Diese Arbeit wurde von der Deutschen Forschungsgemeinschaft (DFG) und des Bundesinstituts für Risikobewertung (BfR, Deutschland) unterstützt.

Die über alle Design des Protokolls enthält vier große Schritte ist in Abbildung 1 dargestellt. Alle Schritte werden ausführlich beschrieben. Zellisolierung, Transduktion und Kultur, durch konfokale Bildgebung etwa 24 Stunden später gefolgt ist ein konsekutiver und obligatorische Zeitskala. Das Virus Konstruktion sollte vor der Zelle isoliert durchgeführt werden und wird dann für die genetische Transduktion eingesetzt. 1. Isolation von adulten Herzmuskelzellen aus Ratten-Herzen <ol><li> Erwachsene männliche Wistar-Ratten ca. 250 g Gewicht (6-12 Wochen alt) sind betäubt durch intraperitoneale Injektion von 170 ul Anästhesie-Lösung pro 100 g Körpergewicht </li><li> Zusätzlich wird ein Citrat-Lösung (2 ul / g Körpergewicht) injiziert, um die Blutgerinnung während der Operation zu vermeiden. </li><li> Langendorff Perfusion Set-Up sollte vorbereitet werden. Alle Lösungen sollten mit Sauerstoff gesättigt werden. </li><li> Wenn die Ratte betäubt ist, wird das Tier auf eine Operation Board befestigt und der obere Teil des Körpers ist mit 70% Ethanol desinfiziert. </li><li> Das Tier ist durch Durchtrennen der Halsschlagader getötet. </li><li> Der Thorax geöffnet wird mit einer Schere. Das Herz und die Aorta sollte nun zugänglich sein. Der Herzbeutel entfernt. </li><li> Ice-kalte Lösung A + (5 ml) wird in beiden Herzkammern mit einer 26-Gauge-Nadel in das Herz Verhaftung und waschen das Blut injiziert. </li><li> Die Aorta ist mit einer Klammer gepackt und verkürzte in der Aortenbogen nur waren die ersten Verzweigung auftritt. </li><li> Das Herz ist aus der Brust entfernt und die Aorta an der Kanüle einer Perfusion Set-up mit einer Pinzette und einer Schelle befestigt retrograde Langendorff-Perfusion erlauben. Seien Sie sich bewusst nicht auf die Aortenklappen foraminate. </li><li> Das Herz muss durch eine Ligatur um die Aorta / Kanüle befestigt werden. Öffnen Schiffe müssen auch ligiert werden. </li><li> Das Herz ist retrograd mit Sauerstoff gesättigte Lösung A + bei Raumtemperatur (23 ° C) für 10 min bei einem Druck von etwa 70 mbar perfundiert. Achten Sie darauf, keine Luftblasen in die Aorta. </li><li> Die Perfusionslösung wird eine Liberase Lösung bei einer Temperatur von 37 ° C schaltet für ca. 25 min mit einer Rate von 4 ml / min durch eine Schlauchpumpe. Am Ende der Perfusion des Herzens aussehen sollte marmoriert weiß. Die Verdauung etwas Zeit brauche, um auf die Situation / Gewebe Zustand angepasst werden. </li><li> Das Herz ist von der Durchblutung Set-up genommen und in eine Petrischale mit Lösung A bei einer Temperatur von 37 ° C. Verbleibenden Schiffe und Atrien sind abgeschnitten. Die Schiffe werden verworfen und die Vorhöfe - falls benötigt - anders (nicht Bestandteil dieses Protokolls) behandelt. Die Kammern sind in etwa 6 Stücke geteilt. </li><li> Die Stücke werden in einen 100 ml Erlenmeyerkolben mit 20 ml Lösung A bei einer Temperatur von 37 ° C und leicht in einem 37 ° C Wasserbad für 5 min geschüttelt. Übertragen Schließlich wird der Überstand verworfen. </li><li> Das oben beschriebene Verfahren ist ein-oder zweimal wiederholt. Der Überstand sollte erscheinen etwas undurchsichtig. </li><li> Der Zuwachs der extrazellulären Calcium-Konzentration wird durch Zugabe von 20 ml Lösung B 1 / 2 bei 37 ° C zu den Zellen und Gewebe bleiben ein Rest der Lösung initiiert A in den Erlenmeyerkolben. Das ist etwas in einem 37 ° C Wasserbad für weitere 5 min geschüttelt. Anschließend wird der Überstand wird verworfen. </li><li> Fügen Sie weitere 20 ml Lösung B 1 / 2. (Die Lösung / Überstand sollte nun lebensfähigen Zellen.) Ein Tropfen der Zellen in einer Petrischale befindet sich auf einer invertierten Zellkultur Mikroskop übertragen. Wenn die Zellen zeigen eine hohe spontane Aktivität (Wehen), muss man warten, bis die Zellen zur Ruhe kommen. </li><li> Einmal mehr wird der Überstand verworfen und 20 ml Lösung B 1 / 2 hinzugefügt werden. </li><li> Die Spitze eines Kunststoff-Pasteurpipette ausgeschaltet ist in einer Weise, dass die Gewebestücke kann leicht passieren, wenn durch die Öffnung bewegt geschnitten. Mit Beflammung scharfen Kanten sind weich (geschmolzen). </li><li> Nun ist die Gewebestücke sind leicht und sanft verrieben. Die Gewebestücke sollten &quot;zerfallen&quot; in die Zellen. </li><li> Die Zelle mit Überstand wird dekantiert und verdünnt mit Lösung B, um die gewünschte Zelldichte, die sich auf die Art von Experimenten hängt und sollten empirisch ermittelt werden erreichen. </li></ol> 2. Bau eines Adenovirus für Fusionsprotein Transduktion Zur Herstellung von Adenoviren der Transpose-Ad adenoviralen Vektor-System von MP Biomedicals wird 1 verwendet. Dieses Protokoll beginnt mit den verfügbaren und getestet Eintrag Vektor (pCR259) für ein fluoreszierendes Fusionsprotein oder GEB s 2. <ol><li> Eine Menge von 10 ng der oben erwähnten ersten pCR259 Vektor mit dem Gen von Interesse wird mit 100 ul HighQ-1 Transpose-AD ™ 294 kompetente Zellen transformiert. </li><li> Diese Mischung wird für 20 min auf Eis durch einen Hitzeschock für 45 s bei 42 ° C gefolgt und auf Eis gelagert für weitere 2 min inkubiert. </li><li> Add 900 &amp; mu; L unselektive LB-Medium wachsen und bei 37 ° C unter leichtem Rühren für 4 Stunden. </li><li> Tafel 50 ul, 100 ul und 200 ul auf Platten mit LB-Medium mit Chloramphenicol (Cm, 20 pg / ml), Ampicillin (100 pg / ml), Tetracyclin (15 ug / ml), X-Gal (280 pg / ml ) und IPTG (40 ug / ml). (Eine intensivere und schnellere Blau-Färbung wird durch die Verwendung der teureren Farbstoff Bluo-Gal mit 300μg/ml möglich. Diese sollen insbesondere verwendet werden, wenn Sie nicht so vertraut sind bei der Erkennung und Unterscheidung blau / weiße Kolonien) </li><li> Wachsen Sie für 24 Stunden bei 37 ° C. Lassen Sie bei 4 ° C bis gute Identifizierung des blauen Kolonien möglich ist. Wenn es Probleme gibt, zu entscheiden, welche Kolonie wirklich weiß ist holen einige der Kolonien und auf einer anderen Platte mit den drei Antibiotika, X-Gal und IPTG replizieren und ließ sie über Nacht wachsen bei 37 ° C. Anm.) Die HighQ-1 Transpose-AD ™ 294 Zellen enthalten zwei wichtige Plasmide: Das Adenovirus-Backbone (Transpose-Ad ™ 294) und ein Helfer-Plasmid Ausdruck einer Transposase, die das Einfügen des Gens von Interesse vermittelt in seinen Zielorten, befindet in der LacZ-Gen des Transpose-AD 294-Plasmid. </li><li> Zur Identifizierung positive Kolonien, die das Gen von Interesse in der Virus-Backbone durchzuführen Kolonie-PCR als in 2,7-2,9 beschrieben. Verwenden Sie Vektor-Primer flankieren die multiple Klonierungsstelle (forward 5 &#39;CCCAGTCACGACGTTGTAAAACG 3&#39;, reverse 5 &#39;GCGGATAACAATTTCACACAGG 3&#39;) und eine Kolonie-PCR mit 100% weißen Kolonien und die Nutzung einer blauen Kolonie als Kontrolle für Transpose-AD 294 Plasmiden ohne eingefügte Gen von Interesse. Blaue Kolonien geben Ihnen einen kurzen PCR-Fragment (~ 200 bp), Kolonien mit Ihrem Gen von Interesse zeigen eine große PCR-Produkt (abhängig von der Länge Ihres Gen von Interesse) und Kolonien mit zwei Fragmente sind mehrere Zellkolonien und müssen getrennt werden wenn weiter verwendet. </li><li> Nach der unten stehenden Tabelle einen Master-Mix muss vorbereitet werden. </li><li> Wählen Sie einen einzigen 100% weiß Kolonie mit einer autoklaviert Zahnstocher und zunächst eine Replikation dieser Kolonie auf einer LB-Platte mit Cm. </li><li> Übertragen Sie die Kolonie in den PCR-Mix. Twirl es in den PCR-Mix 3-4 mal als entfernen Sie die Zahnstocher, bevor es eine Menge der PCR-Mix könnte einweichen. Die PCR-Protokoll hängt von der kb des Einsatzes und der verwendeten Polymerase. Die Annealingtemperatur der Primer ist 57 ° C und einem Einsatz von 35 Zyklen empfohlen. </li><li> Wachsen Sie über Nacht Kulturen (LB-Medium mit Cm) der positiven Klone und Isolierung der Plasmide mit einem kommerziell erhältlichen Kit ohne Spin-Säulen, da die Zentrifugalkraft stört die große Virus-Vektor. </li><li> Transform 0,5 ug der isolierten Plasmide in 100 ul DH5a kompetenten Zellen. Inkubieren DNA mit Zellen auf Eis für 30 min. Heat shock 45 s bei 42 ° C und setzen auf Eis für 2 min. </li><li> Add 900 ul unselektive LB-Medium wachsen und bei 37 ° C unter leichtem Schütteln für 1 Stunde. </li><li> Tafel 50 ul auf einem Teller mit LB-Medium mit Cm, X-Gal und IPTG. Bei 37 ° C für 24 Stunden. </li><li> Pick and replizieren bis zu 20 100% weiße Kolonien auf separaten Ampicillin, Tetracyclin und Chloramphenicol-Platten mit IPTG und X-Gal. Lassen Sie sie über Nacht wachsen bei 37 ° C. Wählen Kolonien, die 100% weiß, Chloramphenicol resistent, Ampicillin und Tetracyclin empfindlich sind. </li><li> Colony-PCR (optional): positive Klone können wieder mit Kolonie-PCR getestet werden, um zu überprüfen, dass sie das Insert enthalten. </li><li> Wählen Sie eine einzelne Kolonie von einer positiven rekombinanten und wachsen in 600 ml LB-Medium mit Cm. </li><li> Isolieren Sie die Plasmid mit einem Plasmid Maxi Kit. </li><li> Digest 5 ug Plasmid mit Pac I für zwei Stunden bei 37 ° C und Stop der Reaktion bei 65 ° C für 20 min. </li><li> Konzentrieren Sie sich das ganze zu verdauen in einem SpeedVac bei Raumtemperatur für 30 min auf ein Endvolumen von 10 ul oder verwenden Sie eine Phenol-Chloroform-Extraktions-Verfahren. </li><li> Tauwetter ein Fläschchen eingefroren QBI-HEK 293-Zellen unter leichtem Schütteln in einem 37 ° C Wasserbad. Spülen Sie die Außenseite der Flasche mit 70% Ethanol und fahren aseptisch in ein steriles Kapuze. </li><li> Transfer-Zellen in ein steriles 15 ml Tube, tropfenweise 10 ml DMEM (+10% FCS), während sanfte Rühren und Zentrifuge 10 min bei 250xg die Zellen zu pelletieren. </li><li> Überstand. Das Pellet in 10 ml DMEM (+10% FCS) durch vorsichtiges Auf-und Abpipettieren. </li><li> Seed in einem 75 cm 2 einwiegen und 10 ml DMEM mit 10% FCS zu den Zellen. Inkubation über Nacht bei 37 ° C in einer 5% CO 2-Inkubator. </li><li> Am nächsten Tag prüfen die Zelldichte. QBI-HEK 293-Zellen sollte bei einer 1.10 bis 1.20 Verhältnis aufgeteilt werden. </li><li> Entfernen Sie das Medium von den Zellen und trypsinize mit 2 ml Trypsin für 1-3 min. Geben Sie 10 ml DMEM auf die Zellen und Zentrifuge bei 250xg für 10 min. </li><li> Entfernen Sie vorsichtig das Medium und geben 10 ml frisches Medium zu den Zellen, resuspendieren und zählen Sie die Zellen. </li><li> Plate in einem Sechs-gut man gut mit 2x10 5, 3x10 5 </sup&gt;, 4x10 5, 5x10 5 und 6x10 5 Zellen. Inkubieren Sie die Schale bei 37 ° C in einem CO 2-Inkubator. </li><li> Am folgenden Tag mit einem gut 50% Konfluenz mit der konzentrierten Pac I verdauen transfizieren. Wir haben gute Erfahrungen mit Lipofectamine 2000 Transfektion, aber auch andere Methoden (z. B. Calciumphosphat-Transfektion) geeignet sein sollte. </li><li> Ändern Sie das Medium, in dem auch 3-4 h vor der Transfektion in die Zellen in ein exponentielles Wachstum zu bekommen während des Verfahrens. </li><li> Mix 5 ul Lipofectamine mit 250 ul DMEM und Inkubieren bei Raumtemperatur für 5 min. </li><li> Geben Sie dem Lipofectamine-Medium-Gemisch auf die DNA (Pac I Digest) und mischen durch Klopfen gegen das Reaktionsrohr, nicht Vermischung durch Pipettieren. Inkubieren Sie die Mischung 20 min bei Raumtemperatur. </li><li> Löschen Sie die Transfektion Mischung auf die Zellen-und Rock-Platte zu mischen. Bei 37 ° C mit 5% CO 2. Ändern Medium nach 4-5 Stunden. </li><li> Zwei Tage nach der Transfektion nehmen das Medium von den Zellen und geben Sie es in eine frische Kulturflasche (75 cm 2). </li><li> Trypsinize die Zellen mit 500 ul Trypsin für bis zu 5 min. Geben Sie 1 ml DMEM auf die Zellen, nehmen Sie die gesamte Mischung und legen Sie sie zusammen mit 17 ml frisches Medium (DMEM mit FCS) in die Kulturflasche. Kultivieren Sie die Zellen bei 37 ° C mit 5% CO 2 bis zytopathischen Effekte (CPE) sichtbar sind. Siehe Abbildung 2 zu lernen, wie CPE aussehen sollte. </li><li> Sammeln Sie die Zellen mit dem Medium in einer 50 ml Tube und Einfrieren der Zellen bei -80 ° C. Break the Zellen mit drei Gefrier / Tau-Zyklen (-80 ° C/37 ° C im Wasserbad). </li><li> Zentrifuge 20 min bei 8000xg und 4 ° C. Den Überstand in ein 100mm-Durchmesser Teller und entsorgen Sie die Pellets. Verwenden Sie eine sterile Filter mit 0.45 Porengröße Filtrat der Überstand. Dies ist der erste Virus, Lager (Passage 1). </li><li> Verwenden Sie 1 / 3 dieser Aktie zu einer 75 cm 2-Kolben mit QBI-HEK 293-Zellen mit 70% Konfluenz transduzieren. Bei 37 ° C und 5% CO 2 bis CPE s sichtbar sind. </li><li> Wenn die Zellen zeigen CPE s sammeln und extrahieren Sie die Viren als getan. Dies ist Durchgang 2 des Virus. </li><li> Wiederholen Sie die Schritte 2,37 und 2,38 mit Viruspassage 2 und so weiter, bis die Verstärkung der Viren erreicht eine ausreichende Virus Lager. Das Virus kann mit speziellen Zentrifugenröhrchen (Amicon Ultra-15 Kreiselpumpen Filtereinheit mit Ultracel-100-Membran von Millipore) konzentriert und gespeichert werden für mehrere Monate bei -80 ° C. Zum Zählen der infektiösen Partikel mit einem Plaque-Assay. </li><li> Verwenden Sie Viruspassage 2 oder höher, um Zellen zu transduzieren und zur weiteren Verstärkung des Virus. </li></ol> 3. Primäre Zellkultur und adenovirale Transduktion <ol><li> Sterile runde Deckgläschen von 20 mm Durchmesser sind in Standard-12-well Platten. </li><li> 20 pl ECM-Lösung ist gleichmäßig auf beiden Deckgläschen verteilt. Bleibt, werden verworfen. Zum Trocknen kann ein Minimum von 1 h bei 37 ° C. Alternativ kann die Beschichtung durch über Nacht getrocknet (12 h) bei Raumtemperatur. </li><li> Jedes der gut ist mit 1 ml Medium M199 mit Ergänzungen aus Antibiotika und ITS gefüllt. </li><li> Eine Zellsuspension (aus Schritt 1,21) von 200 bis 400 ul wird in jede Vertiefung gegeben. Die Kultivierung der Zellen erfolgt bei 37 ° C in einer 5% CO 2-Inkubator. </li><li> Die Zellen werden in das Sediment erlaubt und nach 1 h Medium gewechselt. </li><li> Unmittelbar nach dem Wechsel des Mediums eine ausreichende Menge an Virus haltigen Lösung (von Durchgang 2 oder höher) wird durch vorsichtiges Schwenken der Platte gemischt. </li><li> Im Falle einer langfristigen Kulturmedium wird alle 2 Tage gewechselt. </li><li> 24 Stunden nach der Transfektion GEB Ausdruck ist nachweisbar. </li></ol> 4. Konfokale Bildgebung für 3D subzellulären Strukturen und Ca 2 + Signaling Konfokale Bildgebung kann auf jedem konfokalen Mikroskop durchgeführt werden. Allerdings erfordern Kalzium-Imaging-Experimenten eine Akquisition Geschwindigkeit von mindestens video Rate (25-30 Hz). Dies schränkt nutzbare Technologien entweder Multi Beam-Scanner (zB Nipkow-Scheibe, fegte Feld oder Kilo-beam-Array-Scanner) oder die sehr schnelle Einstrahl-Scanner (zB Resonanz-Scanner oder akusto optischen Deflektor (AOD)-Scanner). Für einen Überblick vgl. Rz. 3. Die 3D-Bildgebung subzellulären erfordert eine z-Antrieb. Hier ein Kilo-beam-Array-Scanner (VTinfinity, Visitech Int., Sunderland, UK) verwendet wird. <ol><li> Das Mikroskop und periphere Geräte muss in einer Betriebsart eingestellt werden. Speziell für den Laser kann dies erfordern eine Aufwärmphase, bis eine stabile Ausgangsleistung erreicht ist. </li><li> Zellen benötigen, um eine experimentelle Kammer (Deckglas-Transfer) übertragen werden. Die Deckgläser mit Zellen sind eine experimentelle Kammer übertragen. 1 ml Tyrode-Lösung (mit 1,8 mM extrazellulärem Calcium) wird dann zugegeben. </li><li> Die experimentelle Kammer muss auf dem Mikroskoptisch platziert werden. Stimulation Elektroden, Perfusion Set-up und weitere Periral-Geräte, zB die Temperierung, müssen entsprechend angeordnet werden. </li><li> Die Zellen werden bei konzentriert und ausgewählt werden mit weißem Licht und / oder epifluoreszenten Beleuchtung. </li><li> Acquisition Parameter wie Laserleistung, Belichtungszeit etc. oder eine ganze Experiment Protokoll muss eingerichtet werden. </li><li> Zeitreihe und / oder Z-Abschnitt Bilder können erworben werden. </li><li> Auf dem Set-up weiter fortgeschritten Multimode-Messungen kann mit Elektrophysiologie (Patch-Clamp) und / oder optische Manipulation wie Fluoreszenz Umverteilung nach photobleach (FRAP) oder Freisetzung von Substanzen, darunter Zwei-Photonen-Photolyse werden. </li><li> Bildanalyse, insbesondere 3D-Rekonstruktion ist auf dedizierten Analyse-Software wie Imaris (Bitplane AG, Zürich, Schweiz), Geschwindigkeit (Improvisation, Coventry, UK) oder Arivis Browser (arivis GmbH, Rostock, Deutschland) durchgeführt. </li></ol> 5. Repräsentative Ergebnisse: Die Endergebnisse des Protokolls sind Bildsequenzen, die verwendet werden, um weitere Daten zu extrahieren können. Ein Beispiel ist die Untersuchung der subzellulären Strukturen und Organellen. Abbildung 3 zeigt das Beispiel der 3-dimensionalen Anordnung der Golgi-Apparat. Im Gegensatz zur Elektronenmikroskopie alle Untersuchungen können an lebenden Zellen durchgeführt werden. <img src="/files/ftp_upload/1433/JoVEFig1.jpg" alt="Abbildung 1" /> Abbildung 1: Allgemeiner Ablauf der wichtigsten experimentellen Schritte. <img src="/files/ftp_upload/1433/JoVEFig2.jpg" alt="Abbildung 2" /> Abbildung 2: Das linke Bild zeigt die Q-HEK-Zellen in Kultur mit 90-95% Konfluenz, die nicht transduziert werden. Cytopatic Wirkungen nach viralen Transduktion sind im rechten Teil dargestellt. Cells runden und lösen Sie aus der unteren Seite der Platte. In diesen Zellen der Kern nimmt den größten Teil der Zellen als Folge der aktiven Virus-Produktion. <img src="/files/ftp_upload/1433/JoVEFig3.jpg" alt="Abbildung 3" /> Abbildung 3: Adult Ratte Herzmuskelzellen mit einem YFP-Fusionsprotein gezielt den Golgi-Apparat transfiziert. Herzmuskelzellen nach adenoviralen Gentransfer (1 Tag in Kultur) drücken die fluoreszierende Fusionsprotein. Panel A zeigt einen einzigen konfokalen Scheibe aus einem z-Stack genommen. In Panel B dieselbe Zelle wird nach Dekonvolution mit Hilfe eines theoretischen Point Spread Function (PSF) dargestellt. Diese de-unscharfes Bild Stapel wird anschließend verwendet, um die Zelle zu machen und sich ein 3D-Volumen Wiederaufbau als in Panel C oder eine 3D-Oberfläche Wiederaufbau (D) gezeigt. Die Bar ist 10 pm.

<ol>
	<li>Kaestner, L., Ruppenthal, S., S, ., Licha, K., Lin, C. P. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Molecular Imaging II. Vol. 7370, 737008-737008 (2009).</li><li>Viero, C., Kraushaar, U., Ruppenthal, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=In+vivo+imaging+of+Drosophila+melanogaster+pupae+with+mesoscopic+fluorescence+tomography.">In vivo imaging of Drosophila melanogaster pupae with mesoscopic fluorescence tomography.</a> Cell Calcium. 43 (1), 59-59 (2008).</li><li>Kaestner, L., Lipp, P., Shorte, S. L., Frischknecht, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Imaging Cellular and Molecular Biological Functions. , 289-289 (2007).</li><li>Kaestner, L., Lipp, P., Popp, J., von Bally, G. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=.">.</a> Optics in Life Science. Vol. 6633, 66330K-66330K (2007).</li><li>Rinne, A., Littwitz, C., Bender, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Adenovirus-mediated+delivery+of+short+hairpin+RNA+(shRNA)+mediates+efficient+gene+silencing+in+terminally+differentiated+cardiac+myocytes.">Adenovirus-mediated delivery of short hairpin RNA (shRNA) mediates efficient gene silencing in terminally differentiated cardiac myocytes.</a> Methods Mol Biol. 515, 107-107 (2009).</li></ol>

Das Verfahren zur Isolierung von Ratten-Kardiomyozyten beschrieben, kann auf andere Arten, wie zB Maus 4 angepasst werden, falls erforderlich. Ein Parameter, der Anpassung muss, ist die Enzym-Mix für die Verdauung (siehe unten) und auch die Dauer der Verdauung. Seien Sie sich bewusst, dass die Zellen einiger Arten (zB Maus) könnte noch zerbrechlicher als andere (zB Ratten). Die Wahl der Kollagenase ist wahrscheinlich der wichtigste Schritt in der Isolierung. Wir wählen Liberase...

<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd">
<html xmlns="http://www.w3.org/1999/xhtml" xml:lang="en" lang="en">	
		
		<div>
		<table border="1">
		<thead>
		<tr>
		<th>Material Name</th>
		<th>Type</th>
		<th>Company</th>
		<th>Catalogue Number</th>
		<th>Comment</th>
		</tr>
		</thead>
		<tbody>
		
<tr>
<td>Anesthesia solution</td>
<td>&nbsp;</td>
<td>Serumwerk Bernburg GmbH (Ursotamin), Bayer Health Care (Rompun)</td>
<td>&nbsp;</td>
<td>Mixture of 1 ml Ursotamin (100 mg/ml Ketaminhydrochlorid) and 240 &mu;l Rompun (2% Xylazinhydrochlorid)</td>
</tr>
<tr>
<td>Citrate solution</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>117,64 mg sodium citrate in 10 ml 0.9% NaCl solution</td>
</tr>
<tr>
<td>Solution A</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>134 mM NaCl, 4 mM KCl, 11 mM glucose, 1.2 mM MgSO4, 1.2 mM Na2HPO4, 10 mM HEPES, pH adjusted to 7.35 using 10 M NaOH, sterile filtered</td>
</tr>
<tr>
<td>Solution A+</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>Content of solution A plus 0.2 mM EGTA, pH adjusted to 7.35 using 10 M NaOH, sterile filtered</td>
</tr>
<tr>
<td>Liberase solution</td>
<td>&nbsp;</td>
<td>F. Hoffmann&#x2010; La Roche Ltd.</td>
<td>11988476 001</td>
<td>500 &mu;l stock solution in 15 ml solution A (stock solution:
10 mg/ml Liberase Blendzyme 4 in aqua dest.)</td>
</tr>
<tr>
<td>Solution B</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>Content of solution A plus 200 &mu;M CaCl2 and 0.1% DNase solution</td>
</tr>
<tr>
<td>Solution B1/2</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>1:1 mixture of solution A and solution B</td>
</tr>
<tr>
<td>DNase solution</td>
<td>&nbsp;</td>
<td>Sigma&#x2010; Aldrich Co.</td>
<td>D4527</td>
<td>Deoxyribonuclease I, Type 2 from bovine pancreas, 40 KU (15 mg) are dissolved in 5 ml of 10 mM Tris&#x2010;HCl buffer, adjusted to pH=7.35, additional content: 50 mM NaCl, 10 mM MgCl2, 1 mM dithioerythritol; this solution is mixed with 5 ml glycerol</td>
</tr>
<tr>
<td>Extracellular matrix protein (ECM) solution</td>
<td>&nbsp;</td>
<td>Extracellular matrix protein (ECM) solution</td>
<td>E1270</td>
<td>1 ml stock solution as purchased is diluted with 6 mL
medium M199</td>
</tr>
<tr>
<td>Culture medium M199</td>
<td>&nbsp;</td>
<td>PAA</td>
<td>E15&#x2010;834</td>
<td>Medium M199 supplemented with 1 &mu;l/ml ITS solution and 20 &mu;l/ml penicillin&#x2010;streptomycin solution (5000 units/ml)</td>
</tr>
<tr>
<td>ITS solution</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>25 mg Insulin, 25 mg Transferrin and 50 &#x03BC;l Selenite stock solution are dissolved in 5 ml aqua dest. (stock solution: 0.5 mg/ml Sodiumselenite in aqua dest.). Add a few drops of 1 M HCl until one should get a clear
solution. Aliquots can be frozen.</td>
</tr>
<tr>
<td>Tyrode</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>135 mM NaCl, 5.4 mM KCl, 1.8 mM CaCl2, 2mM MgCl2, 10 mM glucose, 10 mM HEPES, pH adjusted to 7.35 using 10 M NaOH, sterile filtered</td>
</tr>
<tr>
<td>Master mix</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>5 &mu;l 10&#215;PCR&#x2010;Buffer, 5 &mu;l MgCl2 (25 mM), 2 &mu;l forward primer, 2 &mu;l reverse primer, 1 &mu;l dNTP&#180;s (10 mM each), 33 &mu;l H2O, 1 &mu;l DMSO, 1 &mu;l Taq&#x2010;DNA polymerase for each sample</td>
</tr>
<tr>
<td>LB&#x2010;Medium</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>&nbsp;</td>
<td>10 g/l Tryptone, 5 g/l Yeast extract, 5 g/l NaCl (and 15 g/l Agar if used as solid medium), pH 7.0</td>
</tr>
<tr>
<td>Pac I</td>
<td>&nbsp;</td>
<td>New England Biolabs</td>
<td>R0547L</td>
<td>preparation: 50 &mu;g DNA, 5 &mu;l 10&#215;buffer, 0.5 &mu;l 100&#215;BSA,
0.75 &mu;l Pac I, fill with H2O up to final volume of 50&mu;l</td>
</tr>		</tbody>
		</table>
		</div>

isolation and genetic manipulation of adult cardiac myocytes for confocal imaging

Herzmuskelzellen aus adulten Herzen isoliert werden weithin als ein Modell irgendwo auf halbem Weg zwischen embryonalen und neonatalen Muskelzellen auf der einen Seite und ein funktionierendes Herz auf der anderen akzeptiert. So dienen Kardiomyozyten als gute Modelle für kardiale zelluläre Physiologie und Pathophysiologie, für pharmazeutische Untersuchungen sowie für die Erforschung von transgenen Tiermodellen. Hier beschreiben wir eine Methode zur Isolierung von Zellen aus dem Herzen. Darüber hinaus zeigen wir, wie eine genetische Manipulation an Herzmuskelzellen ohne Zucht eines transgenen Tieres durchgeführt werden können: Dies ist die Kombination von langfristigen Kultur (1 Woche) und adenoviralen Gentransfer. Letzteres ist von der Konstruktion des Virus auf die Transduktion der Zellen beschrieben. Es kann für den Ausdruck von genetisch kodierten Biosensoren (GEBS), fluoreszierende Fusionsproteine ​​verwendet werden, sondern auch für die Protein-Überexpression und Down-Regulation, z. B. mittels RNAi. Hier bieten wir ein Beispiel für den Ausdruck eines Fusionsproteins Färbung eine subzelluläre Struktur (Golgi). Solche Protein-Expression kann durch konfokale Bildgebung von z-Stapeln visualisiert für eine 3D-Rekonstruktion von subzellulären Strukturen. Das Protokoll umfasst state-of-the-art in der Zellkultur, Molekularbiologie und Biophysik und bietet somit einen Ansatz zur Erforschung neuer Horizonte in der Zell-Kardiologie.

Watch this Scientific Journal Video about Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging at JoVE.com

Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging

Adult Herzmuskelzellen sind primäre Zellen, die aus tierischen Herzen isoliert und kultiviert für mehrere Tage. Innerhalb dieses Zeitraums Kultur adenoviralen Gentransfer können verwendet werden, um genetisch kodierte Biosensoren (GEBS) oder fluoreszierende Fusionsproteine ​​zu exprimieren. Beide Ansätze erlauben zellulären Untersuchungen mittels der konfokalen Mikroskopie.

Isolation und genetische Manipulation von Adult Herzmuskelzellen für konfokale Imaging

Cardiac myocytes isolated from adult hearts are widely accepted as a model somewhere half way between embryonic and neonatal muscle cells on one side and ...

isolation-genetic-manipulation-adult-cardiac-myocytes-for-confocal

Research

JoVE Journal

Biology

14.5K Aufrufe.  Universty of Saarland. Adult Herzmuskelzellen sind primäre Zellen, die aus tierischen Herzen isoliert und kultiviert für mehrere Tage. Innerhalb dieses Zeitraums Kultur adenoviralen Gentransfer können verwendet werden, um genetisch kodierte Biosensoren (GEBS) oder fluoreszierende Fusionsproteine ​​zu exprimieren. Beide Ansätze erlauben zellulären Untersuchungen mittels der konfokalen Mikroskopie.

Serie: Isolation and Genetic Manipulation of Adult Cardiac Myocytes for Confocal Imaging

Primary Culture of Adult Rat Heart Myocytes

Cultured primary adult rodent heart cells are an important model system for cardiovascular research. Nevertheless, establishment of robust, viable cultured adult myocytes can be a technically challenging, rate-limiting step for many researchers. Here we described a protocol to obtain a high yield of adult rat heart myocytes that remain viable in culture for several days. The heart is isolated and perfused with collagenase and protease under low Ca2+ conditions to recover single myocytes. Ca2+-tolerant cells are obtained by stepwise increases in extracellular Ca2+ concentration in three subsequent wash steps. Cells are filtered, resuspended in culture medium, and plated on laminin coated slips. Cultured myocytes obtained using this protocol are viable for up to four days and are suitable for most experiments including electrophysiology, biochemistry, imaging and molecular biology.

In this paper, we described a typical way to isolate and culture adult rat heart myocytes. Collagenase and protease are used to digest and isolate single myocytes. Myocytes cultured follow this protocol meet most experiment requirements.

Primäre Kultur der erwachsenen Ratte Herz Myozyten

Cultured primary adult rodent heart cells are an important model system for cardiovascular research.  Nevertheless, establishment of robust, viable ...

Forschung

Biologie

Dissection of Hippocampal Dentate Gyrus from Adult Mouse

The hippocampus is one of the most widely studied areas in the brain because of its important functional role in memory processing and learning, its remarkable neuronal cell plasticity, and its involvement in epilepsy, neurodegenerative diseases, and psychiatric disorders. The hippocampus is composed of distinct regions; the dentate gyrus, which comprises mainly granule neurons, and Ammon's horn, which comprises mainly pyramidal neurons, and the two regions are connected by both anatomic and functional circuits. Many different mRNAs and proteins are selectively expressed in the dentate gyrus, and the dentate gyrus is a site of adult neurogenesis; that is, new neurons are continually generated in the adult dentate gyrus. To investigate mRNA and protein expression specific to the dentate gyrus, laser capture microdissection is often used. This method has some limitations, however, such as the need for special apparatuses and complicated handling procedures. In this video-recorded protocol, we demonstrate a dissection technique for removing the dentate gyrus from adult mouse under a stereomicroscope. Dentate gyrus samples prepared using this technique are suitable for any assay, including transcriptomic, proteomic, and cell biology analyses. We confirmed that the dissected tissue is dentate gyrus by conducting real-time PCR of dentate gyrus-specific genes, tryptophan 2,3-dioxygenase (TDO2) and desmoplakin (Dsp), and Ammon's horn enriched genes, Meis-related gene 1b (Mrg1b) and TYRO3 protein tyrosine kinase 3 (Tyro3). The mRNA expressions of TDO2 and Dsp in the dentate gyrus samples were detected at obviously higher levels, whereas Mrg1b and Tyro3 were lower levels, than those in the Ammon's horn samples. To demonstrate the advantage of this method, we performed DNA microarray analysis using samples of whole hippocampus and dentate gyrus. The mRNA expression of TDO2 and Dsp, which are expressed selectively in the dentate gyrus, in the whole hippocampus of alpha-CaMKII+/- mice, exhibited 0.037 and 0.10-fold changes compared to that of wild-type mice, respectively. In the isolated dentate gyrus, however, these expressions exhibited 0.011 and 0.021-fold changes compared to that of wild-type mice, demonstrating that gene expression changes in dentate gyrus can be detected with greater sensitivity. Taken together, this convenient and accurate dissection technique can be reliably used for studies focused on the dentate gyrus.

A dissection technique for removal of the dentate gyrus from adult mouse under a stereomicroscope was demonstrated in this video-recorded protocol.

Dissection der hippocampalen von erwachsenen Maus

The hippocampus is one of the most widely studied areas in the brain because of its important functional role in memory processing and learning, its ...

Isolation of Human Atrial Myocytes for Simultaneous Measurements of Ca2+ Transients and Membrane Currents

The study of electrophysiological properties of cardiac ion channels with the patch-clamp technique and the exploration of cardiac cellular Ca2+ handling abnormalities requires isolated cardiomyocytes. In addition, the possibility to investigate myocytes from patients using these techniques is an invaluable requirement to elucidate the molecular basis of cardiac diseases such as atrial fibrillation (AF).1 Here we describe a method for isolation of human atrial myocytes which are suitable for both patch-clamp studies and simultaneous measurements of intracellular Ca2+ concentrations. First, right atrial appendages obtained from patients undergoing open heart surgery are chopped into small tissue chunks ("chunk method") and washed in Ca2+-free solution. Then the tissue chunks are digested in collagenase and protease containing solutions with 20 &mu;M Ca2+. Thereafter, the isolated myocytes are harvested by filtration and centrifugation of the tissue suspension. Finally, the Ca2+ concentration in the cell storage solution is adjusted stepwise to 0.2 mM. We briefly discuss the meaning of Ca2+ and Ca2+ buffering during the isolation process and also provide representative recordings of action potentials and membrane currents, both together with simultaneous Ca2+ transient measurements, performed in these isolated myocytes.

Isolation of Human Atrial Myocytes for Simultaneous Measurements of Ca2+ Transients and Membrane Currents

We describe the isolation of human atrial myocytes which can be used for intracellular Ca2+ measurements in combination with electrophysiological patch-clamp studies.

Isolierung humaner Vorhofmyozyten für gleichzeitige Messungen von Ca<sup&gt; 2 +</sup&gt; Transienten und Membrane Currents

The study of  electrophysiological properties of cardiac ion channels with the patch-clamp  technique and the exploration of cardiac cellular Ca2+ ...

Imaging Cell Membrane Injury and Subcellular Processes Involved in Repair

The ability of injured cells to heal is a fundamental cellular process, but cellular and molecular mechanisms involved in healing injured cells are poorly understood. Here assays are described to monitor the ability and kinetics of healing of cultured cells following localized injury. The first protocol describes an end point based approach to simultaneously assess cell membrane repair ability of hundreds of cells. The second protocol describes a real time imaging approach to monitor the kinetics of cell membrane repair in individual cells following localized injury with a pulsed laser. As healing injured cells involves trafficking of specific proteins and subcellular compartments to the site of injury, the third protocol describes the use of above end point based approach to assess one such trafficking event (lysosomal exocytosis) in hundreds of cells injured simultaneously and the last protocol describes the use of pulsed laser injury together with TIRF microscopy to monitor the dynamics of individual subcellular compartments in injured cells at high spatial and temporal resolution. While the protocols here describe the use of these approaches to study the link between cell membrane repair and lysosomal exocytosis in cultured muscle cells, they can be applied as such for any other adherent cultured cell and subcellular compartment of choice.

The process of healing injured cells involves trafficking of specific proteins and subcellular compartments to the site of cell membrane injury. This protocol describes assays to monitor these processes.

Imaging Cell Membrane Verletzung und subzellulärer Prozesse in der Reparatur beteiligt

The ability of injured cells to heal is a fundamental cellular process, but cellular and molecular mechanisms involved in healing injured cells are poorly ...

Isolation and Culture of Adult Mouse Cardiomyocytes for Cell Signaling and in vitro Cardiac Hypertrophy

Technological advances have made genetically modified mice, including transgenic and gene knockout mice, an essential tool in many research fields. Adult cardiomyocytes are widely accepted as a good model for cardiac cellular physiology and pathophysiology, as well as for pharmaceutical intervention. Genetically modified mice preclude the need for complicated cardiomyocyte infection processes to generate the desired genotype, which are inefficient due to cardiomyocytes&#8217; terminal differentiation. Isolation and culture of high quantity and quality functional cardiomyocytes will dramatically benefit cardiovascular research and provide an important tool for cell signaling transduction research and drug development. Here, we describe a well-established method for isolation of adult mouse cardiomyocytes that can be implemented with little training. The mouse heart is excised and cannulated to an isolated heart system, then perfused with a calcium-free and high potassium buffer followed by type II collagenase digestion in Langendorff retrograde perfusion mode. This protocol yields a consistent result for the collection of functional adult mouse cardiomyocytes from a variety of genetically modified mice.

Isolation and Culture of Adult Mouse Cardiomyocytes for Cell Signaling and in vitro Cardiac Hypertrophy

We describe a reliable method for isolation of adult mouse cardiomyocytes. This protocol yields a consistent result for the culture of functional adult cardiomyocytes from a variety of genetically modified mice.

Isolation und Kultur der erwachsenen Maus Kardiomyozyten für Cell Signaling und<em&gt; In-vitro-</em&gt; Herzhypertrophie

Technological advances have made genetically modified mice, including transgenic and gene knockout mice, an essential tool in many research fields. Adult ...

DNA Electroporation, Isolation and Imaging of Myofibers

Mature muscle has a unique structure that is amenable to live cell imaging. Herein, we describe the experimental protocol for expressing fluorescently labeled proteins in the flexor digitorum brevis (FDB) muscle. Conditions have been optimized to provide a large number of high quality myofibers expressing the electroporated plasmid while minimizing muscle damage. The method employs fluorescent tags on various proteins. Combining this expression method with high resolution confocal microscopy permits live cell imaging, including imaging after laser-induced damage. Fluorescent dyes combined with imaging of fluorescently-tagged proteins provides information regarding the basic structure of muscle and its response to stimuli.

This protocol utilizes electroporation to introduce and express fluorescently labeled proteins in mouse muscle fibers. Following recovery after electroporation, fibers are isolated. Individual fibers are then imaged using high resolution confocal microscopy to visualize muscle structure.

DNA Elektroporation, Isolierung und Imaging von Muskelfasern

Mature muscle has a unique structure that is amenable to live cell imaging. Herein, we describe the experimental protocol for expressing fluorescently ...

Methods for the Isolation, Culture, and Functional Characterization of Sinoatrial Node Myocytes from Adult Mice

Sinoatrial node myocytes (SAMs) act as the natural pacemakers of the heart, initiating each heart beat by generating spontaneous action potentials (APs). These pacemaker APs reflect the coordinated activity of numerous membrane currents and intracellular calcium cycling. However the precise mechanisms that drive spontaneous pacemaker activity in SAMs remain elusive. Acutely isolated SAMs are an essential preparation for experiments to dissect the molecular basis of cardiac pacemaking. However, the indistinct anatomy, complex microdissection, and finicky enzymatic digestion conditions have prevented widespread use of acutely isolated SAMs. In addition, methods were not available until recently to permit longer-term culture of SAMs for protein expression studies. Here we provide a step-by-step protocol and video demonstration for the isolation of SAMs from adult mice. A method is also demonstrated for maintaining adult mouse SAMs in vitro and for expression of exogenous proteins via adenoviral infection. Acutely isolated and cultured SAMs prepared via these methods are suitable for a variety of electrophysiological and imaging studies.

Methods are demonstrated for the isolation of sinoatrial node myocytes (SAMs) from adult mice for patch clamp electrophysiology or imaging studies. Isolated cells can be used directly or can be maintained in culture to permit expression of proteins of interest, such as genetically encoded reporters.

Verfahren zur Isolierung, Kultur, und funktionelle Charakterisierung von Sinoatrialknoten Myozyten aus erwachsenen Mäusen

Sinoatrial node myocytes (SAMs) act as the natural pacemakers of the heart, initiating each heart beat by generating spontaneous action potentials (APs). ...

Isolation, Characterization, and Differentiation of Cardiac Stem Cells from the Adult Mouse Heart

Myocardial infarction (MI) is a leading cause of morbidity and mortality around the world. A major goal of regenerative medicine is to replenish the dead myocardium after MI. Although several strategies have been used to regenerate myocardium, stem cell therapy remains a major approach to replenish the dead myocardium of an MI heart. Accumulating evidence suggests the presence of resident cardiac stem cells (CSCs) in the adult heart and their endocrine and/or paracrine effects on cardiac regeneration. However, CSC isolation and their characterization and differentiation toward myocardial cells, especially cardiomyocytes, remains a technical challenge. In the present study, we provided a simple method for the isolation, characterization, and differentiation of CSCs from the adult mouse heart. Here, we describe a density gradient method for the isolation of CSCs, where the heart is digested by a 0.2% collagenase II solution. To characterize the isolated CSCs, we evaluated the expression of CSCs/cardiac markers Sca-1, NKX2-5, and GATA4, and pluripotency/stemness markers OCT4, SOX2, and Nanog. We also determined the proliferation potential of isolated CSCs by culturing them in a Petri dish and assessing the expression of the proliferation marker Ki-67. For evaluating the differentiation potential of CSCs, we selected seven- to ten-days cultured CSCs. We transferred them to a new plate with a cardiomyocyte differentiation medium. They are incubated in a cell culture incubator for 12 days, while the differentiation medium is changed every three days. The differentiated CSCs express cardiomyocyte-specific markers: actinin and troponin I. Thus, CSCs isolated with this protocol have stemness and cardiac markers, and they have a potential for proliferation and differentiation toward cardiomyocyte lineage.

The overall goal of this article is to standardize the protocol for the isolation, characterization, and differentiation of cardiac stem cells (CSCs) from the adult mouse heart. Here, we describe a density gradient centrifugation method to isolate murine CSCs and elaborated methods for CSC culture, proliferation, and differentiation into cardiomyocytes.

Isolierung, Charakterisierung und Differenzierung von kardialen Stammzellen von Erwachsenen Maus Herzen

Myocardial infarction (MI) is a leading cause of morbidity and mortality around the world. A major goal of regenerative medicine is to replenish the dead ...

Isolation and Characterization of Adult Cardiac Fibroblasts and Myofibroblasts

Cardiac fibrosis in response to injury is a physiological response to wound healing. Efforts have been made to study and target fibroblast subtypes that mitigate fibrosis. However, fibroblast research has been hindered due to the lack of universally acceptable fibroblast markers to identify quiescent as well as activated fibroblasts. Fibroblasts are a heterogenous cell population, making them difficult to isolate and characterize. The presented protocol describes three different methods to enrich fibroblasts and myofibroblasts from uninjured and injured mouse hearts. Using a standard and reliable protocol to isolate fibroblasts will enable the study of their roles in homeostasis as well as fibrosis modulation.

Obtaining a pure population of fibroblasts is crucial to studying their role in wound repair and fibrosis. Described here is a detailed method to isolate fibroblasts and myofibroblasts from uninjured and injured mouse hearts followed by characterization of their purity and functionality by immunofluorescence, RTPCR, fluorescence-assisted cell sorting, and collagen gel contraction.

Isolierung und Charakterisierung von adulten Herz-Fibroblasten und Myofibroblasten

Cardiac fibrosis in response to injury is a physiological response to wound healing. Efforts have been made to study and target fibroblast subtypes that ...

Simultaneous Isolation and Culture of Atrial Myocytes, Ventricular Myocytes, and Non-Myocytes from an Adult Mouse Heart

The isolation and culturing of cardiac myocytes from mice has been essential for furthering the understanding of cardiac physiology and pathophysiology. While isolating myocytes from neonatal mouse hearts is relatively straightforward, myocytes from the adult murine heart are preferred. This is because compared to neonatal cells, adult myocytes more accurately recapitulate cell function as it occurs in the adult heart in vivo. However, it is technically difficult to isolate adult mouse cardiac myocytes in the necessary quantities and viability, which contributes to an experimental impasse. Furthermore, published procedures are specific for the isolation of either atrial or ventricular myocytes at the expense of atrial and ventricular non-myocyte cells. Described here is a detailed method for isolating both atrial and ventricular cardiac myocytes, along with atrial and ventricular non-myocytes, simultaneously from a single mouse heart. Also provided are the details for optimal cell-specific culturing methods, which enhance cell viability and function. This protocol aims not only to expedite the process of adult murine cardiac cell isolation, but also to increase the yield and viability of cells for investigations of atrial and ventricular cardiac cells.

A method is described for the simultaneous isolation of myocytes and non-myocytes from both the atria and ventricles of a single adult mouse heart. This protocol results in consistent yields of highly viable cardiac myocytes and non-myocytes and details optimal cell-specific culture conditions for phenotyping and in vitro analysis.

Gleichzeitige Isolierung und Kultur von Atrial Myozyten, ventrikulären Myozyten und Nicht-Myozyten aus einem erwachsenen Mausherz

The isolation and culturing of cardiac myocytes from mice has been essential for furthering the understanding of cardiac physiology and pathophysiology. ...