We thank Kelli Czarra and Megan Karwan for animal technical assistance, Kathleen Noer and Roberta Matthai for flow cytometry assistance, and Donna Butcher andMiriam R. Anver for pathology analysis. This project was supported by a grant from the Ely and Edythe Broad Foundation (to Scott Durum) and has been funded in whole or in part with federal funds from the National Cancer Institute, National Institutes of Health, under Contract No. HHSN261200800001E (MRA).

Alle Tiere erhielten die richtige Pflege in Übereinstimmung mit den im Guide 2011 skizzierten experimentellen Verfahren zur Pflege und Verwendung von Labortieren Komitee Frederick National Laboratory for Cancer Research. 1. Erzeugung von IL-22-tdTomato Reporter Mäusen durch BAC Recombineering HINWEIS: Die Mäuse sollten bewusstlos sein und nicht als Reaktion auf einen schädlichen Reiz bewegen. Sterilisieren Sie den OP-Bereich mit 70% Ethanol und zu sterilisieren alle chirurgischen Werkzeuge, um eine Glasperle Sterilisator verwenden. <ol><li> Reinige BAC - DNA (RP23-401E11, clone Länge 228.391 bps) unter Verwendung eines alkalischen Extraktionsverfahren 10, 11. Charakterisieren Sie den BAC-Klon durch SpeI Verdauung von 5 ug RP23-401E11 die korrekte Größe des Zielgens zu bestätigen. HINWEIS: Die BAC DNA wurde in 14 Fragmente gespalten. </li><li> Legen Sie die tdTomato Reporter-Gen in die Not I / Sal I-Stelle des PLD53SC-A-GFP-B-Shuttle-Vektor11 und das GFP - Gen in der gleichen Stelle ersetzen. Dann als Matrize BAC RP23-401E11, verstärken die Homologie - Boxen (A und B) zu dem ersten übersetzten Exon von Il-22 (Exon 1) durch PCR (95 ° C 2 min; 30 Zyklen von 95 ° C für 30 sec, 55 ° C für 30 sec, und 72 ° C für 30 sec, und eine abschließende Extension bei 72 ° C für 10 min). In einem 50 &amp; mgr; l PCR - Reaktionssystem, werden 50 ng (1 &amp; mgr; l) von BAC - DNA, 0,5 ul Primer (10 uM), 40 ul PCR Supermix high fidelity und 8 &amp; mgr; l H 2 O. HINWEIS: Die Primer für die A- und B - Boxen sind wie folgt: Ein Feld Forward: 5 &#39;T GGCGCGCC GGAGCTGTGAAGAAAG und Reverse: 5&#39; CAGAGATCGCACAAGTGTCAAC; B - Box vorwärts: 5&#39; - G TTAATTAA CTGCCCGTCAACA und Reverse: 5 &#39;T GGCCGGCC TGAGCACCTGCTT CATC 10. Die Standorte der Restriktionsenzyme (Asc I und Pac I) sind unterstrichen. </li><li> Ligieren 500 ng Asc I-verdaute A und 500 ng von Pac I-verdaute B fragments in 50 ng PLD53SC-ATB (tdTomato) Vektor bei 16 ° C für 1 Stunde. </li><li> Transformieren des gereinigten PLD53SC-ATB Vektors in BAC-kompetente Zellen 11 und Kultur sie auf Luria-Bertani (LB) Agarplatten mit Chloramphenicol (20 ug / ml) und Ampicillin (30 ug / ml) bei 37 ° C. Wählen Sie zwei vor drei Kolonien von Co-Integration von den Ch / Amp Master-Platten. </li><li> Beimpfen jede Kolonie in 1 ml LB, ergänzt mit 20 ug / ml Chloramphenicol und inkubiert sie für 1 h bei 37 ° C und 225 rpm. Verbreiten 100 ul jeder Mischung auf einem LB-Agarplatte (10 g Pepton 140, 5 g Hefeextrakt, 12 g Agar und 1 l Wasser, pH 7,5), ergänzt mit Chloramphenicol und 4-4,5% Saccharose. Inkubieren der Kultur über Nacht bei 37 ° C. </li><li> Wählen Sie große und kleine Kolonien und Ausstrich sie auf zwei LB-Agar-Platten mit Chloramphenicol. Dann setzen die Platten entweder mit oder ohne UV-Licht für 30 Sekunden und wählen Sie die UV-empfindlichen Kolonien zur weiteren Analyse. </li><li> Identifizieren Sie die modifizierten BAC-DNA durch PCR unter Verwendung tdTomato / IL-22 heterozygot Primer (Forward: 5 &#39;ACT TGT GCG ATC TCT GAT ggT; Reverse: 5&#39; TGT AAT Cgg ggA TGT Cgg C). Die Thermocycler-Bedingungen sind wie folgt: 95 ° C für 2 min; 30 Zyklen von 95 ° C für 30 sec, 56 ° C für 30 sec, und 72 ° C für 30 sec; und eine abschließende Extension bei 72 ° C für 10 min. </li><li> Bestätigen die Sequenz des modifizierten Bereich des BAC durch direkte Sequenzierung BAC groß prep BAC DNA 12. </li><li> Anästhesieren einen Empfänger-Maus mit einer Dosis von 0,25% Tribromethanol in die Bauchhöhle bei der mikroinjizierten Zygoten in pseudo-schwangeren C57BL / 6c Mäuse implantiert. </li><li> Linearisieren der IL-22-tdTomato BAC (10 &amp; mgr; g) durch Verdau mit 5 ul Restriktions endonucleasePi-SceI in 100 &amp; mgr; l des Reaktionssystems zu konstruieren und die linearisierte BAC DNA in befruchtete Eier von C57BL / 6 - Weibchen im Vorkernstadium 13 microinject. Screen den transgenen Mäusen durch Southern-Blot-Analyse von DNA aus Schwanzbiopsien unter Verwendung von Standardverfahren isoliert. </li></ol> 2. Single-Zell-Herstellung aus Milzen, Thymus, Lymphknoten und Peyer-Patch- HINWEIS: IL-22-tdTomato Reporter-Mäuse am National Cancer Institute (NCI, Frederick, MD) gehalten wurden. Die Euthanasie-Verfahren entspricht den neuesten AVMA Richtlinien zur Euthanasie. Alle Mäuse wurden unter Verwendung von CO 2 Inhalation 14 euthanasiert. <ol><li> Euthanize eine IL-22-tdTomato Maus in einem CO 2 Kammer und legte es auf eine saubere Unterlage. Sterilisieren Sie den Bauch Haut um 70% Alkohol besprühen und schneiden Sie es auf. Entfernen Sie die Milz in der linken Flanke und den Thymus hinter dem Brustbein. </li><li> Um die mesentericlymph Knoten ernten (im mesenterialen Gewebe befindet) und Peyer-Plaques (kleine lymphoidnodules im gesamten Ileum Bereich des Dünndarms), nehmen Sie die Perlweiß mesenteric Knoten der Nähe ter Wand des Dünndarms Zange mit ersten feinen Punkt geriffelten Spitzen mit sezieren und entfernen Sie den gesamten Dünndarm und Dickdarm aus dem Körper heraus. Finden Sie die erweiterte ovale Patches (Peyer-Plaques) entlang des Darms und schneiden Sie sie mit einer Schere. Grind diese Lymphgewebe (Lymphknoten und Peyer-Plaques), die einzeln zwischen zwei mattierten Folien in eine Einzelzellsuspension in PBS / 1% fötalem Rinderserum (FBS) Puffer auf Eis. </li><li> Zerhacken der Milz oder Thymus-Gewebe unter Verwendung des gleichen Verfahrens wie in Schritt 2.2. Zentrifugieren Sie die Milz- Suspension für 8 min bei 500 × g und 4 ° C. 1 ml ACK Lysepuffer pro Milz an die Zellpellets. </li><li> Gut mischen und lassen Sie sie für 1 min stehen. Hinzufügen 9 ml steriler phosphatgepufferter Kochsalzlösung (PBS) -Puffer zu jeder Probe. Zentrifugieren durch Zentrifugation für 8 min bei 500 xg und 4 ° C, um die roten Blutkörperchen zu entfernen. HINWEIS: Verwenden Sie keine ACK Lysepuffer in den Thymus-Zellen hinzuzufügen. </li><li> Resuspendieren der resultierenden Leukocyten in 5 ml PBS und pass die Zellen durch ein 100 &amp; mgr; m Zelle Sieb. Sammle die Zellpellets durch Zentrifugation bei 500 × g für 8 min. </li><li> Resuspendieren der Zellen in 5 ml RPMI-Medium oder FACS-Puffer und zählt die lebensfähigen Zellen 0,4% Trypanblau-Farbstoff / PBS-Lösung. </li></ol> 3. Isolierung von intraepitheliale Lymphozyten und Lamina propria Zellen aus den Därmen <ol><li> Öffnen Sie die Bauchhaut, wie in Schritt 2.1, schneiden Sie den Dünndarm, von Duodenum (neben dem Magen) zu Ileum (in der Nähe der Anlage) und das gesamte Kolon, direkt über dem Anus. Entfernen Sie die zusätzlichen Fett- und mesenterialen Gewebe mit einer Pinzette. Setzen Sie den Darm sofort in eiskaltem PBS. </li><li> Geben Sie für Peyer-Plaques (kleine, raue Knoten) entlang dem distalen Bereich des Dünndarms. Entfernen Sie die Massen mit einer Pinzette andopen den Darm der Länge nach einer Schere. Gründlich spülen Darm mit 10 ml eiskaltem PBS. </li><li> Inkubieren des Gewebes in 20 ml vorgeVerdauungsPuffer (5 mM EDTAund 1 mM Dithiothreitol in Hanks Balanced Salt Solution (HBSS)) für 30 min bei 37 ° C unter langsamer Rotation (50 rpm) in einem Schüttler. Nach jedem von 2 Inkubationen, entfernen Sie die epithelialen Zellschicht, die intraepitheliale Lymphozyten (IELs), durch intensive Verwirbelung (30 sec bei 12.000 Umdrehungen pro Minute) und übergeben alle Gewebe durch ein 100 &amp; mgr; m Zelle Sieb enthält. </li><li> 20 ml neuer EDTA-Lösung auf das Gewebe für die zweite Inkubation für 30 min bei 37 ° C. Führen Sie die IEL Fraktionen durch ein 100 &amp; mgr; m Zellsieb und sie gemeinsam mit den bisherigen Fraktionen. Halten Sie die verbleibenden Darm-Fragmente auf Eis werden in Schritt 3.9 behandelt. </li><li> Zentrifugiere die gepoolten Fraktionen IEL bei 800 xg für 5 min bei 4 ° C. Waschen der vereinigten IEL Fraktionen mit 10 ml HBSS / 5% FBS und Spin sie bei 800 xg für 5 min nach unten und 4 ° C. </li><li> Resuspendieren der Zellen in 8 ml 44% kolloidales Siliciumdioxid Medium 15 und überlagern sie mit 5 ml 67% kolloidales Siliciumdioxid Medium. Zentrifugieren Sie die 44% / 670,5% Zellgemisch Gradienten für 20 min bei Raumtemperatur und 1500 x g. </li><li> Sammeln Sie die IEL-Zellen aus dem Band an der Schnittstelle. Entfernen Sie zuerst die oberste Schicht des Überstandes (ca. 5 ml) unter Verwendung von 1 ml Pipette. Dann Ernte IELs an der Phasen des kolloidalen Silica mit mittlerer Steigung. </li><li> Waschen Sie die IELs von 10 ml RPMI-Medium hinzugefügt wird. Drehen Sie die Zellen nach unten für 5 Minuten bei 800 × g und 4 ° C. Resuspendieren der IELs in 5 ml RPMI für Schritt 3.15. </li><li> Zur Isolierung der Lamina propria-Lymphozyten (LPLs), Hackfleisch Darm Gewebefragmente aus Schritt 3.4 in kleine Stücke Schere (1 mm) und zu verdauen, die Stücke mit 10 ml Aufschlusspuffer (0,05 g Kollagenase, 0,05 g DNaseI verwenden, und 0,3 g Dispase II in RPMI / 5% FBS) für 15-20 min bei 37 ° C. </li><li> Filtern des Gemisches durch eine 70 &amp; mgr; m Zellsieb. Die Durchflussüberstand enthält das frei LPL. </li><li> verdauen Voll Darm-Fragmente durch Schritte 3,9-3,10 Wiederholung (in der Regel müssen sie sein3-mal wiederholt). Jedes Mal, bündeln die Überstände der LPLs enthält. </li><li> Sammle die Zellen durch Zentrifugation für 5 min bei 1500 xg und Raumtemperatur und Resuspendieren der Pellets in RPMI / 5% FBS. Übergeben sie durch ein 40 &amp; mgr; m Zelle Sieb. </li><li> Resuspendieren der Zellpellets in 10 ml der 40% Anteil an einem 40:80 kolloidalen mittlerer Steigung Kieselsäure und überziehe sie auf 5 ml der 80% Fraktion in einem 15-ml-Tube. </li><li> Führen des Dichtegradienten Trennung durch Zentrifugation für 20 min bei 1500 xg und Raumtemperatur 15. </li><li> Sammeln Sie die LPLs, wie in Schritt 3.7 beschrieben. Wasche sie einmal mit 10 ml PBS und Resuspendieren der Pellets in 1 ml PBS / 1% FBS RPMI Medium oder Puffer. </li><li> Zählen Sie die lebenden Zellen (beide IELs und LPLs) unter Verwendung von 0,4% Trypanblaufarbstoff / PBS-Lösung. </li></ol> 4. Expression von IL-22-tdTomato in Kolitis <ol><li> Bereiten einzelnen Milzzellsuspensionen von IL-22-tdTomato Mäusen bei einer Konzentration von 1 x 10 &lt;sup&gt; 7 Zellen / ml in sterilem PBS, wie 2,1-2,4 in Schritten beschrieben. </li><li> Reinige die CD4 + T - Zellen der Maus CD4 - Zell Negative Isolation Methode unter Verwendung von 10. Etikettieren sie mit anti-CD4-APC (Klon RM4-5, 0,5 &amp; mgr; l / 1 x 10 6 Zellen in PBS / 1% FBS - Puffer) und anti-CD45RB-FITC (Klon 16A, 0,5 &amp; mgr; l / 1 x 10 6 Zellen in PBS FBS Puffer / 1%) durch Inkubation bei 4 ° C für 30 min. </li><li> Drehen Sie die Zellen nach unten für 5 Minuten bei 500 × g und 4 ° C. Waschen Sie die Zellen mit 2 ml PBS / 1% FBS-Puffer und Resuspension sie in 1 ml PBS / 1% FBS Färbepuffer. </li><li> Führen Sie die markierten T - Zellen auf einer Durchflusszytometrie Maschine 16. Tor die Zellen auf einer T-Zell - Population und Art CD4 + CD45RB hoch doppelt positiven Zellen (die Wellenlänge bei 488 nm detektiert und 633 nm Laser). </li><li> Ernte der sortierten Zellen durch Zentrifugation für 5 min bei 500 xg und 4 ° C. Resuspension der Zellpellets in sterile PBS - Puffer auf 1 x 10 &amp; sup6 ; </sup&gt; Zellen / ml. Injizieren der Zellen (0,5 x 10 6) in das Peritoneum ofeach Rag1 - / - Empfängermaus. </li><li> Opfern , um die Empfängermäuse unter CO 2 zu verschiedenen Zeitpunkten. Ernten die mesenteriale Lymphknoten und die Dünn- und Dickdarm, wie in den Schritten 2.1 und 2.2 beschrieben. Setzen Sie jeden Mesenteriallymphknoten und aufgeschnittenem Darm (Papier / Darm / Papier Sandwich) in 4% Paraformaldehyd (PFA; Griff unter einem Abzug) über Nacht das Gewebe zu reparieren. Ersetzen Sie die PFA mit 18% Saccharose für 16-24 h und dann das Gewebe einzufrieren für das Schneiden. </li><li> Verwenden Sie den Kryostaten Maschine des Gewebes 17, 18, 19 zu schneiden. Warm die Gewebeabschnitte auf Raumtemperatur für ca. 60 min und sie in Aceton für 10 min bei Raumtemperatur. Trocknen Sie sie bei Raumtemperatur für ca. 5 min. </li><li> In FBS über, entfernen Sie sie mit einer Pipette, und fügen Sie anti-RFP bei einer 1: 200-Verdünnung in 0,1% BSA / 1x PBS. Inkubieren des Antikörpers bei 37 ° C für 60 min. </li><li> Spülen Sie die Abschnitte in 1x PBS für 10 min und Anwendung der entsprechenden Sekundärantikörper (Ziege-anti-Kaninchen-568) auf das Gewebe, verdünnt 1: 300 in 1% BSA / 1x PBS, für 30 min bei Raumtemperatur. </li><li> Spülen Sie Dias in 1x PBS für 10 min, wischen Sie sie trocken und Deck hinzuzufügen. </li><li> Visualisieren Sie alle Proben mit einem Fluoreszenzmikroskop unter gleichmäßige Ausleuchtung (RFP: Anregungsfilter 540-580 nm), um das 40X-Objektiv verwendet wird. </li></ol>

<ol>
	<li>Awasthi, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cutting+edge:+IL-23+receptor+gfp+reporter+mice+reveal+distinct+populations+of+IL-17-producing+cells.">Cutting edge: IL-23 receptor gfp reporter mice reveal distinct populations of IL-17-producing cells.</a> J Immunol. 182, 5904-5908 (2009).</li><li>Price, A. E., Reinhardt, R. L., Liang, H. E., Locksley, R. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Marking+and+quantifying+IL-17A-producing+cells+in+vivo.">Marking and quantifying IL-17A-producing cells in vivo.</a> PLoS One. 7, e39750 (2012).</li><li>Kamanaka, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Expression+of+interleukin-10+in+intestinal+lymphocytes+detected+by+an+interleukin-10+reporter+knockin+tiger+mouse.">Expression of interleukin-10 in intestinal lymphocytes detected by an interleukin-10 reporter knockin tiger mouse.</a> Immunity. 25, 941-952 (2006).</li><li>Sonnenberg, G. F., Fouser, L. A., Artis, D. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Border+patrol:+regulation+of+immunity,+inflammation+and+tissue+homeostasis+at+barrier+surfaces+by+IL-22.">Border patrol: regulation of immunity, inflammation and tissue homeostasis at barrier surfaces by IL-22.</a> Nat Immunol. 12, 383-390 (2011).</li><li>Dumoutier, L., Louahed, J., Renauld, J. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cloning+and+characterization+of+IL-10-related+T+cell-derived+inducible+factor+(IL-TIF),+a+novel+cytokine+structurally+related+to+IL-10+and+inducible+by+IL-9.">Cloning and characterization of IL-10-related T cell-derived inducible factor (IL-TIF), a novel cytokine structurally related to IL-10 and inducible by IL-9.</a> J Immunol. 164, 1814-1819 (2000).</li><li>Cella, M., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+human+natural+killer+cell+subset+provides+an+innate+source+of+IL-22+for+mucosal+immunity.">A human natural killer cell subset provides an innate source of IL-22 for mucosal immunity.</a> Nature. 457, 722-725 (2009).</li><li>Sanos, S. L., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=RORgammat+and+commensal+microflora+are+required+for+the+differentiation+of+mucosal+interleukin+22-producing+NKp46++cells.">RORgammat and commensal microflora are required for the differentiation of mucosal interleukin 22-producing NKp46+ cells.</a> Nat Immunol. 10, 83-91 (2009).</li><li>Spits, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Innate+lymphoid+cells--a+proposal+for+uniform+nomenclature.">Innate lymphoid cells--a proposal for uniform nomenclature.</a> Nat Rev Immunol. 13, 145-149 (2013).</li><li>Mazzucchelli, R. I., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Visualization+and+identification+of+IL-7+producing+cells+in+reporter+mice.">Visualization and identification of IL-7 producing cells in reporter mice.</a> PLoS One. 4, e7637 (2009).</li><li>Shen, W., Hixon, J. A., McLean, M. H., Li, W. Q., Durum, S. K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IL-22-Expressing+Murine+Lymphocytes+Display+Plasticity+and+Pathogenicity+in+Reporter+Mice.">IL-22-Expressing Murine Lymphocytes Display Plasticity and Pathogenicity in Reporter Mice.</a> Front Immunol. 6, 662 (2015).</li><li>Gong, S., Yang, X. W., Li, C., Heintz, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Highly+efficient+modification+of+bacterial+artificial+chromosomes+(BACs)+using+novel+shuttle+vectors+containing+the+R6Kgamma+origin+of+replication.">Highly efficient modification of bacterial artificial chromosomes (BACs) using novel shuttle vectors containing the R6Kgamma origin of replication.</a> Genome Res. 12, 1992-1998 (2002).</li><li>Shen, W., Huang, Y., Tang, Y., Liu, D. P., Liang, C. C. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=A+general+method+to+modify+BACs+to+generate+large+recombinant+DNA+fragments.">A general method to modify BACs to generate large recombinant DNA fragments.</a> Mol Biotechnol. 31, 181-186 (2005).</li><li>Cho, A., Haruyama, N., Kulkarni, A. B. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Generation+of+transgenic+mice.">Generation of transgenic mice.</a> Curr Protoc Cell Biol. Chapter. Chapter 19, Unit 19 11 (2009).</li><li>Danneman, P. J., Stein, S., Walshaw, S. O. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Humane+and+practical+implications+of+using+carbon+dioxide+mixed+with+oxygen+for+anesthesia+or+euthanasia+of+rats.">Humane and practical implications of using carbon dioxide mixed with oxygen for anesthesia or euthanasia of rats.</a> Lab Anim Sci. 47, 376-385 (1997).</li><li>Omata, Y., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Isolation+of+coccidian+enteroepithelial+stages+of+Toxoplasma+gondii+from+the+intestinal+mucosa+of+cats+by+Percoll+density-gradient+centrifugation.">Isolation of coccidian enteroepithelial stages of Toxoplasma gondii from the intestinal mucosa of cats by Percoll density-gradient centrifugation.</a> Parasitol Res. 83, 574-577 (1997).</li><li>Kumar, N., Borth, N. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Flow-cytometry+and+cell+sorting:+an+efficient+approach+to+investigate+productivity+and+cell+physiology+in+mammalian+cell+factories.">Flow-cytometry and cell sorting: an efficient approach to investigate productivity and cell physiology in mammalian cell factories.</a> Methods. 56, 366-374 (2012).</li><li>Fischer, A. H., Jacobson, K. A., Rose, J., Zeller, R. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cryosectioning+tissues.">Cryosectioning tissues.</a> CSH Protoc. 2008, pdb.prot4991 (2008).</li><li>Hilbe, W., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Comparison+of+automated+cellular+imaging+system+and+manual+microscopy+for+immunohistochemically+stained+cryostat+sections+of+lung+cancer+specimens+applying+p53,+ki-67+and+p120.">Comparison of automated cellular imaging system and manual microscopy for immunohistochemically stained cryostat sections of lung cancer specimens applying p53, ki-67 and p120.</a> Oncol Rep. 10, 15-20 (2003).</li><li>Suzuki, Y., Furukawa, M., Abe, J., Kashiwagi, M., Hirose, S. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Localization+of+porcine+trappin-2+(SKALP/elafin)+in+trachea+and+large+intestine+by+in+situ+hybridization+and+immunohistochemistry.">Localization of porcine trappin-2 (SKALP/elafin) in trachea and large intestine by in situ hybridization and immunohistochemistry.</a> Histochem Cell Biol. 114, 15-20 (2000).</li><li>Wolk, K., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IL-22+increases+the+innate+immunity+of+tissues.">IL-22 increases the innate immunity of tissues.</a> Immunity. 21, 241-254 (2004).</li><li>Brand, S., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IL-22+is+increased+in+active+Crohn's+disease+and+promotes+proinflammatory+gene+expression+and+intestinal+epithelial+cell+migration.">IL-22 is increased in active Crohn's disease and promotes proinflammatory gene expression and intestinal epithelial cell migration.</a> Am J Physiol Gastrointest Liver Physiol. 290, G827-G838 (2006).</li><li>Nagalakshmi, M. L., Rascle, A., Zurawski, S., Menon, S., Waal Malefyt, d. e., R, <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interleukin-22+activates+STAT3+and+induces+IL-10+by+colon+epithelial+cells.">Interleukin-22 activates STAT3 and induces IL-10 by colon epithelial cells.</a> Int Immunopharmacol. 4, 679-691 (2004).</li><li>Maloy, K. J., Powrie, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intestinal+homeostasis+and+its+breakdown+in+inflammatory+bowel+disease.">Intestinal homeostasis and its breakdown in inflammatory bowel disease.</a> Nature. 474, 298-306 (2011).</li><li>Andoh, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Interleukin-22,+a+member+of+the+IL-10+subfamily,+induces+inflammatory+responses+in+colonic+subepithelial+myofibroblasts.">Interleukin-22, a member of the IL-10 subfamily, induces inflammatory responses in colonic subepithelial myofibroblasts.</a> Gastroenterology. 129, 969-984 (2005).</li><li>Bhan, A. K., Mizoguchi, E., Smith, R. N., Mizoguchi, A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Colitis+in+transgenic+and+knockout+animals+as+models+of+human+inflammatory+bowel+disease.">Colitis in transgenic and knockout animals as models of human inflammatory bowel disease.</a> Immunol Rev. 169, 195-207 (1999).</li><li>Mombaerts, P., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spontaneous+development+of+inflammatory+bowel+disease+in+T+cell+receptor+mutant+mice.">Spontaneous development of inflammatory bowel disease in T cell receptor mutant mice.</a> Cell. 75, 274-282 (1993).</li><li>Powrie, F. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Immune+regulation+in+the+intestine:+a+balancing+act+between+effector+and+regulatory+T+cell+responses.">Immune regulation in the intestine: a balancing act between effector and regulatory T cell responses.</a> Ann N Y Acad Sci. 1029, 132-141 (2004).</li><li>Ahlfors, H., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=IL-22+fate+reporter+reveals+origin+and+control+of+IL-22+production+in+homeostasis+and+infection.">IL-22 fate reporter reveals origin and control of IL-22 production in homeostasis and infection.</a> J Immunol. 193, 4602-4613 (2014).</li></ol>

The authors have nothing to disclose.

IL-22 spielt eine wesentliche Rolle bei der angeborenen Immunabwehr und Gewebeumbau. IL-22-produzierenden Zellen wurden ex vivo durch intrazelluläre Anfärbung identifiziert. Allerdings bleibt es immer noch schwierig , IL-22 - Expression in situ zu verfolgen, entweder im normalen Zustand oder in entzündlichen Erkrankungen. Dieses Protokoll beschreibt ein neues Verfahren ein IL-22 - Reporter Mausmodell, das uns die Reporter-exprimierenden Zellen in vivo zu lokalisieren ermöglicht zu entwicke...

Zelltyp-spezifische Expression von Reportergenen ist nützlich exprimierenden Zellen in das Zielgewebe unter homöostatischen und gestörter Zustände aktiv zu identifizieren. Es ermöglicht auch die Reinigung dieser Zellen, die lebensfähig bleiben, ihre anderen Eigenschaften zu untersuchen. Reporter-Mäuse wurden bei der Aufklärung der Wirkmechanismus für bestimmte Zytokine, Transkriptionsfaktoren und regulatorische Elemente verwendet. Bisherigen Strategien 1, 2, 3 haben sich auf Klopfen der Reporter in den Ziel - Locus in der Maus - Chromosom, ein zeitraubende und kostspieliges Verfahren weitgehend verlassen. Somit ist eine einfachere Methode zur Erzeugung von Reportermäusen wünschenswert. Cytokine sind eine breite Klasse von kleinen, sekretierte Proteine ​​/ Peptide, die Immunreaktionen durch interzelluläre Signalübertragung regulieren. Interleukin 22 (IL-22) ist ein Zytokin mit vielen Aktivitäten berichtet, einschließlich Barriere function, die Reparatur von Gewebe und Entzündungen 4. Obwohl IL-22 anfangs als T-Zellprodukt 5 demonstrierte nachfolgende entdeckt wurde berichtet seine Expression in natürlichen Killer (NK) -Zellen in Menschen und Mäusen 6 7 und in anderen Klassen von angeborenen Lymphozyten 8. Trotz intensiver Beobachtung von IL-22-produzierenden Zellen, die Visualisierung von IL-22 bisher erforderlichen ex vivo Stimulation und Permeabilisierung zu Flecken mit Antikörpern. Daher wäre Roman IL-22-Reporter-Mäuse ein sehr nützliches Werkzeug, um die Funktion von IL-22 in Homöostase und pathogenen Prozessen zu untersuchen. Hier entwickelten wir ein vereinfachtes transgenes Mausmodell reporter die IL-22-produzierenden Zellen in vivo und in vitro zu beobachten. Mit Hilfe eines BAC Recombineering Methode 9, legten wir die tdTomato cDNA - Sequenz mit Poly - A - Signal - Fragmente in die IL-22 locuns und ersetzt Exon 1. Die anderen untranslatierten Regionen, Exons und regulatorische Elemente nicht gestört wurden, da wir die natürliche Regulation von IL-22, so viel wie möglich zu imitieren möchten. Der Ort der Reporter Insertion unterbricht die Signalsequenz, was zu der Ansammlung des Reporter innerhalb der produzierenden Zellen, im Gegensatz zu IL-22 selbst, die schnell ausgeschieden wird. Dieses neue Verfahren kann auch zur Erzeugung von Reportermäusen für andere sekretierte Proteine ​​angewendet werden.

<table border="0" cellpadding="0" cellspacing="0" width="775">
	<tbody>
		<tr height="21">
			<td height="21" style="height:21px;width:164px;">RP23-401E11 BAC</td>
			<td style="width:151px;">Thermo Fisher Scientific</td>
			<td style="width:116px;">RPCI23.C</td>
			<td style="width:345px;">Need gene ID: 50929</td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:164px;">NucleoBond BAC 100</td>
			<td style="width:151px;">Takara Clontech</td>
			<td style="width:116px;">740579</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:164px;">PCR SuperMix High Fidelity</td>
			<td style="width:151px;">Thermo Fisher Scientific</td>
			<td style="width:116px;">10790020</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:164px;">PI-SceI</td>
			<td style="width:151px;">New England Biolabs</td>
			<td style="width:116px;">R0696S</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:164px;">SpeI</td>
			<td style="width:151px;">New England Biolabs</td>
			<td style="width:116px;">R0133S</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:164px;">LB Broth</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:116px;">10855-001</td>
			<td style="width:345px;">1L: 10 g SELECT Peptone 140, 5 g SELECT Yeast Extract, 5 g sodium chloride&#160;</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:164px;">Anti-mouse CD3</td>
			<td style="width:151px;">eBioscience</td>
			<td style="width:116px;">11-0031</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:164px;">Anti-mouse CD4</td>
			<td style="width:151px;">eBioscience</td>
			<td style="width:116px;">17-0041</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:164px;">Anti-mouse CD45</td>
			<td>Thermo Fisher Scientific</td>
			<td style="width:116px;">MCD4530</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:164px;">Anti-mouse CD45RB</td>
			<td style="width:151px;">eBioscience</td>
			<td style="width:116px;">11-0455</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:164px;">Anti-mouse RFP</td>
			<td style="width:151px;">Abcam</td>
			<td style="width:116px;">Ab62341</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:164px;">HBSS, no calcium, no magnesium, no phenol red</td>
			<td style="width:151px;">Thermo Fisher Scientific</td>
			<td style="width:116px;">14175145</td>
			<td style="width:345px;">KCl, KH2PO4, Na2HPO4, NaHCO3, NaCl, D-Glucose</td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:164px;">Dnase I</td>
			<td style="width:151px;">Roche</td>
			<td style="width:116px;">10104159001</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:164px;">ACK lysing buffer</td>
			<td style="width:151px;">Thermo Fisher Scientific</td>
			<td style="width:116px;">A1049201</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:164px;">Percoll</td>
			<td style="width:151px;">GE healthcare life sciences</td>
			<td style="width:116px;">17-0891-01</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:164px;">Collagenase D</td>
			<td style="width:151px;">Roche</td>
			<td style="width:116px;">11088858001</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:164px;">Dispase II (neutral protease, grade II)</td>
			<td style="width:151px;">Roche</td>
			<td style="width:116px;">4942078001</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:164px;">IX70 inverted fluorescence microscope</td>
			<td style="width:151px;">Olympus</td>
			<td style="width:116px;"></td>
			<td style="width:345px;">Ask for quote</td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:164px;">Nikon Eclipse 80i microscope</td>
			<td style="width:151px;">Nikon</td>
			<td style="width:116px;"></td>
			<td style="width:345px;">Ask for quote</td>
		</tr>
		<tr height="61">
			<td height="61" style="height:61px;width:164px;">Dynal shaker</td>
			<td style="width:151px;">Electron Microscopy Science</td>
			<td style="width:116px;">61050-10</td>
			<td style="width:345px;"></td>
		</tr>
		<tr height="21">
			<td height="21" style="height:21px;width:164px;">FACSAria</td>
			<td style="width:151px;">BD Bioscience</td>
			<td style="width:116px;"></td>
			<td style="width:345px;">Ask for quote</td>
		</tr>
		<tr height="41">
			<td height="41" style="height:41px;width:164px;">LSRII SORP/flow cytometry</td>
			<td style="width:151px;">Becton, Dickinson and Company&#160;</td>
			<td style="width:116px;"></td>
			<td style="width:345px;">Ask for quote</td>
		</tr>
	</tbody>
</table>

visualization of il-22-expressing lymphocytes using reporter mice

Reporter-Mäuse wurden weithin verwendet, um die Lokalisierung der Expression von Genen gezielt zu beobachten. Dieses Protokoll konzentriert sich auf eine Strategie einen neuen transgenen Reporter Mausmodell zu etablieren. Wir entschieden uns für Interleukin (IL) 22 Genexpression zu visualisieren, da dieses Zytokin wichtige Aktivitäten im Darm hat, wo sie einen Beitrag durch eine Entzündung beschädigte Gewebe zu reparieren. Reporter - Systeme bieten erhebliche Vorteile gegenüber anderen Methoden der Produkte in vivo zu identifizieren. Im Falle von IL-22, hatte andere Studien ersten Zellen aus Geweben isoliert und dann die Zellen in vitro erneut stimuliert. IL-22, das normalerweise ausgeschieden wird, wurde in den Zellen unter Verwendung eines Arzneimittels gefangen, und die intrazelluläre Färbung wurde verwendet, um es zu visualisieren. Dieses Verfahren identifiziert Zellen, die Herstellung von IL-22, aber nicht bestimmen , ob sie in vivo Dabei wurden. Der Reporter Design enthält ein Gen für ein fluoreszierendes Protein (tdTomato) in den IL-22-Gen in einer solchen wa Einfügeny , die das fluoreszierende Protein nicht sezerniert werden und bleibt daher in den produzierenden Zellen in vivo gefangen. Fluoreszierende Produzenten können dann in Gewebeschnitten oder durch ex vivo Analyse durch Durchflusszytometrie visualisiert werden. Die eigentlichen Bauprozess für die Reporter enthalten ein bakterielles künstliches Chromosom Recombineering, die die IL-22-Gen enthielt. Dieses erzeugte Chromosom wurde dann in das Mausgenom eingeführt. Homöostatischen IL-22-Reporter-Expression in verschiedenen Mausgeweben, einschließlich der Milz, Thymus, Lymphknoten, Peyerschen Plaques und Darm, durch Durchflusszytometrie-Analyse beobachtet. Kolitis wurde von T-Zellen (CD4 + CD45RBhigh) Transfer induziert und Reporterexpression sichtbar gemacht wurde. Positive T-Zellen wurden zunächst die in den mesenterischen Lymphknoten und dann akkumuliert sie in der Lamina propria des distalen Dünndarm und Dickdarm Gewebe. Die Strategie BACs gab gute Treue Reporterexpression im Vergleich zu IL-22 Expres mitsion, und es ist einfacher als Knock-in-Verfahren.

Ein Maus - IL-22 Reporter - Transgen wurde unter Verwendung von Recombineering erstellt eine bakterielle künstliche Chromosom tragen die IL-22 - Locus zu ändern. Figur 1 zeigt ein Diagramm von pBACe3.6 Vektor , der das Gen sacBII, einen positiven Selektionsmarker enthält, und Chloramphenicol - Antibiotikum - Resistenzgen 11. Nach der Einführung tdTomato in Exon 1 wurde die Signalpeptidsequenz unterbrochen wird , wie in Abbildu...

Watch this Scientific Journal Video about Visualization of IL-22-expressing Lymphocytes Using Reporter Mice at JoVE.com

Visualization of IL-22-expressing Lymphocytes Using Reporter Mice

We describe here a transgenic reporter mouse model to visualize the IL-22-producing cells inside different mouse tissues. This method can be used to track the location of other cytokines or secretary proteins in the mouse.

Visualisierung von IL-22-exprimierenden Lymphozyten unter Verwendung Reporter Mäuse

Reporter mice have been widely used to observe the localization of expression of targeted genes. This protocol focuses on a strategy to establish a new ...

visualization-of-il-22-expressing-lymphocytes-using-reporter-mice

Research

JoVE Journal

Immunology and Infection

8.7K Aufrufe.  National Cancer Institute, National Institutes of Health. We describe here a transgenic reporter mouse model to visualize the IL-22-producing cells inside different mouse tissues. This method can be used to track the location of other cytokines or secretary proteins in the mouse. 

Serie: Visualization of IL-22-expressing Lymphocytes Using Reporter Mice

Visualization of Bacterial Toxin Induced Responses Using Live Cell Fluorescence Microscopy

Bacterial toxins bind to cholesterol in membranes, forming pores that allow for leakage of cellular contents and influx of materials from the external environment. The cell can either recover from this insult, which requires active membrane repair processes, or else die depending on the amount of toxin exposure and cell type1. In addition, these toxins induce strong inflammatory responses in infected hosts through activation of immune cells, including macrophages, which produce an array of pro-inflammatory cytokines2. Many Gram positive bacteria produce cholesterol binding toxins which have been shown to contribute to their virulence through largely uncharacterized mechanisms.
Morphologic changes in the plasma membrane of cells exposed to these toxins include their sequestration into cholesterol-enriched surface protrusions, which can be shed into the extracellular space, suggesting an intrinsic cellular defense mechanism3,4. This process occurs on all cells in the absence of metabolic activity, and can be visualized using EM after chemical fixation4. In immune cells such as macrophages that mediate inflammation in response to toxin exposure, induced membrane vesicles are suggested to contain cytokines of the IL-1 family and may be responsible both for shedding toxin and disseminating these pro-inflammatory cytokines5,6,7. A link between IL-1&beta; release and a specific type of cell death, termed pyroptosis has been suggested, as both are caspase-1 dependent processes8. To sort out the complexities of this macrophage response, which includes toxin binding, shedding of membrane vesicles, cytokine release, and potentially cell death, we have developed labeling techniques and fluorescence microscopy methods that allow for real time visualization of toxin-cell interactions, including measurements of dysfunction and death (Figure 1). Use of live cell imaging is necessary due to limitations in other techniques. Biochemical approaches cannot resolve effects occurring in individual cells, while flow cytometry does not offer high resolution, real-time visualization of individual cells. The methods described here can be applied to kinetic analysis of responses induced by other stimuli involving complex phenotypic changes in cells.

Methods for purifying the cholesterol binding toxin streptolysin O from recombinant E. coli and visualization of toxin binding to live eukaryotic cells are described. Localized delivery of toxin induces rapid and complex changes in targeted cells revealing novel aspects of toxin biology.

Visualisierung der bakteriellen Toxin induzierten Reaktionen mit Live Cell Fluoreszenzmikroskopie

Bacterial toxins bind to cholesterol in membranes, forming pores that allow for leakage of cellular contents and influx of materials from the external ...

Forschung

Immunologie und Infektion

Isolation of Lymphocytes from Mouse Genital Tract Mucosa

Mucosal surfaces, including in the gastrointestinal, urogenital, and respiratory tracts, provide portals of entry for pathogens, such as viruses and bacteria 1. Mucosae are also inductive sites in the host to generate immunity against pathogens, such as the Peyers patches in the intestinal tract and the nasal-associated lymphoreticular tissue in the respiratory tract. This unique feature brings mucosal immunity as a crucial player of the host defense system. Many studies have been focused on gastrointestinal and respiratory mucosal sites. However, there has been little investigation of reproductive mucosal sites. The genital tract mucosa is the primary infection site for sexually transmitted diseases (STD), including bacterial and viral infections. STDs are one of the most critical health challenges facing the world today. Centers for Disease Control and Prevention estimates that there are 19 million new infectious every year in the United States. STDs cost the U.S. health care system $17 billion every year 2, and cost individuals even more in immediate and life-long health consequences. In order to confront this challenge, a greater understanding of reproductive mucosal immunity is needed and isolating lymphocytes is an essential component of these studies. Here, we present a method to reproducibly isolate lymphocytes from murine female genital tracts for immunological studies that can be modified for adaption to other species. The method described below is based on one mouse.&#x2003;

An efficient way to isolate lymphocytes from mouse genital tract is described. This method takes advantage of enzyme digestion and Percoll gradient separation to allow efficient isolation. This technique is also adaptable to for use in other species

Isolierung von Lymphozyten aus Maus Genital Tract Mucosa

Mucosal surfaces, including in the gastrointestinal, urogenital, and respiratory tracts, provide portals of entry for pathogens, such as viruses and ...

Isolation and Th17 Differentiation of Na&iuml;ve CD4 T Lymphocytes

Th17 cells are a distinct subset of T cells that have been found to produce interleukin 17 (IL-17), and differ in function from the other T cell subsets including Th1, Th2, and regulatory T cells. Th17 cells have emerged as a central culprit in overzealous inflammatory immune responses associated with many autoimmune disorders. In this method we purify T lymphocytes from the spleen and lymph nodes of C57BL/6 mice, and stimulate purified CD4+ T cells under control and Th17-inducing environments. The Th17-inducing environment includes stimulation in the presence of anti-CD3 and anti-CD28 antibodies, IL-6, and TGF-&#946;. After incubation for at least 72 hours and for up to five days at 37 &#176;C, cells are subsequently analyzed for the capability to produce IL-17 through flow cytometry, qPCR, and ELISAs. Th17 differentiated CD4+CD25- T cells can be utilized to further elucidate the role that Th17 cells play in the onset and progression of autoimmunity and host defense. Moreover, Th17 differentiation of CD4+CD25- lymphocytes from distinct murine knockout/disease models can contribute to our understanding of cell fate plasticity.

Isolation and Th17 Differentiation of Na&#239;ve CD4 T Lymphocytes

With effector functions distinct from other T cell subsets, Th17 cells have been centrally implicated in inflammatory autoimmunity. This in vitro Th17 differentiation protocol provides a means to determine whether na&#239;ve CD4+ T lymphocytes can differentiate into Th17 cells, and to further examine their role in autoimmunity and host response.

Isolierung und Differenzierung von Th17 Naive CD4-T-Lymphozyten

Th17 cells are a distinct subset of T cells that have been found to produce interleukin 17 (IL-17), and differ in function from the other T cell subsets ...

Long Term Intravital Multiphoton Microscopy Imaging of Immune Cells in Healthy and Diseased Liver Using CXCR6.Gfp Reporter Mice

Liver inflammation as a response to injury is a highly dynamic process involving the infiltration of distinct subtypes of leukocytes including monocytes, neutrophils, T cell subsets, B cells, natural killer (NK) and NKT cells. Intravital microscopy of the liver for monitoring immune cell migration is particularly challenging due to the high requirements regarding sample preparation and fixation, optical resolution and long-term animal survival. Yet, the dynamics of inflammatory processes as well as cellular interaction studies could provide critical information to better understand the initiation, progression and regression of inflammatory liver disease. Therefore, a highly sensitive and reliable method was established to study migration and cell-cell-interactions of different immune cells in mouse liver over long periods (about 6 hr) by intravital two-photon laser scanning microscopy (TPLSM) in combination with intensive care monitoring.
The method provided includes a gentle preparation and stable fixation of the liver with minimal perturbation of the organ; long term intravital imaging using multicolor multiphoton microscopy with virtually no photobleaching or phototoxic effects over a time period of up to 6 hr, allowing tracking of specific leukocyte subsets; and stable imaging conditions due to extensive monitoring of mouse vital parameters and stabilization of circulation, temperature and gas exchange.
To investigate lymphocyte migration upon liver inflammation CXCR6.gfp knock-in mice were subjected to intravital liver imaging under baseline conditions and after acute and chronic liver damage induced by intraperitoneal injection(s) of carbon tetrachloride (CCl4).
CXCR6 is a chemokine receptor expressed on lymphocytes, mainly on Natural Killer T (NKT)-, Natural Killer (NK)- and subsets of T lymphocytes such as CD4 T cells but also mucosal associated invariant (MAIT) T cells1. Following the migratory pattern and positioning of CXCR6.gfp+ immune cells allowed a detailed insight into their altered behavior upon liver injury and therefore their potential involvement in disease progression.

Stable intravital high-resolution imaging of immune cells in the liver is challenging. Here we provide a highly sensitive and reliable method to study migration and cell-cell-interactions of immune cells in mouse liver over long periods (about 6 hours) by intravital multiphoton laser scanning microscopy in combination with intensive care monitoring.

Langzeitintravital Multiphotonen Mikroskopie Imaging von Immunzellen in gesunden und kranken Leber Mit CXCR6.Gfp Reporter Mäuse

Liver inflammation as a response to injury is a highly dynamic process involving the infiltration of distinct subtypes of leukocytes including monocytes, ...

Intravital Imaging of Neutrophil Priming Using IL-1&#946; Promoter-driven DsRed Reporter Mice

Neutrophils are the most abundant leukocytes in human blood circulation and are quickly recruited to inflammatory sites. Priming is a critical event that enhances the phagocytic functionality of neutrophils. Although extensive studies have unveiled the existence and importance of neutrophil priming during infection and injury, means of visualizing this process in vivo have been unavailable. The protocol provided enables monitoring of the dynamic process of neutrophil priming in living animals by combining three methodologies: 1) DsRed reporter signal &#8212; used as a measure of priming 2) in vivo neutrophil labeling &#8212; achieved by injection of fluorescence-conjugated anti-lymphocyte antigen 6G (Ly6G) monoclonal antibody (mAb) and 3) intravital confocal imaging. Several critical steps are involved in this protocol: oxazolone-induced mouse ear skin inflammation, appropriate sedation of animals, repeated injections of anti-Ly6G mAb, and prevention of focus drift during imaging. Although a few limitations have been observed, such as the limit of continuous imaging time (~ 8 hr) in one mouse and the leakage of fluorescein isothiocyanate-dextran from blood vessels in the inflammatory state, this protocol provides a fundamental framework for intravital imaging of primed neutrophil behavior and function, which can easily be expanded to examination of other immune cells in mouse inflammation models.

This current protocol employs fluorescent reporters, in vivo labeling, and intravital imaging techniques to enable monitoring of the dynamic process of neutrophil priming in living animals.

Intravital Imaging von Neutrophilen Priming Mit IL-1β Promoter-driven DsRed Reporter Mäuse

Neutrophils are the most abundant leukocytes in human blood circulation and are quickly recruited to inflammatory sites. Priming is a critical event that ...

Isolation and Activation of Murine Lymphocytes

B and T cells, with their extremely diverse antigen-receptor repertoires, have the ability to mount specific immune responses against almost any invading pathogen1,2. Understandably, such intricate abilities are controlled by a large number of molecules involved in various cellular processes to ensure timely and spatially regulated immune responses3. Here, we describe experimental procedures that allow rapid isolation of highly purified murine lymphocytes using magnetic cell sorting technology. The resulting purified lymphocytes can then be subjected to various in vitro or in vivo functional assays, such as the determination of lymphocyte signaling capacity upon stimulation by immunoblotting4 and the investigation of proliferative abilities by 3H-thymidine incorporation or carboxyfluorescein diacetate succinimidyl ester (CFSE) labeling5-7. In addition to comparing the functional capacities of control and genetically modified lymphocytes, we can also determine the T cell stimulatory capacity of antigen-presenting cells (APCs) in vivo, as shown in our representative results using transplanted CFSE-labeled OT-I T cells.

Lymphocytes are the major players in adaptive immune responses. Here, we present a lymphocyte purification protocol to determine the physiological functions of the desired molecules in lymphocyte activation in vitro and in vivo. The described experimental procedures are suitable for comparing functional capacities between control and genetically modified lymphocytes.

Isolation und Aktivierung von murinen Lymphozyten

B and T cells, with their extremely diverse antigen-receptor repertoires, have the ability to mount specific immune responses against almost any invading ...

Visualization of Biofilm Formation in Candida albicans Using an Automated Microfluidic Device

Candida albicans is the most common fungal pathogen of humans, causing about 15% of hospital-acquired sepsis cases. A major virulence attribute of C. albicans is its ability to form biofilms, structured communities of cells attached to biotic and abiotic surfaces. C. albicans biofilms can form on host tissues, such as mucosal layers, and on medical devices, such as catheters, pacemakers, dentures, and joint prostheses. Biofilms pose significant clinical challenges because they are highly resistant to physical and chemical perturbations, and can act as reservoirs to seed disseminated infections. Various in vitro assays have been utilized to study C. albicans biofilm formation, such as microtiter plate assays, dry weight measurements, cell viability assays, and confocal scanning laser microscopy. All of these assays are single end-point assays, where biofilm formation is assessed at a specific time point. Here, we describe a protocol to study biofilm formation in real-time using an automated microfluidic device under laminar flow conditions. This method allows for the observation of biofilm formation as the biofilm develops over time, using customizable conditions that mimic those of the host, such as those encountered in vascular catheters. This protocol can be used to assess the biofilm defects of genetic mutants as well as the inhibitory effects of antimicrobial agents on biofilm development in real-time.

Visualization of Biofilm Formation in Candida albicans Using an Automated Microfluidic Device

This protocol describes the use of a customizable automated microfluidic device to visualize biofilm formation in Candida albicans under host physiological conditions.

Visualisierung der Biofilmbildung in Candida Albicans ein automatisiertes mikrofluidischen Gerät

Candida albicans is the most common fungal pathogen of humans, causing about 15% of hospital-acquired sepsis cases. A major virulence attribute of C. ...

Imaging Mycobacterium tuberculosis in Mice with Reporter Enzyme Fluorescence

Reporter enzyme fluorescence (REF) utilizes substrates that are specific for enzymes present in target organisms of interest for imaging or detection by fluorescence or bioluminescence. We utilize BlaC, an enzyme expressed constitutively by all M. tuberculosis strains. REF allows rapid quantification of bacteria in lungs of infected mice. The same group of mice can be imaged at many time points, greatly reducing costs, enumerating bacteria more quickly, allowing novel observations in host-pathogen interactions, and increasing statistical power, since more animals per group are readily maintained. REF is extremely sensitive due to the catalytic nature of the BlaC enzymatic reporter and specific due to the custom flourescence resonance energy transfer (FRET) or fluorogenic substrates used. REF does not require recombinant strains, ensuring normal host-pathogen interactions. We describe the imaging of M. tuberculosis infection using a FRET substrate with maximal emission at 800 nm. The wavelength of the substrate allows sensitive deep tissue imaging in mammals. We will outline aerosol infection of mice with M. tuberculosis, anesthesia of mice, administration of the REF substrate, and optical imaging. This method has been successfully applied to evaluating host-pathogen interactions and efficacy of antibiotics targeting M. tuberculosis.

Imaging Mycobacterium tuberculosis in Mice with Reporter Enzyme Fluorescence

We describe the optical imaging of mice infected with Mycobacterium tuberculosis (M. tuberculosis) using reporter enzyme fluorescence (REF). This protocol facilitates the sensitive and specific detection of M. tuberculosis in pre-clinical animal models for pathogenesis, therapeutics and vaccine research.

Mycobacterium Tuberculosis in Mäusen mit Reporter Enzym Fluoreszenz Imaging

Reporter enzyme fluorescence (REF) utilizes substrates that are specific for enzymes present in target organisms of interest for imaging or detection by ...

Probiotic Studies in Neonatal Mice Using Gavage

Adult mouse models have been widely used to understand the mechanism behind disease progression in humans. The applicability of studies done in adult mouse models to neonatal diseases is limited. To better understand disease progression, host responses and long-term impact of interventions in neonates, a neonatal mouse model likely is a better fit. The sparse use of neonatal mouse models can in part be attributed to the technical difficulties of working with these small animals. A neonatal mouse model was developed to determine the effects of probiotic administration in early life and to specifically assess the ability to establish colonization in the newborn mouse intestinal tract. Specifically, to assess probiotic colonization in the neonatal mouse, Lactobacillus plantarum (LP) was delivered directly into the neonatal mouse gastrointestinal tract. To this end, LP was administered to mice by feeding through intra-esophageal (IE) gavage. A highly reproducible method was developed to standardize the process of IE gavage that allows an accurate administration of probiotic dosages while minimizing trauma, an aspect particularly important given the fragility of newborn mice. Limitations of this process include possibilities of esophageal irritation or damage and aspiration if gavaged incorrectly. This approach represents an improvement on current practices because IE gavage into the distal esophagus reduces the chances of aspiration. Following gavage, the colonization profile of the probiotic was traced using quantitative polymerase chain reaction (qPCR) of the extracted intestinal DNA with LP specific primers. Different litter settings and cage management techniques were used to assess the potential for colonization-spread. The protocol details the intricacies of IE neonatal mouse gavage and subsequent colonization quantification with LP.

This study details the process of gavaging precise amounts of probiotics to neonatal mice. The experimental set-up was optimized to include but is not limited to probiotic dosing, methods of administration, and quantification of bacteria in the intestines.

Probiotische Studien an neugeborenen Mäusen mit Magensonde

Adult mouse models have been widely used to understand the mechanism behind disease progression in humans. The applicability of studies done in adult ...

Intravital Imaging of Intraepithelial Lymphocytes in Murine Small Intestine

Intraepithelial lymphocytes expressing &#947;&#948; T cell receptor (&#947;&#948; IEL) play a key role in immune surveillance of the intestinal epithelium. Due in part to the lack of a definitive ligand for the &#947;&#948; T cell receptor, our understanding of the regulation of &#947;&#948; IEL activation and their function in vivo remains limited. This necessitates the development of alternative strategies to interrogate signaling pathways involved in regulating &#947;&#948; IEL function and the responsiveness of these cells to the local microenvironment. Although &#947;&#948; IELs are widely understood to limit pathogen translocation, the use of intravital imaging has been critical to understanding the spatiotemporal dynamics of IEL/epithelial interactions at steady-state and in response to invasive pathogens. Herein, we present a protocol for visualizing IEL migratory behavior in the small intestinal mucosa of a GFP &#947;&#948; T cell reporter mouse using inverted spinning disk confocal laser microscopy. Although the maximum imaging depth of this approach is limited relative to the use of two-photon laser-scanning microscopy, spinning disk confocal laser microscopy provides the advantage of high speed image acquisition with reduced photobleaching and photodamage. Using 4D image analysis software, T cell surveillance behavior and their interactions with neighboring cells can be analyzed following experimental manipulation to provide additional insight into IEL activation and function within the intestinal mucosa.

We describe a method to visualize GFP-labeled &#947;&#948; IELs using intravital imaging of murine small intestine by inverted spinning disk confocal microscopy. This technique enables the tracking of live cells within the mucosa for up to 4 h and can be used to investigate a variety of intestinal immune-epithelial interactions. &#160;