the low-density fraction (LDF) are immunoselected by magnetic cell sorting. Enrichment of TEC populations (mTEC, cTEC) is achieved by depletion of hematopoietic (CD45hi) cells from the low-density Percoll cell fraction allowing their subsequent isolation via fluorescence activated cell sorting (FACS) using specific cell markers. The isolated cells can be used for different downstream applications.

This protocol details a method to isolate antigen presenting cells from human thymus via different steps of enzymatic digestion of the tissue followed by density centrifugation of the single cell suspension and finally magnetic and/or FACS sorting of the cell populations of interest.

Isolierung von myeloider dendritischer Zellen und Epithelzellen Menschliche Thymus

In this protocol we provide a method to isolate dendritic cells (DC) and epithelial cells (TEC) from the human thymus. DC and TEC are the major antigen ...

Averaging of Viral Envelope Glycoprotein Spikes from Electron Cryotomography Reconstructions using Jsubtomo

Enveloped viruses utilize membrane glycoproteins on their surface to mediate entry into host cells. Three-dimensional structural analysis of these glycoprotein &#8216;spikes&#8217; is often technically challenging but important for understanding viral pathogenesis and in drug design. Here, a protocol is presented for viral spike structure determination through computational averaging of electron cryo-tomography data. Electron cryo-tomography is a technique in electron microscopy used to derive three-dimensional tomographic volume reconstructions, or tomograms, of pleomorphic biological specimens such as membrane viruses in a near-native, frozen-hydrated state. These tomograms reveal structures of interest in three dimensions, albeit at low resolution. Computational averaging of sub-volumes, or sub-tomograms, is necessary to obtain higher resolution detail of repeating structural motifs, such as viral glycoprotein spikes. A detailed computational approach for aligning and averaging sub-tomograms using the Jsubtomo software package is outlined. This approach enables visualization of the structure of viral glycoprotein spikes to a resolution in the range of 20-40 &#197; and study of the study of higher order spike-to-spike interactions on the virion membrane. Typical results are presented for Bunyamwera virus, an enveloped virus from the family Bunyaviridae. This family is a structurally diverse group of pathogens posing a threat to human and animal health.

An approach is presented for determining structures of viral membrane glycoprotein complexes using a combination of electron cryo-tomography and sub-tomogram averaging with the computational package Jsubtomo.

Mittelung der Virushülle Glykoprotein-Spikes von Electron Cryotomography Rekonstruktionen mit Jsubtomo

Enveloped viruses utilize membrane glycoproteins on their surface to mediate entry into host cells. Three-dimensional structural analysis of these ...

Isolation of Leukocytes from the Human Maternal-fetal Interface

Pregnancy is characterized by the infiltration of leukocytes in the reproductive tissues and at the maternal-fetal interface (decidua basalis and decidua parietalis). This interface is the anatomical site of contact between maternal and fetal tissues; therefore, it is an immunological site of action during pregnancy. Infiltrating leukocytes at the maternal-fetal interface play a central role in implantation, pregnancy maintenance, and timing of delivery. Therefore, phenotypic and functional characterizations of these leukocytes will provide insight into the mechanisms that lead to&#160;pregnancy disorders. Several protocols have been described in order to isolate infiltrating leukocytes from the decidua basalis and decidua parietalis; however, the lack of consistency in the reagents, enzymes, and times of incubation makes it difficult to compare these results. Described herein is&#160;a novel approach that combines the use of gentle mechanical and enzymatic dissociation techniques to preserve the viability and integrity of extracellular and intracellular markers in leukocytes isolated from the human tissues at the maternal-fetal interface. Aside from immunophenotyping, cell culture, and cell sorting, the future applications of this protocol are numerous and varied. Following this protocol, the isolated leukocytes can be used to determine DNA methylation, expression of target genes, in vitro leukocyte functionality (i.e., phagocytosis, cytotoxicity, T-cell proliferation, and plasticity, etc.), and the production of reactive oxygen species at the maternal-fetal interface. Additionally, using the described protocol, this laboratory has been able to describe new and rare leukocytes at the maternal-fetal interface.

Described herein is a protocol to isolate and further study the infiltrating leukocytes of the decidua basalis and decidua parietalis - the human maternal-fetal interface. This protocol maintains the integrity of cell surface markers and yields enough viable cells for downstream applications as proven by flow cytometry analysis.

Isolation von Leukozyten aus dem menschlichen Mutter und Fötus-Schnittstelle

Pregnancy is characterized by the infiltration of leukocytes in the reproductive tissues and at the maternal-fetal interface (decidua basalis and decidua ...

Isolation of Sertoli Cells and Peritubular Cells from Rat Testes

The testis, and in particular the male gamete, challenges the immune system in a unique way because differentiated sperm first appear at the time of puberty - more than ten years after the establishment of systemic immune tolerance. Spermatogenic cells express a number of proteins that may be seen as non-self by the immune system. The testis must then be able to establish tolerance to these neo-antigens on the one hand but still be able to protect itself from infections and tumor development on the other hand. Therefore the testis is one of a few immune privileged sites in the body that tolerate foreign antigens without evoking a detrimental inflammatory immune response. Sertoli cells play a key role for the maintenance of this immune privileged environment of the testis and also prolong survival of cotransplanted cells in a foreign environment. Therefore primary Sertoli cells are an important tool for studying the immune privilege of the testis that cannot be easily replaced by established cell lines or other cellular models. Here we present a detailed and comprehensive protocol for the isolation of Sertoli cells - and peritubular cells if desired - from rat testes within a single day.

Primary Sertoli cells are required for studying testis-immune privilege, signal transduction during inflammation or infection, and utilization of their immunoprotective properties. Here we describe an enzyme-based protocol for the isolation of highly purified primary Sertoli cells and peritubular cells from rat testes.

Isolierung von Sertoli-Zellen und peritubulären Zellen aus Ratte Hoden

The testis, and in particular the male gamete, challenges the immune system in a unique way because differentiated sperm first appear at the time of ...

Swab Sampling Method for the Detection of Human Norovirus on Surfaces

Human noroviruses are a leading cause of epidemic and sporadic gastroenteritis worldwide. Because most infections are either spread directly via the person-to-person route or indirectly through environmental surfaces or food, contaminated fomites and inanimate surfaces are important vehicles for the spread of the virus during norovirus outbreaks.
We developed and evaluated a protocol using macrofoam swabs for the detection and typing of human noroviruses from hard surfaces. Compared with fiber-tipped swabs or antistatic wipes, macrofoam swabs allow virus recovery (range 1.2-33.6%) from toilet seat surfaces of up to 700 cm2. The protocol includes steps for the extraction of the virus from the swabs and further concentration of the viral RNA using spin columns. In total, 127 (58.5%) of 217 swab samples that had been collected from surfaces in cruise ships and long-term care facilities where norovirus gastroenteritis had been reported tested positive for GII norovirus by RT-qPCR. Of these 29 (22.8%) could be successfully genotyped. In conclusion, detection of norovirus on environmental surfaces using the protocol we developed may assist in determining the level of environmental contamination during outbreaks as well as detection of virus when clinical samples are not available; it may also facilitate monitoring of effectiveness of remediation strategies.

A macrofoam based sampling methodology was developed and evaluated for the detection and quantification of norovirus on environmental hard surfaces.

Swab Sampling Verfahren zum Nachweis von humanem Norovirus auf Oberflächen

Human noroviruses are a leading cause of epidemic and sporadic gastroenteritis worldwide. Because most infections are either spread directly via the ...

Isolation of Dendritic Cells from the Human Female Reproductive Tract for Phenotypical and Functional Studies

The characterization of the human dendritic cells (DCs) resident in mucosal tissues is challenging due to the difficulty in obtaining samples, and the low numbers of DCs present per tissue. Yet, as the phenotype and function of DCs is modified by the tissue environment, it is necessary to analyze tissue resident DC populations, since blood derived DCs incompletely reflect the complexities of DCs in tissues. Here we present a protocol to isolate DCs from the human female reproductive tract (FRT) using hysterectomy specimens that allows both phenotypical and functional analyses. The protocol consists of tissue digestion to generate a single cell mixed cell suspension, followed by positive magnetic bead selection. Our tissue digestion protocol does not cleave surface markers, which allows phenotypical and functional analysis of DCs in the steady state, without overnight incubation or cell activation. This protocol can be adapted for the isolation of other immune cell types or isolation of DCs from other tissues.

We describe here a method to isolate and purify dendritic cells from different anatomical compartments in the human female reproductive tract for the evaluation of their phenotypical and functional characteristics. This method can be adapted to isolate other immune cells or dendritic cells from other mucosal tissues.

Isolation von dendritischen Zellen aus menschlichen weiblichen Fortpflanzungsorgane für phänotypische und funktionelle Studien

The characterization of the human dendritic cells (DCs) resident in mucosal tissues is challenging due to the difficulty in obtaining samples, and the low ...

Isolation, Expansion, and Adipogenic Induction of CD34+CD31+ Endothelial Cells from Human Omental and Subcutaneous Adipose Tissue

Obesity is accompanied by an extensive remodeling of adipose tissue primarily via adipocyte hypertrophy. Extreme adipocyte growth results in a poor response to insulin, local hypoxia, and inflammation. By stimulating the differentiation of functional white adipocytes from progenitors, radical hypertrophy of the adipocyte population can be prevented and, consequently, the metabolic health of adipose tissue can be improved along with a reduction of inflammation. Also, by stimulating a differentiation of beige/brown adipocytes, the total body energy expenditure can be increased, resulting in weight loss. This approach could prevent the development of obesity co-morbidities such as type 2 diabetes and cardiovascular disease.
This paper describes the isolation, expansion, and differentiation of white and beige adipocytes from a subset of human adipose tissue endothelial cells that co-express the CD31 and CD34 markers. The method is relatively cheap and is not labor-intensive. It requires access to human adipose tissue and the subcutaneous depot is suitable for sampling. For this protocol, fresh adipose tissue samples from morbidly obese subjects [body mass index (BMI) &#62;35] are collected during bariatric surgery procedures. Using a sequential immunoseparation from the stromal vascular fraction, enough cells are produced from as little as 2&#8211;3 g of fat. These cells can be expanded in culture over 10&#8211;14 days, can be cryopreserved, and retain their adipogenic properties with passaging up to passage 5&#8211;6. The cells are treated for 14 days with an adipogenic cocktail using a combination of human insulin and the PPAR&#947; agonist-rosiglitazone.
This methodology can be used for obtaining proof of concept experiments on molecular mechanisms that drive adipogenic responses in adipose endothelial cells, or for screening new drugs that can enhance the adipogenic response directed either towards white or beige/brown adipocyte differentiation. Using small subcutaneous biopsies, this methodology can be used to screen out non-responder subjects for clinical trials aimed to stimulate beige/brown and white adipocytes for the treatment of obesity and co-morbidities.

The differentiation of white and beige adipocytes from adipose tissue vascular progenitors bears potential for metabolic improvement in obesity. We describe protocols for a CD34+CD31+ endothelial cell isolation from human fat and for a subsequent in vitro expansion and differentiation into white and beige adipocytes. Several downstream applications are discussed.

Isolation, Expansion und Adipogenen Induktion von CD34 + CD31 + Endothelial Zellen aus menschlichen Omentalis und subkutanem Fettgewebe

Obesity is accompanied by an extensive remodeling of adipose tissue primarily via adipocyte hypertrophy. Extreme adipocyte growth results in a poor ...