Todos los procedimientos de uso de animales estaban en conformidad con las normas éticas establecidas por la Junta de Gobierno Local (Regierungspräsidium Karlsruhe, Karlsruhe, Alemania). 1. Preparación del Complejo siRNA / PEI La solución de complejo de ARNsi / PEI se prepara utilizando las instrucciones del fabricante de la siguiente manera: <ol><li> Solución A: Diluir la cantidad deseada de siRNA con agua estéril (si es necesario) hasta una cuarta parte del volumen final y diluir dicha adicionalmente con una solución de glucosa al 10% hasta la mitad del volumen final. Vortex o mezclar suavemente la pipeta hacia arriba y hacia abajo. La cantidad óptima de siRNA se debe determinar empíricamente pero 1 mg siRNA en 10 l solución compleja por animal es un buen punto de partida para la optimización. </li><li> Solución B: Diluir el volumen necesario de reactivo PEI con agua estéril hasta una cuarta parte del volumen final y diluir dicha adicionalmente con una solución de glucosa al 10% hasta la mitad del volumen final. Vortex gently o mezclar pipeteando arriba y abajo. Nota: la cantidad de reactivo de PEI determina el equilibrio iónico en el complejo que influye en la eficiencia de la transfección. Del mismo modo la cantidad óptima de solución de PEI tiene que ser determinada empíricamente. En nuestras manos, la cantidad óptima es de 0,12 l de solución de PEI por 1 g de siRNA. </li><li> Mezclar la solución A con la solución B a la vez, vórtice suavemente. </li><li> Incubar la solución se mezcló durante 15 min a temperatura ambiente antes de su uso. Este complejo es estable durante 2 horas a temperatura ambiente y durante 24 horas a 4 ° C. </li></ol> 2. La inyección intratecal <ol><li> Anestesiar el ratón con el 3% isoflurano, hasta que no muestra signos de reflejo de enderezamiento. Además, compruebe si hay cola y / o la pata pizca reflex para asegurar aún más el estado de anestesia. </li><li> Shave alrededor de 2 cm 2 de piel en el extremo posterior del animal cerca de la base de la cola para facilitar una mejor visualización durante la inserción de la aguja. </li><li> Coloque el ratón enun cono de la nariz para una administración continua isoflurano durante el procedimiento, a reducir el isoflurano al 1,5%, y cubrir los ojos del ratón con lubricante ocular. </li><li> Prepare la lista para su uso siRNA solución mixta utilizando una jeringa Hamilton de 25 l adjunto a un 30 G 0,5 en la aguja. </li><li> Busque la apófisis espinosa de la L6, que debería ser el más destacado y fijar la columna de la vertebrado alrededor de esta área presionando suavemente. </li><li> Inserte cuidadosamente la aguja entre la ranura de L5 y L6 vértebras y observar por un movimiento de la cola ya que este signo indica una entrada exitosa de la aguja en el espacio intradural. Consejo: El uso de la uña, uno debe ser capaz de localizar la ranura también. </li><li> Una vez que se observa movimiento de la cola, de inmediato, pero con cuidado, asegurar la posición de la aguja con una mano e inyectar el volumen deseado de la sustancia con la otra mano lentamente. Consejo: un volumen de entre 5-10 l es óptima ya que el volumen de menos de 5 y# 181; l es poco fiable y un volumen más grande que 10 l conduce a demasiada presión. </li><li> Una vez que se realiza la inyección, mover el ratón de nuevo a la jaula para recuperarse de la anestesia. </li><li> Repita este inyección de al menos 2 veces más cada 24 horas para lograr una óptima regulación a la baja del gen diana. </li></ol>

<ol>
	<li>Hylden, J. L., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Intrathecal+morphine+in+mice:+a+new+technique.">Intrathecal morphine in mice: a new technique.</a> Eur. J. Pharmacol. 67, 313-316 (1980).</li><li>Stokes, J. A., Corr, M., Yaksh, T. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Transient+tactile+allodynia+following+intrathecal+puncture+in+mouse:+contributions+of+Toll-like+receptor+signaling.">Transient tactile allodynia following intrathecal puncture in mouse: contributions of Toll-like receptor signaling.</a> Neurosci. Lett. 504, 215-218 (2011).</li><li>Goula, D., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Polyethylenimine-based+intravenous+delivery+of+transgenes+to+mouse+lung.">Polyethylenimine-based intravenous delivery of transgenes to mouse lung.</a> Gene Ther. , 1291-1295 (1998).</li><li>Fairbanks, C. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Spinal+delivery+of+analgesics+in+experimental+models+of+pain+and+analgesia.">Spinal delivery of analgesics in experimental models of pain and analgesia.</a> Adv. Drug. Deliv. Rev. 55, 1007-1041 (2003).</li><li>Hohmann, A. G., Tsou, K., Walker, J. M. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Cannabinoid+modulation+of+wide+dynamic+range+neurons+in+the+lumbar+dorsal+horn+of+the+rat+by+spinally+administered+WIN55,212-2.">Cannabinoid modulation of wide dynamic range neurons in the lumbar dorsal horn of the rat by spinally administered WIN55,212-2.</a> Neurosci. Lett. 257, 119-122 (1998).</li><li>Song, Z. H., Takemori, A. E. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+spinal+kappa+opioid+receptors+in+the+antinociception+produced+by+intrathecally+administered+corticotropin-releasing+factor+in+mice.">Involvement of spinal kappa opioid receptors in the antinociception produced by intrathecally administered corticotropin-releasing factor in mice.</a> J. Pharmacol. Exp. Ther. 254, 363-368 (1990).</li><li>Trang, T., Sutak, M., Jhamandas, K. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Involvement+of+cannabinoid+(CB1)-receptors+in+the+development+and+maintenance+of+opioid+tolerance.">Involvement of cannabinoid (CB1)-receptors in the development and maintenance of opioid tolerance.</a> Neuroscience. , 1275-1288 (2007).</li><li>Yaksh, T. L., Rudy, T. A. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Chronic+catheterization+of+the+spinal+subarachnoid+space.">Chronic catheterization of the spinal subarachnoid space.</a> Physiol. Behav. 17, 1031-1036 (1976).</li><li>Tappe, A., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Synaptic+scaffolding+protein+Homer1a+protects+against+chronic+inflammatory+pain.">Synaptic scaffolding protein Homer1a protects against chronic inflammatory pain.</a> Nat. Med. , 677-681 (2006).</li><li>Bourinet, E., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Silencing+of+the+Cav3.2+T-type+calcium+channel+gene+in+sensory+neurons+demonstrates+its+major+role+in+nociception.">Silencing of the Cav3.2 T-type calcium channel gene in sensory neurons demonstrates its major role in nociception.</a> EMBO J. 24, 315-324 (2005).</li><li>Wang, X., et al. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Gene+transfer+to+dorsal+root+ganglia+by+intrathecal+injection:+effects+on+regeneration+of+peripheral+nerves.">Gene transfer to dorsal root ganglia by intrathecal injection: effects on regeneration of peripheral nerves.</a> Mol. Ther. 12, 314-320 (2005).</li><li>Wigdor, S., Wilcox, G. L. <a target="_blank" href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=PubMed&cmd=Search&doptcmdl=Citation&defaultField=Title+Word&term=Central+and+systemic+morphine-induced+antinociception+in+mice:+contribution+of+descending+serotonergic+and+noradrenergic+pathways.">Central and systemic morphine-induced antinociception in mice: contribution of descending serotonergic and noradrenergic pathways.</a> J. Pharmacol. Exp. Ther. 242, 90-95 (1987).</li></ol>

Los autores declaran no tener intereses financieros en competencia.

Por lo tanto, la técnica de inyecciones intratecales de aguja anteriormente descrito es eficaz, rápido, específicamente localizada-, y no destructiva. Técnicamente, el aspecto más crítico de este procedimiento es el punto de inserción de la aguja en el surco. Es crucial que este procedimiento se realiza con las manos muy tranquilas y paciencia. Como muchos procedimientos quirúrgicos, la formación mejora la tasa de éxito de la inyección. Esto también es importante porque durante un experimento real, esta téc...

La médula espinal es un centro muy importante en una variedad de procesos biológicos fundamentales y funciones fisiológicas, incluyendo el procesamiento y la transmisión de entradas dolorosas (nociceptivo) 4-7. Diversas técnicas experimentales se han desarrollado para facilitar la modulación farmacológica de la médula espinal, tales como la implantación crónica de catéteres intratecales 8, la microinyección de la médula espinal, intratecal y la aguja de inyección 9. Cada técnica tiene sus propias ventajas y desventajas, y dependiendo del paradigma experimento Una técnica podría ser más adecuado que los otros. Considerando que la implantación crónica de los catéteres intratecales es fácilmente factible en la rata, este método es muy difícil en el ratón, dadas las restricciones de tamaño. El índice de éxito es muy baja y el déficit motor a menudo se producen debido a la presencia voluminosa de un catéter en el espacio subdural severamente limitado en el ratón. Además, la administración a largo plazo de medicamentos se hace debido a la coagulación frecuentesde implantado crónicamente catéteres. Finalmente, las reacciones inmunes son comunes. Estos problemas pueden ser evitados utilizando el método de la inyección intratecal aguda a través de una aguja en la ausencia de un catéter preimplanted, que permite una aplicación rápida y anatómicamente limitado de medicamentos y reactivos a la médula espinal en ratones. Este método mantiene plenamente los beneficios de la entrega intratecal sobre otras rutas de administración sistémica (por ejemplo, oral, intravenosa, intraperitoneal, etc) tales como especificidad de la modulación espinal, que permite la reducción de las dosis y los efectos secundarios límite, así como la capacidad para entregar sustancias no hacen normalmente no atraviesan la barrera hematoencefálica ya que durante la inyección intratecal, se inserta la aguja entre la duramadre y la médula espinal. Es importante destacar sin embargo, en comparación con otros métodos de entrega intratecal, el método de inyección de aguja intratecal es el menos invasivo, lo que permite numerosas aplicaciones en lamismo animal sin causar ningún daño tisular considerable o evocando reacción inmune debido a la implantación de material extraño. Sin embargo, requiere habilidades técnicas para una orientación muy precisa de la aguja para permitir la eficacia. Este sentido, demostrar visualmente el método para alcanzar una tasa óptima de éxito para la orientación específica de la médula espinal lumbar. El sitio de la inyección que se elige en este experimento es el surco entre L5 y L6 columna de vertebrados, cerca de donde termina la médula espinal, para reducir al mínimo la posibilidad de dañar la columna vertebral. Por otra parte, se demuestra el uso de esta técnica para derribar los genes en la médula espinal utilizando siRNAs.

<table border="0" cellpadding="0" cellspacing="0" width="1012">
	<colgroup>
		<col /> 
		<col />
		<col />
		<col />
	</colgroup>
	<tbody>
		<tr height="20">
			<td height="20" style="height:20px;width:283px;">in vivo-jetPEI</td>
			<td style="width:255px;">Polyplus</td>
			<td style="width:288px;">201-10G</td>
			<td style="width:188px;"> </td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">WAVE1 siRNA</td>
			<td>Santa Cruz</td>
			<td>sc-36832</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Control siRNA-A</td>
			<td>Santa Cruz</td>
			<td>sc-37007</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Anti-&#223;-Tubulin III antibody</td>
			<td>Sigma</td>
			<td>T2200</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Anti-WAVE1 antibody</td>
			<td>R&#38;D Systems</td>
			<td>AF5514</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Fast green dye</td>
			<td>Sigma</td>
			<td>F-7252</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Isoflurane</td>
			<td>Baxter</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Isoflurane setup</td>
			<td>Dr&#228;ger L&#252;beck</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Shaver</td>
			<td>Wella</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Hamilton syringe Gastight 1702</td>
			<td>Hamilton</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">30G 1/2, 0,3 * 13mm Needle</td>
			<td>BD Microlance</td>
			<td>304000</td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">Microscope Leica MS5</td>
			<td>Leica</td>
			<td></td>
			<td></td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">WAVE1 forward primer for qRT-PCR</td>
			<td>Sigma</td>
			<td></td>
			<td>cacagagcctcaggacagg</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">WAVE1 reversed primer for qRT-PCR</td>
			<td>Sigma</td>
			<td></td>
			<td>cttttcaccaacggcatctt</td>
		</tr>
		<tr height="20">
			<td height="20" style="height:20px;">FastStart Essential DNA Green Master</td>
			<td>Roche</td>
			<td>6402712001</td>
			<td></td>
		</tr>
	</tbody>
</table>

in vivo sirna transfection and gene knockdown in spinal cord via rapid noninvasive lumbar intrathecal injections in mice

En este informe se describe una guía paso a paso a la técnica de inyecciones intratecales agujas agudas de una manera no invasiva, es decir, independiente de la implantación del catéter. La limitación técnica de esta técnica quirúrgica se encuentra en la finura de las manos. La inyección es rápida, sobre todo para un investigador entrenado, y dado que la interrupción del tejido con esta técnica es mínima, las inyecciones repetidas son posibles; reacción además inmune a las herramientas de extranjeros (por ej. Catéter) no ocurre, dando así una mejor y más específica leer en voz de la modulación de la médula espinal. Dado que la aplicación de la sustancia se limita en gran parte a la región diana de la médula espinal, los fármacos no necesitan ser aplicado en grandes dosis, y efectos más importante no deseados en otro tejido, como se observa con un suministro sistémico, pueden ser eludidas 1, 2. Además, combinamos esta técnica con la transfección in vivo de ácido nucleico con la ayuda de polyethylenimINE (PEI) de reactivo 3, que proporciona una gran versatilidad para el estudio de funciones de la médula a través de la administración de agentes farmacológicos, así como de genes, ARN, y moduladores de proteínas.

Con el fin de ilustrar una inyección de éxito, se realizó esta técnica usando Fast tinte verde FCF en ratones adultos C57Bl6 (8-10 semanas de edad). El animal se le permitió recuperarse durante unos minutos después de la inyección para dar tiempo suficiente para que el tinte se extendió y luego mató con una sobredosis de CO 2. Posteriormente, la columna de la vertebrado fue disecada y la médula espinal se expuso. El puntos lagrimales azul correspondiente al colorante difusa, marcó el sitio de la in...

Watch this Scientific Journal Video about In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice at JoVE.com

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

Este informe describe una técnica sencilla y rápida de la aguja de punción intratecal para una transfección localizada de siRNA en la médula espinal lumbar de ratón bajo anestesia de corta luz duradera.

En Vivo transfección siRNA y Gene Derribo en la médula espinal a través de Rapid no invasiva lumbar intratecal inyecciones en ratones

This report describes a step-by-step guide to the technique of acute intrathecal needle injections in a noninvasive manner, i.e. independent of catheter ...

in-vivo-sirna-transfection-gene-knockdown-spinal-cord-via-rapid

Research

JoVE Journal

Biology

In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

46.3K vistas.  University of Heidelberg.  Este informe describe una técnica sencilla y rápida de la aguja de punción intratecal para una transfección localizada de siRNA en la médula espinal lumbar de ratón bajo anestesia de corta luz duradera. 

Video: In Vivo SiRNA Transfection and Gene Knockdown in Spinal Cord via Rapid Noninvasive Lumbar Intrathecal Injections in Mice

Spinal Cord Electrophysiology

The neonatal mouse spinal cord is a model for studying the development of neural circuitries and locomotor movement. We demonstrate the spinal cord dissection and preparation of recording bath artificial cerebrospinal fluid used for locomotor studies. Once dissected, the spinal cord ventral nerve roots can be attached to a recording electrode to record the electrophysiologic signals of the central pattern generating circuitry within the lumbar cord.

A demonstration of the isolation of neonatal mouse spinal cord for electrophysiologic studies.

La médula espinal de Electrofisiología

The neonatal mouse spinal cord is a model for studying the development of neural circuitries and locomotor movement. We demonstrate the spinal cord ...

Investigación

Biología

Using an Automated Cell Counter to Simplify Gene Expression Studies: siRNA Knockdown of IL-4 Dependent Gene Expression in Namalwa Cells

The use of siRNA mediated gene knockdown is continuing to be an important tool in studies of gene expression.  siRNA studies are being conducted not only to study the effects of downregulating single genes, but also to interrogate signaling pathways and other complex interaction networks.  These pathway analyses require both the use of relevant cellular models and methods that cause less perturbation to the cellular physiology.  Electroporation is increasingly being used as an effective way to introduce siRNA and other nucleic acids into difficult to transfect cell lines and primary cells without altering the signaling pathway under investigation. There are multiple critical steps to a successful siRNA experiment, and there are ways to simplify the work while improving the data quality at several experimental stages.  To help you get started with your siRNA mediated gene knockdown project, we will demonstrate how to perform a pathway study complete from collecting and counting the cells prior to electroporation through post transfection real-time PCR gene expression analysis.  The following study investigates the role of the transcriptional activator STAT6 in IL-4 dependent gene expression of CCL17 in a Burkitt lymphoma cell line (Namalwa).  The techniques demonstrated are useful for a wide range of siRNA-based experiments on both adherent and suspension cells.  We will also show how to streamline cell counting with the TC10 automated cell counter, how to electroporate multiple samples simultaneously using the MXcell electroporation system, and how to simultaneously assess RNA quality and quantity with the Experion automated electrophoresis system.

This procedure describes a quick and easy workflow to introduce siRNA into difficult to transfect cell lines and follow gene expression by real-time PCR. Use of an automated cell counter, multi-well electroporation plate, and automated electrophoresis station provide quick and reliable results without the need for expensive robotic handling.

El uso de un contador de células automatizado para simplificar estudios de expresión génica: siRNA Derribo de IL-4 la expresión génica en células dependientes Namalwa

The use of siRNA mediated gene knockdown is continuing to be an important tool in studies of gene expression.  siRNA studies are being conducted not only ...

RNAi-mediated Gene Knockdown and In Vivo Diuresis Assay in Adult Female Aedes aegypti Mosquitoes

This video protocol demonstrates an effective technique to knockdown a particular gene in an insect and conduct a novel bioassay to measure excretion rate. This method can be used to obtain a better understanding of the process of diuresis in insects and is especially useful in the study of diuresis in blood-feeding arthropods that are able to take up huge amounts of liquid in a single blood meal. 
This RNAi-mediated gene knockdown combined with an in vivo diuresis assay was developed by the Hansen lab to study the effects of RNAi-mediated knockdown of aquaporin genes on Aedes aegypti mosquito diuresis1. 
The protocol is setup in two parts: the first demonstration illustrates how to construct a simple mosquito injection device and how to prepare and inject dsRNA into the thorax of mosquitoes for RNAi-mediated gene knockdown. The second demonstration illustrates how to determine excretion rates in mosquitoes using an in vivo bioassay.

RNAi-mediated Gene Knockdown and In Vivo Diuresis Assay in Adult Female Aedes aegypti Mosquitoes

In this protocol we combine RNAi-mediated gene silencing with an in vivo diuresis assay to study the effects knockdown of genes of interest has on mosquito fluid excretion.

RNAi mediada por Gene y Derribo<em&gt; En Vivo</em&gt; Ensayo de diuresis en Mujeres Adultas<em&gt; Aedes aegypti</em&gt; Los mosquitos

This video protocol demonstrates an effective technique to knockdown a particular gene in an insect and conduct a novel bioassay to measure excretion ...

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the messagefor review see 1. However, it's now widely accepted that synonymous codon usage is the primary cause of non-uniform translational elongation rates1. Synonymous codons are not used with identical frequency. A bias exists in the use of synonymous codons with some codons used more frequently than others2. Codon bias is organism as well as tissue specific2,3. Moreover, frequency of codon usage is directly proportional to the concentrations of cognate tRNAs4. Thus, a frequently used codon will have higher multitude of corresponding tRNAs, which further implies that a frequent codon will be translated faster than an infrequent one. Thus, regions on mRNA enriched in rare codons (potential pause sites) will as a rule slow down ribosome movement on the message and cause accumulation of nascent peptides of the respective sizes5-8. These pause sites can have functional impact on the protein expression, mRNA stability and protein foldingfor review see 9. Indeed, it was shown that alleviation of such pause sites can alter ribosome movement on mRNA and subsequently may affect the efficiency of co-translational (in vivo) protein folding1,7,10,11. To understand the process of protein folding in vivo, in the cell, that is ultimately coupled to the process of protein synthesis it is essential to gain comprehensive insights into the impact of codon usage/tRNA content on the movement of ribosomes along mRNA during translational elongation.
Here we describe a simple technique that can be used to locate major translation pause sites for a given mRNA translated in various cell-free systems6-8. This procedure is based on isolation of nascent polypeptides accumulating on ribosomes during in vitro translation of a target mRNA. The rationale is that at low-frequency codons, the increase in the residence time of the ribosomes results in increased amounts of nascent peptides of the corresponding sizes. In vitro transcribed mRNA is used for in vitro translational reactions in the presence of radioactively labeled amino acids to allow the detection of the nascent chains. In order to isolate ribosome bound nascent polypeptide complexes the translation reaction is layered on top of 30% glycerol solution followed by centrifugation. Nascent polypeptides in polysomal pellet are further treated with ribonuclease A and resolved by SDS PAGE. This technique can be potentially used for any protein and allows analysis of ribosome movement along mRNA and the detection of the major pause sites. Additionally, this protocol can be adapted to study factors and conditions that can alter ribosome movement and thus potentially can also alter the function/conformation of the protein.

Isolation of Ribosome Bound Nascent Polypeptides in vitro to Identify Translational Pause Sites Along mRNA

A technique to identify translational pause sites on mRNA is described. This procedure is based on isolation of nascent polypeptides accumulating on ribosomes during in vitro translation of a target mRNA, followed by the size analysis of the nascent chains using a denaturing gel electrophoresis.

El aislamiento de los ribosomas polipéptidos nacientes Bound<em&gt; In vitro</em&gt; Para la identificación de sitios de traslación pausa a lo largo del ARNm

The rate of translational elongation is non-uniform. mRNA secondary structure, codon usage and mRNA associated proteins may alter ribosome movement on the ...

Using SecM Arrest Sequence as a Tool to Isolate Ribosome Bound Polypeptides

Extensive research has provided ample evidences suggesting that protein folding in the cell is a co-translational process1-5. However, the exact pathway that polypeptide chain follows during co-translational folding to achieve its functional form is still an enigma. In order to understand this process and to determine the exact conformation of the co-translational folding intermediates, it is essential to develop techniques that allow the isolation of RNCs carrying nascent chains of predetermined sizes to allow their further structural analysis.
SecM (secretion monitor) is a 170 amino acid E. coli protein that regulates expression of the downstream SecA (secretion driving) ATPase in the secM-secA operon6. Nakatogawa and Ito originally found that a 17 amino acid long sequence (150-FSTPVWISQAQGIRAGP-166) in the C-terminal region of the SecM protein is sufficient and necessary to cause stalling of SecM elongation at Gly165, thereby producing peptidyl-glycyl-tRNA stably bound to the ribosomal P-site7-9. More importantly, it was found that this 17 amino acid long sequence can be fused to the C-terminus of virtually any full-length and/or truncated protein thus allowing the production of RNCs carrying nascent chains of predetermined sizes7. Thus, when fused or inserted into the target protein, SecM stalling sequence produces arrest of the polypeptide chain elongation and generates stable RNCs both in vivo in E. coli cells and in vitro in a cell-free system. Sucrose gradient centrifugation is further utilized to isolate RNCs.
The isolated RNCs can be used to analyze structural and functional features of the co-translational folding intermediates. Recently, this technique has been successfully used to gain insights into the structure of several ribosome bound nascent chains10,11. Here we describe the isolation of bovine Gamma-B Crystallin RNCs fused to SecM and generated in an in vitro translation system.

We describe here a technique that is now routinely used to isolate stably bound ribosome nascent chain complexes (RNCs). This technique takes advantage of the discovery that a 17 amino acid long SecM "arrest sequence" can halt translation elongation in a prokaryotic (E. coli) system, when inserted into (or fused to the C-terminus) of virtually any protein.

Usar secuencias de detención SecM como una herramienta para aislar Ribosome polipéptidos enlazados

Extensive research has provided ample evidences suggesting that protein folding in the cell is a co-translational process1-5. However, the exact pathway ...

Rapid Genetic Analysis of Epithelial-Mesenchymal Signaling During Hair Regeneration

Hair follicle morphogenesis, a complex process requiring interaction between epithelia-derived keratinocytes and the underlying mesenchyme, is an attractive model system to study organ development and tissue-specific signaling. Although hair follicle development is genetically tractable, fast and reproducible analysis of factors essential for this process remains a challenge. Here we describe a procedure to generate targeted overexpression or shRNA-mediated knockdown of factors using lentivirus in a tissue-specific manner. Using a modified version of a hair regeneration model 5, 6, 11, we can achieve robust gain- or loss-of-function analysis in primary mouse keratinocytes or dermal cells to facilitate study of epithelial-mesenchymal signaling pathways that lead to hair follicle morphogenesis. We describe how to isolate fresh primary mouse keratinocytes and dermal cells, which contain dermal papilla cells and their precursors, deliver lentivirus containing either shRNA or cDNA to one of the cell populations, and combine the cells to generate fully formed hair follicles on the backs of nude mice. This approach allows analysis of tissue-specific factors required to generate hair follicles within three weeks and provides a fast and convenient companion to existing genetic models.

Tissue-specific analysis of a hair follicle regeneration model using lentivirus to mediate gain- or loss-of-function.

El análisis genético rápido de epitelio-mesenquimal de señalización durante la regeneración del cabello

Hair follicle morphogenesis, a complex process requiring interaction between epithelia-derived keratinocytes and the underlying mesenchyme, is an ...

Intravenous Injections in Neonatal Mice

Intravenous injection is a clinically applicable manner to deliver therapeutics. For adult rodents and larger animals, intravenous injections are technically feasible and routine. However, some mouse models can have early onset of disease with a rapid progression that makes administration of potential therapies difficult. The temporal (or facial) vein is just anterior to the ear bud in mice and is clearly visible for the first two days after birth on either side of the head using a dissecting microscope. During this window, the temporal vein can be injected with volumes up to 50 &#956;l. The injection is safe and well tolerated by both the pups and the dams. A typical injection procedure is completed within 1-2 min, after which the pup is returned to the home cage. By the third postnatal day the vein is difficult to visualize and the injection procedure becomes technically unreliable. This technique has been used for delivery of adeno-associated virus (AAV) vectors, which in turn can provide almost body-wide, stable transgene expression for the life of the animal depending on the viral serotype chosen.

Animal models of pediatric disease can experience early onset and aggressive disease progression. Clinically relevant therapy delivery to young mouse models can be technically difficult. This protocol describes a non-invasive intravenous injection method for newborn mice within the first two postnatal days of life.

Las inyecciones intravenosas en ratones recién nacidos

Intravenous injection is a clinically applicable manner to deliver therapeutics. For adult rodents and larger animals, intravenous injections are ...

Filtration Isolation of Nucleic Acids:  A Simple and Rapid DNA Extraction Method

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad to extract cellular DNA from whole blood in less than 2 min. The blood specimen is treated with detergent, mixed briefly and applied by pipet to the separation membrane. The lysate wicks into the blotting pad due to capillary action, capturing the genomic DNA on the surface of the separation membrane. The extracted DNA is retained on the membrane during a simple wash step wherein PCR inhibitors are wicked into the absorbent blotting pad. The membrane containing the entrapped DNA is then added to the PCR reaction without further purification. This simple method does not require laboratory equipment and can be easily implemented with inexpensive laboratory supplies. Here we describe a protocol for highly sensitive detection and quantitation of HIV-1 proviral DNA from 100 &#181;l whole blood as a model for early infant diagnosis of HIV that could readily be adapted to other genetic targets.

We describe here a simple and rapid paper-based DNA extraction method of HIV proviral DNA from whole blood detected by quantitative PCR. This protocol can be extended for use in detecting other genetic markers or using alternative amplification methods.

El aislamiento de filtración de ácidos nucleicos: A Extracción de ADN método sencillo y rápido

FINA, filtration isolation of nucleic acids, is a novel extraction method which utilizes vertical filtration via a separation membrane and absorbent pad ...

Cystometric and External Urethral Sphincter Measurements in Awake Rats with Implanted Catheter and Electrodes Allowing for Repeated Measurements

Lower urinary tract function is mainly assessed by means of cystometric bladder function analysis in rodents. Conventional cystometries are usually performed as terminal analysis under urethane anesthesia. It is well known that anesthetic drugs can influence bladder function. Hence, the aim of this technique is to perform cystometric measurements of the urinary bladder and external urethral sphincter in lightly restrained awake rats. For this purpose, a bladder catheter is implanted into the bladder dome. Subsequently, two electrodes are implanted bilateral to the external urethral sphincter and a ground electrode is sutured to a non-responsive skeletal muscle. The bladder catheter and the three electrodes are finally tunneled subcutaneously to the neck region and affixed to a harness. With this technique, the lower urinary tract can be measured at multiple time points in the same animal to assess lower urinary tract function. The main application of this technique is the follow-up of simultaneous urinary bladder and external urethral sphincter function in awake healthy rats and after induction of a disease or injury. Moreover, subsequent lower urinary tract monitoring can be performed during evaluation of the disease/injury and to monitor treatment efficacy.

This protocol first describes the surgical procedure of the permanent implantation of a urinary bladder catheter combined with external urethral sphincter electrodes, and second, the measurement of the function of the urinary bladder and external urethral sphincter in implanted awake animals.

Medición de esfínter uretral externo cistométrico en ratas despiertas con catéter implantado y electrodos para medidas repetidas

Lower urinary tract function is mainly assessed by means of cystometric bladder function analysis in rodents. Conventional cystometries are usually ...

Microbiota Analysis Using Two-step PCR and Next-generation 16S rRNA Gene Sequencing

The human gut is colonized by trillions of bacteria that support physiologic functions such as food metabolism, energy harvesting, and regulation of the immune system. Perturbation of the healthy gut microbiome has been suggested to play a role in the development of inflammatory diseases, including multiple sclerosis (MS). Environmental and genetic factors can influence the composition of the microbiome; therefore, identification of microbial communities linked with a disease phenotype has become the first step towards defining the microbiome&#8217;s role in health and disease. Use of 16S rRNA metagenomic sequencing for profiling bacterial community has helped in advancing microbiome research. Despite its wide use, there is no uniform protocol for 16S rRNA-based taxonomic profiling analysis. Another limitation is the low resolution of taxonomic assignment due to technical difficulties such as smaller sequencing reads, as well as use of only forward (R1) reads in the final analysis due to low quality of reverse (R2) reads. There is need for a simplified method with high resolution to characterize bacterial diversity in a given biospecimen. Advancements in sequencing technology with the ability to sequence longer reads at high resolution have helped to overcome some of these challenges. Present sequencing technology combined with a publicly available metagenomic analysis pipeline such as R-based Divisive Amplicon Denoising Algorithm-2 (DADA2) has helped advance microbial profiling at high resolution, as DADA2 can assign sequence at the genus and species levels. Described here is a guide for performing bacterial profiling using two-step amplification of the V3-V4 region of the 16S rRNA gene, followed by analysis using freely available analysis tools (i.e., DADA2, Phyloseq, and METAGENassist). It is believed that this simple and complete workflow will serve as an excellent tool for researchers interested in performing microbiome profiling studies.

Described here is a simplified standard operating procedure for microbiome profiling using 16S rRNA metagenomic sequencing and analysis using freely available tools. This protocol will help researchers who are new to the microbiome field as well as those requiring updates on methods to achieve bacterial profiling at a higher resolution.

Análisis de microbiota utilizando PCR de dos pasos y secuenciación genética de rRNA 16S de próxima generación

The human gut is colonized by trillions of bacteria that support physiologic functions such as food metabolism, energy harvesting, and regulation of the ...

En Vivo transfección siRNA y Gene Derribo en la médula espinal a través de Rapid no invasiva lumbar intratecal inyecciones en ratones

Resumen

Explorar más videos

Capítulos en este video